http://2010.igem.org/wiki/index.php?title=Special:Contributions/Minniss&feed=atom&limit=50&target=Minniss&year=&month=2010.igem.org - User contributions [en]2024-03-28T13:12:55ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:Harvard/partsTeam:Harvard/parts2010-10-27T17:36:38Z<p>Minniss: </p>
<hr />
<div>{{harvardmain}}<br />
<br />
<html><br />
<br />
<head><br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
</style><br />
</head><br />
<br />
<body><br />
<br />
<br><br><br />
<h1>parts</h1><br />
<br />
<table cellspacing="0" width="900"><br />
<br />
<tr><td><b></b></td><td><b>biobrick name</b></td><td><b>original name</b></td><td><b>description</b></td><td><b>resistance (bacteria)</b></td><td><b>resistance (plants)</b></td><td><b>sequence</b></td></tr> <br />
<br />
<tr><td>1</td><td>BBa_K382000</td><td>pORE Open Series Vector with BioBrick Sites</td><td>Agrobacterium vector open series with biobrick cloning site</td><td>kan</td><td>pat</td><td><a href="http://openwetware.org/images/3/3b/V7.gb">link</a></td></tr><br />
<br />
<tr><td>2</td><td>BBa_K382001</td><td>pORE Open Series Vector with BioBrick Sites</td><td>Agrobacterium vector open series with biobrick cloning site</td><td>kan</td><td>nptII</td><td><a href="http://openwetware.org/images/0/0f/V8.gb">link</a></td></tr><br />
<br />
<tr><td>3</td><td>BBa_K382002</td><td>pORE Expression Series Vector with BioBrick Sites</td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>kan</td><td>pat</td><td><a href="http://openwetware.org/images/d/d2/V9.gb">link</a></td></tr><br />
<br />
<tr><td>4</td><td>BBa_K382003</td><td>pORE Expression Series Vector with BioBrick Sites</td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>kan</td><td>nptII</td><td><a href="http://openwetware.org/images/3/33/V10.gb">link</a></td></tr><br />
<br />
<tr><td>5</td><td>BBa_K382004</td><td>pORE Reporter Series Vector with BioBrick Sites</td><td>Agrobacterium vector with gusA reporter and biobrick cloning site</td><td>kan</td><td>nptII</td><td><a href="http://openwetware.org/images/5/56/V11.gb">link</a></td></tr><br />
<br />
<tr><td>6</td><td>BBa_K382005</td><td>pORE Reporter Series Vector with BioBrick Sites</td><td>Agrobacterium vector with smgfp reporter and biobrick cloning site</td><td>kan</td><td>nptII</td><td><a href="http://openwetware.org/images/a/a8/V12.gb">link</a></td></tr><br />
<br />
<tr><td>7</td><td>BBa_K382010</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/b/b9/Lut2.txt">link</a></td></tr><br />
<br />
<tr><td>8</td><td>BBa_K382011</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/d/da/Beta-ophase.txt">link</a></td></tr><br />
<br />
<tr><td>9</td><td>BBa_K382012</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/0/0f/LYC.txt">link</a></td></tr><br />
<br />
<tr><td>10</td><td>BBa_K382014</td><td>ihpRNA Bet</td><td>Intron hairpin Bet Knockdown construct</td><td>amp</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt">link</a></td></tr><br />
<br />
<tr><td>11</td><td>BBa_K382015</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">link</a></td></tr><br />
<br />
<tr><td>12</td><td>BBa_K382017</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>amp</td><td>-</td><td> <a href="https://2010.igem.org/Team:Harvard/allergy/LTP.txt">link</a></td></tr><br />
<br />
<tr><td>13</td><td>BBa_K382018</td><td>PDK intron hairpin</td><td>Intron hairpin construct</td><td>amp</td><td>-</td><td><a href="http://partsregistry.org/Part:BBa_K382018">link</a></td></tr><br />
<br />
<tr><td>14</td><td>BBa_K382019</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">link</a></td></tr><br />
<br />
<tr><td>15</td><td>BBa_K382020</td><td><i>Arabidopsis</i>-optimized Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td>16</td><td>BBa_K382021</td><td><i>Arabidopsis</i>-optimized Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td>17</td><td>BBa_K382022</td><td>pENTCUP2 promoter</td><td>Plant specific promoter. Used to drive expression of our flavor constructs in plants. </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382022">link</a></td></tr><br />
<br />
<tr><td>18</td><td>BBa_K382023</td><td>NOSt terminator</td><td>Plant specific terminator. Terminates transcription but no stop codon on end.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382023">link</a></td></tr><br />
<br />
<tr><td>19</td><td>BBa_K382024</td><td>NOSt terminator + stop</td><td>Plant specific terminator. Terminates transcription with stop codon on 5' end.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382024">link</a></td></tr><br />
<br />
<tr><td>20</td><td>BBa_K382025</td><td><i>Arabidopsis</i>-optimized Miraculin StrepII N-terminus</td><td>Miraculin with StrepII tag on N-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382025">link</a></td></tr><br />
<br />
<tr><td>21</td><td>BBa_K382026</td><td><i>Arabidopsis</i>-optimized Brazzein StrepII N-terminus</td><td>Brazzein with StrepII tag on N-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382026">link</a></td></tr><br />
<br />
<tr><td>22</td><td>BBa_K382027</td><td><i>Arabidopsis</i>-optimized Miraculin StrepII C-terminus</td><td>Miraculin with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382027">link</a></td></tr><br />
<br />
<tr><td>23</td><td>BBa_K382028</td><td><i>Arabidopsis</i>-optimized Brazzein StrepII C-terminus</td><td>Brazzein with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382028">link</a></td></tr><br />
<br />
<tr><td>24</td><td>BBa_K382030</td><td>RXRHm</td><td>Human Retinoic Acid Receptor performs a function analogous to RXRLc. RXRHm has been shown to be sensitive to lower level of methoxyfenozide, but also to have higher background activation in the absence of methoxyfenozide.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f5">link</a></td></tr><br />
<br />
<tr><td>25</td><td>BBa_K382031</td><td>RXRLc<td> Part of the Locust Retinoic Acid Receptor and VP16 activation domain fusion protein. RXRLc binds EcR in presence of Methoxyfenozide</td><td>amp</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f4">link</a></td></tr><br />
<br />
<tr><td>26</td><td>BBa_K382033</td><td>Ecdysone Receptor</td><td> Part of the fusion protein of Ecdysone receptor and Gal4 DNA binding domain. Ecdysone receptor binds RXR-VP16 in presence of Methoxyfenozide </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f7">link</a></td></tr><br />
<br />
<tr><td>27</td><td>BBa_K382034</td><td>Act2pLacO</td><td>Actin promoter with LacO sites </td><td>amp</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f12">link</a></td></tr><br />
<br />
<tr><td>28</td><td>BBa_K382035</td><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f3">link</a></td></tr><br />
<br />
<tr><td>29</td><td>BBa_K382036</td><td>RXRHm</td><td>Human Retinoic Acid Receptor performs a function analogous to RXRLc. RXRHm has been shown to be sensitive to lower level of methoxyfenozide, but also to have higher background activation in the absence of methoxyfenozide.</td><td>amp</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f5">link</a></td></tr><br />
<br />
<tr><td>30</td><td>BBa_K382037</td><td>Ecdysone Receptor</td><td> Part of the fusion protein of Ecdysone receptor and Gal4 DNA binding domain. Ecdysone receptor binds RXR-VP16 in presence of Methoxyfenozide </td><td>amp</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f7">link</a></td></tr><br />
<br />
<tr><td>31</td><td>BBa_K382040</td><td><i>Arabidopsis</i>-optimized Miraculin YFP2x C-terminus</td><td>Miraculin with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/F7">link</a></td></tr><br />
<br />
<tr><td>32</td><td>BBa_K382041</td><td><i>Arabidopsis</i>-optimized Brazzein YFP2x C-terminus</td><td>Brazzein with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/F6">link</a></td></tr><br />
<br />
<tr><td>33</td><td>BBa_K382050</td><td><i>Arabidopsis</i>-optimized Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>kan</td><td>pat</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td>34</td><td>BBa_K382051</td><td><i>Arabidopsis</i>-optimized Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>kan</td><td>nptII</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td>35</td><td>BBa_K382052</td><td><i>Arabidopsis</i>-optimized Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>kan</td><td>pat</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td>36</td><td>BBa_K382053</td><td><i>Arabidopsis</i>-optimized Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>kan</td><td>nptII</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td>37</td><td>BBa_K382054</td><td>amiRNA GFP</td><td>amiRNA construct for GFP knockdown</td><td>kan</td><td>pat</td><td><a href="https://2010.igem.org/Team:Harvard/allergy/AmirnaGFP.txt">link</a></td></tr><br />
<br />
<tr><td>38</td><td>BBa_K382055</td><td>amiRNA GFP</td><td>amiRNA construct for GFP knockdown</td><td>kan</td><td>nptII</td><td><a href="https://2010.igem.org/Team:Harvard/allergy/AmirnaGFP.txt">link</a></td></tr><br />
<br />
<tr><td>39</td><td>BBa_K382058</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/b/b9/Lut2.txt">link</a></td></tr><br />
<br />
<tr><td>40</td><td>BBa_K382059</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/d/da/Beta-ophase.txt">link</a></td></tr><br />
<br />
<tr><td>41</td><td>BBa_K382060</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/0/0f/LYC.txt">link</a></td></tr><br />
<br />
<tr><td>42</td><td>BBa_K382061</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/b/b9/Lut2.txt">link</a></td></tr><br />
<br />
<tr><td>43</td><td>BBa_K382062</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/d/da/Beta-ophase.txt">link</a></td></tr><br />
<br />
<tr><td>44</td><td>BBa_K382063</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/0/0f/LYC.txt">link</a></td></tr><br />
<br />
<tr><td>45</td><td>BBa_K382064</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>kan</td><td>pat</td><td> <a href="https://2010.igem.org/Team:Harvard/allergy/LTP.txt">link</a></td></tr><br />
<br />
<tr><td>46</td><td>BBa_K382065</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>kan</td><td>nptII</td><td> <a href="https://2010.igem.org/Team:Harvard/allergy/LTP.txt">link</a></td></tr><br />
<br />
<tr><td>47</td><td>BBa_K382066</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">link</a></td></tr><br />
<br />
<tr><td>48</td><td>BBa_K382067</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">link</a></td></tr><br />
<br />
<tr><td>49</td><td>BBa_K382068</td><td>ihpRNA BetV1</td><td>Intron hairpin Bet Knockdown construct</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt">link</a></td></tr><br />
<br />
<tr><td>50</td><td>BBa_K382069</td><td>ihpRNA BetV1</td><td>Intron hairpin Bet Knockdown construct</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt">link</a></td></tr><br />
<br />
<tr><td>51</td><td>BBa_K382070</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">link</a></td></tr><br />
<br />
<tr><td>52</td><td>BBa_K382071</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">link</a></td></tr><br />
</table></div>Minnisshttp://2010.igem.org/Team:Harvard/partsTeam:Harvard/parts2010-10-27T17:35:42Z<p>Minniss: </p>
<hr />
<div>{{harvardmain}}<br />
<br />
<html><br />
<br />
<head><br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
</style><br />
</head><br />
<br />
<body><br />
<br />
<br><br><br />
<h1>parts</h1><br />
<br />
<table cellspacing="0" width="900"><br />
<br />
<tr><td><b></b></td><td><b>biobrick name</b></td><td><b>original name</b></td><td><b>description</b></td><td><b>resistance (bacteria)</b></td><td><b>resistance (plants)</b></td><td><b>sequence</b></td></tr> <br />
<br />
<tr><td>1</td><td>BBa_K382000</td><td>pORE Open Series Vector with BioBrick Sites</td><td>Agrobacterium vector open series with biobrick cloning site</td><td>kan</td><td>pat</td><td><a href="http://openwetware.org/images/3/3b/V7.gb">link</a></td></tr><br />
<br />
<tr><td>2</td><td>BBa_K382001</td><td>pORE Open Series Vector with BioBrick Sites</td><td>Agrobacterium vector open series with biobrick cloning site</td><td>kan</td><td>nptII</td><td><a href="http://openwetware.org/images/0/0f/V8.gb">link</a></td></tr><br />
<br />
<tr><td>3</td><td>BBa_K382002</td><td>pORE Expression Series Vector with BioBrick Sites</td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>kan</td><td>pat</td><td><a href="http://openwetware.org/images/d/d2/V9.gb">link</a></td></tr><br />
<br />
<tr><td>4</td><td>BBa_K382003</td><td>pORE Expression Series Vector with BioBrick Sites</td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>kan</td><td>nptII</td><td><a href="http://openwetware.org/images/3/33/V10.gb">link</a></td></tr><br />
<br />
<tr><td>5</td><td>BBa_K382004</td><td>pORE Reporter Series Vector with BioBrick Sites</td><td>Agrobacterium vector with gusA reporter and biobrick cloning site</td><td>kan</td><td>nptII</td><td><a href="http://openwetware.org/images/5/56/V11.gb">link</a></td></tr><br />
<br />
<tr><td>6</td><td>BBa_K382005</td><td>pORE Reporter Series Vector with BioBrick Sites</td><td>Agrobacterium vector with smgfp reporter and biobrick cloning site</td><td>kan</td><td>nptII</td><td><a href="http://openwetware.org/images/a/a8/V12.gb">link</a></td></tr><br />
<br />
<tr><td>7</td><td>BBa_K382010</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/b/b9/Lut2.txt">link</a></td></tr><br />
<br />
<tr><td>8</td><td>BBa_K382011</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/d/da/Beta-ophase.txt">link</a></td></tr><br />
<br />
<tr><td>9</td><td>BBa_K382012</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/0/0f/LYC.txt">link</a></td></tr><br />
<br />
<tr><td>10</td><td>BBa_K382014</td><td>ihpRNA Bet</td><td>Intron hairpin Bet Knockdown construct</td><td>amp</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt">link</a></td></tr><br />
<br />
<tr><td>11</td><td>BBa_K382015</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">link</a></td></tr><br />
<br />
<tr><td>12</td><td>BBa_K382017</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>amp</td><td>-</td><td> <a href="https://2010.igem.org/Team:Harvard/allergy/LTP.txt">link</a></td></tr><br />
<br />
<tr><td>13</td><td>BBa_K382018</td><td>PDK intron hairpin</td><td>Intron hairpin construct</td><td>amp</td><td>-</td><td><a href="http://partsregistry.org/Part:BBa_K382018">link</a></td></tr><br />
<br />
<tr><td>14</td><td>BBa_K382019</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">link</a></td></tr><br />
<br />
<tr><td>15</td><td>BBa_K382020</td><td><i>Arabidopsis</i>-optimized Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td>16</td><td>BBa_K382021</td><td><i>Arabidopsis</i>-optimized Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td>17</td><td>BBa_K382022</td><td>pENTCUP2 promoter</td><td>Plant specific promoter. Used to drive expression of our flavor constructs in plants. </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382022">link</a></td></tr><br />
<br />
<tr><td>18</td><td>BBa_K382023</td><td>NOSt terminator</td><td>Plant specific terminator. Terminates transcription but no stop codon on end.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382023">link</a></td></tr><br />
<br />
<tr><td>19</td><td>BBa_K382024</td><td>NOSt terminator + stop</td><td>Plant specific terminator. Terminates transcription with stop codon on 5' end.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382024">link</a></td></tr><br />
<br />
<tr><td>20</td><td>BBa_K382025</td><td><i>Arabidopsis</i>-optimized Miraculin StrepII N-terminus</td><td>Miraculin with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382025">link</a></td></tr><br />
<br />
<tr><td>21</td><td>BBa_K382026</td><td><i>Arabidopsis</i>-optimized Brazzein StrepII N-terminus</td><td>Brazzein with StrepII tag on N-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382026">link</a></td></tr><br />
<br />
<tr><td>22</td><td>BBa_K382027</td><td><i>Arabidopsis</i>-optimized Miraculin StrepII C-terminus</td><td>Miraculin with StrepII tag on N-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382027">link</a></td></tr><br />
<br />
<tr><td>23</td><td>BBa_K382028</td><td><i>Arabidopsis</i>-optimized Brazzein StrepII C-terminus</td><td>Brazzein with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382028">link</a></td></tr><br />
<br />
<tr><td>24</td><td>BBa_K382030</td><td>RXRHm</td><td>Human Retinoic Acid Receptor performs a function analogous to RXRLc. RXRHm has been shown to be sensitive to lower level of methoxyfenozide, but also to have higher background activation in the absence of methoxyfenozide.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f5">link</a></td></tr><br />
<br />
<tr><td>25</td><td>BBa_K382031</td><td>RXRLc<td> Part of the Locust Retinoic Acid Receptor and VP16 activation domain fusion protein. RXRLc binds EcR in presence of Methoxyfenozide</td><td>amp</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f4">link</a></td></tr><br />
<br />
<tr><td>26</td><td>BBa_K382033</td><td>Ecdysone Receptor</td><td> Part of the fusion protein of Ecdysone receptor and Gal4 DNA binding domain. Ecdysone receptor binds RXR-VP16 in presence of Methoxyfenozide </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f7">link</a></td></tr><br />
<br />
<tr><td>27</td><td>BBa_K382034</td><td>Act2pLacO</td><td>Actin promoter with LacO sites </td><td>amp</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f12">link</a></td></tr><br />
<br />
<tr><td>28</td><td>BBa_K382035</td><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f3">link</a></td></tr><br />
<br />
<tr><td>29</td><td>BBa_K382036</td><td>RXRHm</td><td>Human Retinoic Acid Receptor performs a function analogous to RXRLc. RXRHm has been shown to be sensitive to lower level of methoxyfenozide, but also to have higher background activation in the absence of methoxyfenozide.</td><td>amp</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f5">link</a></td></tr><br />
<br />
<tr><td>30</td><td>BBa_K382037</td><td>Ecdysone Receptor</td><td> Part of the fusion protein of Ecdysone receptor and Gal4 DNA binding domain. Ecdysone receptor binds RXR-VP16 in presence of Methoxyfenozide </td><td>amp</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f7">link</a></td></tr><br />
<br />
<tr><td>31</td><td>BBa_K382040</td><td><i>Arabidopsis</i>-optimized Miraculin YFP2x C-terminus</td><td>Miraculin with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/F7">link</a></td></tr><br />
<br />
<tr><td>32</td><td>BBa_K382041</td><td><i>Arabidopsis</i>-optimized Brazzein YFP2x C-terminus</td><td>Brazzein with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/F6">link</a></td></tr><br />
<br />
<tr><td>33</td><td>BBa_K382050</td><td><i>Arabidopsis</i>-optimized Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>kan</td><td>pat</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td>34</td><td>BBa_K382051</td><td><i>Arabidopsis</i>-optimized Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>kan</td><td>nptII</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td>35</td><td>BBa_K382052</td><td><i>Arabidopsis</i>-optimized Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>kan</td><td>pat</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td>36</td><td>BBa_K382053</td><td><i>Arabidopsis</i>-optimized Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>kan</td><td>nptII</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td>37</td><td>BBa_K382054</td><td>amiRNA GFP</td><td>amiRNA construct for GFP knockdown</td><td>kan</td><td>pat</td><td><a href="https://2010.igem.org/Team:Harvard/allergy/AmirnaGFP.txt">link</a></td></tr><br />
<br />
<tr><td>38</td><td>BBa_K382055</td><td>amiRNA GFP</td><td>amiRNA construct for GFP knockdown</td><td>kan</td><td>nptII</td><td><a href="https://2010.igem.org/Team:Harvard/allergy/AmirnaGFP.txt">link</a></td></tr><br />
<br />
<tr><td>39</td><td>BBa_K382058</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/b/b9/Lut2.txt">link</a></td></tr><br />
<br />
<tr><td>40</td><td>BBa_K382059</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/d/da/Beta-ophase.txt">link</a></td></tr><br />
<br />
<tr><td>41</td><td>BBa_K382060</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/0/0f/LYC.txt">link</a></td></tr><br />
<br />
<tr><td>42</td><td>BBa_K382061</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/b/b9/Lut2.txt">link</a></td></tr><br />
<br />
<tr><td>43</td><td>BBa_K382062</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/d/da/Beta-ophase.txt">link</a></td></tr><br />
<br />
<tr><td>44</td><td>BBa_K382063</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/0/0f/LYC.txt">link</a></td></tr><br />
<br />
<tr><td>45</td><td>BBa_K382064</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>kan</td><td>pat</td><td> <a href="https://2010.igem.org/Team:Harvard/allergy/LTP.txt">link</a></td></tr><br />
<br />
<tr><td>46</td><td>BBa_K382065</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>kan</td><td>nptII</td><td> <a href="https://2010.igem.org/Team:Harvard/allergy/LTP.txt">link</a></td></tr><br />
<br />
<tr><td>47</td><td>BBa_K382066</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">link</a></td></tr><br />
<br />
<tr><td>48</td><td>BBa_K382067</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">link</a></td></tr><br />
<br />
<tr><td>49</td><td>BBa_K382068</td><td>ihpRNA BetV1</td><td>Intron hairpin Bet Knockdown construct</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt">link</a></td></tr><br />
<br />
<tr><td>50</td><td>BBa_K382069</td><td>ihpRNA BetV1</td><td>Intron hairpin Bet Knockdown construct</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt">link</a></td></tr><br />
<br />
<tr><td>51</td><td>BBa_K382070</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>kan</td><td>pat</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">link</a></td></tr><br />
<br />
<tr><td>52</td><td>BBa_K382071</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>kan</td><td>nptII</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">link</a></td></tr><br />
</table></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382028Team:Harvard/BBa K3820282010-10-27T02:11:46Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>Brazzein with StrepII C-terminus tag Sequence</h1><br />
<br />
ATGCAAGATAAGTGTAAAAAAGTGTATGAGAACTATCCTGTGAGTAAATGCCAATTGGCA<br />
AACCAGTGCAATTATGATTGTAAACTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTAT<br />
GATGAGAAGAGGAACCTCCAGTGTATCTGTGATTATTGTGAGTATACTAGAAGTGCTTGG<br />
TCTCACCCACAATTCGAAAAG<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382027Team:Harvard/BBa K3820272010-10-27T02:11:14Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>Miraculin with StrepII C-terminus tag Sequence</h1><br />
<br />
ATGAAGGAGCTTACCATGCTTTCACTTTCTTTTTTCTTCGTGTCTGCTCTTTTGGCTGCT<br />
GCTGCTAACCCTCTTTTGTCTGCTGCTGATTCTGCTCCAAACCCTGTTCTCGATATCGAT<br />
GGAGAGAAATTGAGAACCGGAACAAACTATTATATCGTGCCTGTGCTTAGAGATCACGG<br />
TGGAGGACTCACTGTTAGTGCTACTACTCCAAACGGAACCTTCGTGTGTCCACCTAGAG<br />
TTGTTCAGACTAGGAAGGAAGTGGATCATGATAGACCACTCGCTTTTTTCCCTGAAAAT<br />
CCTAAAGAGGATGTTGTTAGAGTTTCTACCGATTTGAACATCAACTTTTCTGCTTTCATG<br />
CCTTGTAGATGGACCTCTTCAACTGTGTGGAGACTCGATAAGTATGATGAGTCTACCGG<br />
ACAGTATTTCGTGACTATCGGAGGAGTGAAGGGTAATCCTGGTCCTGAGACTATTAGTT<br />
CTTGGTTTAAAATCGAGGAGTTCTGTGGATCTGGTTTCTATAAACTTGTGTTTTGCCCAA<br />
CTGTGTGTGGATCTTGTAAAGTGAAATGTGGTGATGTGGGAATCTATATCGATCAAAAG<br />
GGAAGGAGGAGACTTGCTTTGTCTGATAAGCCTTTCGCTTTCGAGTTCAACAAAACCGT<br />
TTATTTCACTAGAAGTGCTTGGTCTCACCCACAATTCGAAAAG<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382026Team:Harvard/BBa K3820262010-10-27T02:10:48Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>Brazzein with StrepII N-terminus tag Sequence</h1><br />
<br />
AGTGCTTGGTCTCACCCACAATTCGAAAAGACTAGAATGCAAGATAAGTGTAAAAAAGTG<br />
TATGAGAACTATCCTGTGAGTAAATGCCAATTGGCAAACCAGTGCAATTATGATTGTAAA<br />
CTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTATGATGAGAAGAGGAACCTCCAGTGT<br />
ATCTGTGATTATTGTGAGTAT<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382025Team:Harvard/BBa K3820252010-10-27T02:09:48Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>Miraculin with StrepII N-terminus tag Sequence</h1><br />
<br />
AGTGCTTGGTCTCACCCACAATTCGAAAAGACTAGAATGAAGGAGCTTACCATGCTTTCA<br />
CTTTCTTTTTTCTTCGTGTCTGCTCTTTTGGCTGCTGCTGCTAACCCTCTTTTGTCTGCTG<br />
CTGATTCTGCTCCAAACCCTGTTCTCGATATCGATGGAGAGAAATTGAGAACCGGAACAA<br />
ACTATTATATCGTGCCTGTGCTTAGAGATCACGGTGGAGGACTCACTGTTAGTGCTACTA<br />
CTCCAAACGGAACCTTCGTGTGTCCACCTAGAGTTGTTCAGACTAGGAAGGAAGTGGATC<br />
ATGATAGACCACTCGCTTTTTTCCCTGAAAATCCTAAAGAGGATGTTGTTAGAGTTTCTAC<br />
CGATTTGAACATCAACTTTTCTGCTTTCATGCCTTGTAGATGGACCTCTTCAACTGTGTGG<br />
AGACTCGATAAGTATGATGAGTCTACCGGACAGTATTTCGTGACTATCGGAGGAGTGAAG<br />
GGTAATCCTGGTCCTGAGACTATTAGTTCTTGGTTTAAAATCGAGGAGTTCTGTGGATCTG<br />
GTTTCTATAAACTTGTGTTTTGCCCAACTGTGTGTGGATCTTGTAAAGTGAAATGTGGTGA<br />
TGTGGGAATCTATATCGATCAAAAGGGAAGGAGGAGACTTGCTTTGTCTGATAAGCCTTT<br />
CGCTTTCGAGTTCAACAAAACCGTTTATTTC<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382025Team:Harvard/BBa K3820252010-10-27T02:09:34Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1><i>Arabidopsis</i> optimized Miraculin with StrepII N-terminus tag Sequence</h1><br />
<br />
AGTGCTTGGTCTCACCCACAATTCGAAAAGACTAGAATGAAGGAGCTTACCATGCTTTCA<br />
CTTTCTTTTTTCTTCGTGTCTGCTCTTTTGGCTGCTGCTGCTAACCCTCTTTTGTCTGCTG<br />
CTGATTCTGCTCCAAACCCTGTTCTCGATATCGATGGAGAGAAATTGAGAACCGGAACAA<br />
ACTATTATATCGTGCCTGTGCTTAGAGATCACGGTGGAGGACTCACTGTTAGTGCTACTA<br />
CTCCAAACGGAACCTTCGTGTGTCCACCTAGAGTTGTTCAGACTAGGAAGGAAGTGGATC<br />
ATGATAGACCACTCGCTTTTTTCCCTGAAAATCCTAAAGAGGATGTTGTTAGAGTTTCTAC<br />
CGATTTGAACATCAACTTTTCTGCTTTCATGCCTTGTAGATGGACCTCTTCAACTGTGTGG<br />
AGACTCGATAAGTATGATGAGTCTACCGGACAGTATTTCGTGACTATCGGAGGAGTGAAG<br />
GGTAATCCTGGTCCTGAGACTATTAGTTCTTGGTTTAAAATCGAGGAGTTCTGTGGATCTG<br />
GTTTCTATAAACTTGTGTTTTGCCCAACTGTGTGTGGATCTTGTAAAGTGAAATGTGGTGA<br />
TGTGGGAATCTATATCGATCAAAAGGGAAGGAGGAGACTTGCTTTGTCTGATAAGCCTTT<br />
CGCTTTCGAGTTCAACAAAACCGTTTATTTC<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382024Team:Harvard/BBa K3820242010-10-27T02:08:44Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>NosT terminator with STOP codon Sequence</h1><br />
<br />
TGAGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTT<br />
GCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAA<br />
TGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAA<br />
TACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTC<br />
ATCTATGTTACTAGATC<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382024Team:Harvard/BBa K3820242010-10-27T02:08:13Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>NosT plant specific terminator with STOP codon Sequence</h1><br />
<br />
TGAGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTT<br />
GCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAA<br />
TGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAA<br />
TACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTC<br />
ATCTATGTTACTAGATC<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382023Team:Harvard/BBa K3820232010-10-27T02:07:35Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>NosT plant specific terminator Sequence</h1><br />
<br />
GATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCG<br />
ATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCA<br />
TGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGC<br />
GATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTAT<br />
GTTACTAGATC<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382022Team:Harvard/BBa K3820222010-10-27T02:07:07Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>pENTCUP2 plant specific promoter Sequence</h1><br />
<br />
GGGATCTTCTGCAAGCATCTCTATTTCCTGAAGGTCTAACCTCGAAGATTTAAGATTTAA<br />
TTACGTTTATAATTACAAAATTGATTCTAGTATCTTTAATTTAATGCTTATACATTATTAA<br />
TTAATTTAGTACTTTCAATTTGTTTTCAGAAATTATTTTACTATTTTTTATAAAATAAAAG<br />
GGAGAAAATGGCTATTTAAATACTAGCCTATTTTATTTCAATTTTAGCTTAAAATCAGCC<br />
CCAATTAGCCCCAATTTCAAATTCAAATGGTCCAGCCCAATTCCTAAATAACCCACCCCT<br />
AACCCGCCCGGTTTCCCCTTTTGATCCATGCAGTCAACGCCCAGAATTTCCCTATATAAT<br />
TTTTTAATTCCCAAACACCCCTAACTCTATCCCATTTCTCACCAACCGCCACATAGATCT<br />
ATCCTCTTATCTCTCAAACTCTCTCGAACCTTCCCCTAACCCTAGCAGCCTCTCATCATC<br />
CTCACCTCAAAACCCACCGGA<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382021Team:Harvard/BBa K3820212010-10-27T02:06:31Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1><i>Arabidopsis</i> optimized Miraculin Sequence</h1><br />
<br />
ATGAAGGAGCTTACCATGCTTTCACTTTCTTTTTTCTTCGTGTCTGCTCTTTTGGCTGCT<br />
GCTGCTAACCCTCTTTTGTCTGCTGCTGATTCTGCTCCAAACCCTGTTCTCGATATCGA<br />
TGGAGAGAAATTGAGAACCGGAACAAACTATTATATCGTGCCTGTGCTTAGAGATCACG<br />
GTGGAGGACTCACTGTTAGTGCTACTACTCCAAACGGAACCTTCGTGTGTCCACCTAGA<br />
GTTGTTCAGACTAGGAAGGAAGTGGATCATGATAGACCACTCGCTTTTTTCCCTGAAAA<br />
TCCTAAAGAGGATGTTGTTAGAGTTTCTACCGATTTGAACATCAACTTTTCTGCTTTCAT<br />
GCCTTGTAGATGGACCTCTTCAACTGTGTGGAGACTCGATAAGTATGATGAGTCTACCG<br />
GACAGTATTTCGTGACTATCGGAGGAGTGAAGGGTAATCCTGGTCCTGAGACTATTAGT<br />
TCTTGGTTTAAAATCGAGGAGTTCTGTGGATCTGGTTTCTATAAACTTGTGTTTTGCCCA<br />
ACTGTGTGTGGATCTTGTAAAGTGAAATGTGGTGATGTGGGAATCTATATCGATCAAAA<br />
GGGAAGGAGGAGACTTGCTTTGTCTGATAAGCCTTTCGCTTTCGAGTTCAACAAAACCG<br />
TTTATTTC<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382020Team:Harvard/BBa K3820202010-10-27T02:05:46Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1><i>Arabidopsis</i> optimized Brazzein Sequence</h1><br />
<br />
ATGCAAGATAAGTGTAAAAAAGTGTATGAGAACTATCCTGTGAGTAAATGCCAATTGGCA<br />
AACCAGTGCAATTATGATTGTAAACTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTAT<br />
GATGAGAAGAGGAACCTCCAGTGTATCTGTGATTATTGTGAGTAT<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/BBa_K382020Team:Harvard/BBa K3820202010-10-27T02:05:25Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>Arabidopsis optimized Brazzein Sequence</h1><br />
<br />
ATGCAAGATAAGTGTAAAAAAGTGTATGAGAACTATCCTGTGAGTAAATGCCAATTGGCA<br />
AACCAGTGCAATTATGATTGTAAACTCGATAAGCACGCTAGGAGTGGAGAGTGTTTCTAT<br />
GATGAGAAGAGGAACCTCCAGTGTATCTGTGATTATTGTGAGTAT<br />
<br />
<br/><br/><br />
<a href="https://2010.igem.org/Team:Harvard/flavor/parts">back to flavor parts</a><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/partsTeam:Harvard/parts2010-10-27T00:51:29Z<p>Minniss: </p>
<hr />
<div>{{Harvard_css}}<br />
{{Harvard_topbar}}<br />
<html><br />
<br />
<head><br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
</style><br />
</head><br />
<br />
<body><br />
<br />
<br><br><br />
<h1>parts</h1><br />
<br />
<table cellspacing="0" width="900"><br />
<br />
<tr><td><b>name</b></td><td><b>biobrick name</b></td><td><b>original name</b></td><td><b>description</b></td><td><b>resistance (bacteria)</b></td><td><b>resistance (plants)</b></td><td><b>sequence</b></td></tr> <br />
<br />
<tr><td>V7</td><td>BBa_K382000</td><td>pORE Open Series Vector with BioBrick Sites (kan/pat)</td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/3/3b/V7.gb"> V7 </a></td></tr><br />
<br />
<tr><td>V8</td><td>BBa_K382001</td><td>pORE Open Series Vector with BioBrick Sites (kan/nptII)</td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/0/0f/V8.gb"> V8 </a></td></tr><br />
<br />
<tr><td>V9</td><td>BBa_K382002</td><td>pORE Expression Series Vector with BioBrick Sites (kan/pat)</td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/d/d2/V9.gb"> V9 </a></td></tr><br />
<br />
<tr><td>V10</td><td>BBa_K382003</td><td>pORE Expression Series Vector with BioBrick Sites (kan/nptII)</td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/3/33/V10.gb"> V10 </a></td></tr><br />
<br />
<tr><td>V11</td><td>BBa_K382004</td><td>pORE Reporter Series Vector with BioBrick Sites (kan/nptII)</td><td>Agrobacterium vector with gusA reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/5/56/V11.gb"> V11 </a></td></tr><br />
<br />
<tr><td>V12</td><td>BBa_K382005</td><td>pORE Reporter Series Vector with BioBrick Sites (kan/nptII)</td><td>Agrobacterium vector with smgfp reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/a/a8/V12.gb"> V12 </a></td></tr><br />
<br />
<tr><td>C1</td><td>BBa_K382010</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/2/24/BBa_K382026_C1.txt">amiRNA LUT2</a></td></tr><br />
<br />
<tr><td>C2</td><td>BBa_K382011</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f2/BBa_K382027_C2.txt">amiRNA BETA-OHASE 1</a></td></tr><br />
<br />
<tr><td>C3</td><td>BBa_K382012</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f8/BBa_K382028_C3.txt">amiRNA LYC</a></td></tr><br />
<br />
<tr><td>A3</td><td>BBa_K382014</td><td>ihpRNA Bet</td><td>Intron hairpin Bet Knockdown construct</td><td>ampicillin</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<br />
<tr><td>A4</td><td>BBa_K382015</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">ihpRNA LTP</a></td></tr><br />
<br />
<tr><td>A2</td><td>BBa_K382017</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>ampicillin</td><td>-</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<br />
<tr><td>A4</td><td>BBa_K382018</td><td>PDK intron hairpin</td><td>Intron hairpin construct</td><td>ampicillin</td><td>-</td><td><a href=</a></td></tr><br />
<br />
<tr><td>A5</td><td>BBa_K382019</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">ihpRNA GER</a></td></tr><br />
<br />
<tr><td>F4</td><td>BBa_K382020</td><td>Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td>F5</td><td>BBa_K382021</td><td>Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td>F1</td><td>BBa_K382022</td><td>pENTCUP2 promoter</td><td>Plant specific promoter. Used to drive expression of our flavor constructs in plants. </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382022">link</a></td></tr><br />
<br />
<tr><td>F2</td><td>BBa_K382023</td><td>NOSt terminator</td><td>Plant specific terminator. Terminates transcription but no stop codon on end.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382023">link</a></td></tr><br />
<br />
<tr><td>F3</td><td>BBa_K382024</td><td>NOSt terminator + stop</td><td>Plant specific terminator. Terminates transcription with stop codon on 5' end.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382024">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382025</td><td>Miraculin StrepII N-terminus</td><td>Miraculin with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382027">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382026</td><td>Brazzein StrepII N-terminus</td><td>Brazzein with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382028">link</a></td></tr><br />
<br />
<tr><td>F9</td><td>BBa_K382027</td><td>Miraculin StrepII C-terminus</td><td>Miraculin with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382027">link</a></td></tr><br />
<br />
<tr><td>F8</td><td>BBa_K382028</td><td>Brazzein StrepII C-terminus</td><td>Brazzein with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382028">link</a></td></tr><br />
<br />
<tr><td>GF5</td><td>BBa_K382030</td><td>RXRHm</td><td>Human Retinoic Acid Receptor performs a function analogous to RXRLc. RXRHm has been shown to be sensitive to lower level of methoxyfenozide, but also to have higher background activation in the absence of methoxyfenozide.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f5">link</a></td></tr><br />
<br />
<tr><td>GF4</td><td>BBa_K382031</td><td>RXRLc<td> Part of the Locust Retinoic Acid Receptor and VP16 activation domain fusion protein. RXRLc binds EcR in presence of Methoxyfenozide</td><td>ampicillin</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f4">link</a></td></tr><br />
<br />
<tr><tr><td></td><td>BBa_K382033</td><td>Ecdysone Receptor</td><td> Part of the fusion protein of Ecdysone receptor and Gal4 DNA binding domain. Ecdysone receptor binds RXR-VP16 in presence of Methoxyfenozide </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f7">link</a></td></tr><br />
<br />
<tr><tr><td></td><td>BBa_K382034</td><td>Act2pLacO</td><td>Actin promoter with LacO sites </td><td>ampicillin</td><td>-</td><td><a href="">link</a></td></tr><br />
<br />
<tr><td>GF3</td><td>BBa_K382035</td><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f3">link</a></td></tr><br />
<br />
<tr><td>GF4</td><td>BBa_K382031</td><td>RXRLc<td> Part of the Locust Retinoic Acid Receptor and VP16 activation domain fusion protein. RXRLc binds EcR in presence of Methoxyfenozide</td><td>ampicillin</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f4">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382035</td><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f3">link</a></td></tr><br />
<br />
<tr><td>GF5</td><td>BBa_K382036</td><td>RXRHm</td><td>Human Retinoic Acid Receptor performs a function analogous to RXRLc. RXRHm has been shown to be sensitive to lower level of methoxyfenozide, but also to have higher background activation in the absence of methoxyfenozide.</td><td>ampicillin</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f5">link</a></td></tr><br />
<br />
<tr><tr><td></td><td>BBa_K382037</td><td>Ecdysone Receptor</td><td> Part of the fusion protein of Ecdysone receptor and Gal4 DNA binding domain. Ecdysone receptor binds RXR-VP16 in presence of Methoxyfenozide </td><td>ampicillin</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f7">link</a></td></tr><br />
<br />
<tr><td>F6</td><td>BBa_K382040</td><td>Brazzein YFP2x C-terminus</td><td>Brazzein with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/F6">link</a></td></tr><br />
<br />
<tr><td>F7</td><td>BBa_K382041</td><td>Miraculin YFP2x C-terminus</td><td>Miraculin with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/F7">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382050</td><td>Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382051</td><td>Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382052</td><td>Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382053</td><td>Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>kan (bacteria) / nptII (plant)</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382054</td><td>amiRNA GFP</td><td>amiRNA construct for GFP knockdown</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="">amiRNA LUT2</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382055</td><td>amiRNA GFP</td><td>amiRNA construct for GFP knockdown</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="">amiRNA LUT2</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382058</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/2/24/BBa_K382026_C1.txt">amiRNA LUT2</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382059</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f2/BBa_K382027_C2.txt">amiRNA BETA-OHASE 1</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382060</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f8/BBa_K382028_C3.txt">amiRNA LYC</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382061</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/2/24/BBa_K382026_C1.txt">amiRNA LUT2</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382062</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f2/BBa_K382027_C2.txt">amiRNA BETA-OHASE 1</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382063</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f8/BBa_K382028_C3.txt">amiRNA LYC</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382064</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382065</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382066</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">ihpRNA GER</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382067</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">ihpRNA GER</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382068</td><td>ihpRNA BetV1</td><td>Intron hairpin Bet Knockdown construct</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<br />
<br />
<tr><td></td><td>BBa_K382069</td><td>ihpRNA BetV1</td><td>Intron hairpin Bet Knockdown construct</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382070</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">ihpRNA LTP</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382071</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">ihpRNA LTP</a></td></tr><br />
</table></div>Minnisshttp://2010.igem.org/Team:Harvard/partsTeam:Harvard/parts2010-10-27T00:47:51Z<p>Minniss: </p>
<hr />
<div>{{Harvard_css}}<br />
{{Harvard_topbar}}<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
</style><br />
<br />
<div id="abstract"><br />
<br><br><br />
<h1>parts</h1><br />
<br />
<table cellspacing="0" width="900"><br />
<br />
<tr><td><b>name</b></td><td><b>biobrick name</b></td><td><b>original name</b></td><td><b>description</b></td><td><b>resistance (bacteria)</b></td><td><b>resistance (plants)</b></td><td><b>sequence</b></td></tr> <br />
<br />
<tr><td>V7</td><td>BBa_K382000</td><td>pORE Open Series Vector with BioBrick Sites (kan/pat)</td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/3/3b/V7.gb"> V7 </a></td></tr><br />
<br />
<tr><td>V8</td><td>BBa_K382001</td><td>pORE Open Series Vector with BioBrick Sites (kan/nptII)</td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/0/0f/V8.gb"> V8 </a></td></tr><br />
<br />
<tr><td>V9</td><td>BBa_K382002</td><td>pORE Expression Series Vector with BioBrick Sites (kan/pat)</td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/d/d2/V9.gb"> V9 </a></td></tr><br />
<br />
<tr><td>V10</td><td>BBa_K382003</td><td>pORE Expression Series Vector with BioBrick Sites (kan/nptII)</td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/3/33/V10.gb"> V10 </a></td></tr><br />
<br />
<tr><td>V11</td><td>BBa_K382004</td><td>pORE Reporter Series Vector with BioBrick Sites (kan/nptII)</td><td>Agrobacterium vector with gusA reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/5/56/V11.gb"> V11 </a></td></tr><br />
<br />
<tr><td>V12</td><td>BBa_K382005</td><td>pORE Reporter Series Vector with BioBrick Sites (kan/nptII)</td><td>Agrobacterium vector with smgfp reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/a/a8/V12.gb"> V12 </a></td></tr><br />
<br />
<tr><td>C1</td><td>BBa_K382010</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/2/24/BBa_K382026_C1.txt">amiRNA LUT2</a></td></tr><br />
<br />
<tr><td>C2</td><td>BBa_K382011</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f2/BBa_K382027_C2.txt">amiRNA BETA-OHASE 1</a></td></tr><br />
<br />
<tr><td>C3</td><td>BBa_K382012</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f8/BBa_K382028_C3.txt">amiRNA LYC</a></td></tr><br />
<br />
<tr><td>A3</td><td>BBa_K382014</td><td>ihpRNA Bet</td><td>Intron hairpin Bet Knockdown construct</td><td>ampicillin</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<br />
<tr><td>A4</td><td>BBa_K382015</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">ihpRNA LTP</a></td></tr><br />
<br />
<tr><td>A2</td><td>BBa_K382017</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>ampicillin</td><td>-</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<br />
<tr><td>A4</td><td>BBa_K382018</td><td>PDK intron hairpin</td><td>Intron hairpin construct</td><td>ampicillin</td><td>-</td><td><a href=</a></td></tr><br />
<br />
<tr><td>A5</td><td>BBa_K382019</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">ihpRNA GER</a></td></tr><br />
<br />
<tr><td>F4</td><td>BBa_K382020</td><td>Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td>F5</td><td>BBa_K382021</td><td>Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td>F1</td><td>BBa_K382022</td><td>pENTCUP2 promoter</td><td>Plant specific promoter. Used to drive expression of our flavor constructs in plants. </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382022">link</a></td></tr><br />
<br />
<tr><td>F2</td><td>BBa_K382023</td><td>NOSt terminator</td><td>Plant specific terminator. Terminates transcription but no stop codon on end.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382023">link</a></td></tr><br />
<br />
<tr><td>F3</td><td>BBa_K382024</td><td>NOSt terminator + stop</td><td>Plant specific terminator. Terminates transcription with stop codon on 5' end.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382024">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382025</td><td>Miraculin StrepII N-terminus</td><td>Miraculin with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382027">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382026</td><td>Brazzein StrepII N-terminus</td><td>Brazzein with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382028">link</a></td></tr><br />
<br />
<tr><td>F9</td><td>BBa_K382027</td><td>Miraculin StrepII C-terminus</td><td>Miraculin with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382027">link</a></td></tr><br />
<br />
<tr><td>F8</td><td>BBa_K382028</td><td>Brazzein StrepII C-terminus</td><td>Brazzein with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382028">link</a></td></tr><br />
<br />
<tr><td>GF5</td><td>BBa_K382030</td><td>RXRHm</td><td>Human Retinoic Acid Receptor performs a function analogous to RXRLc. RXRHm has been shown to be sensitive to lower level of methoxyfenozide, but also to have higher background activation in the absence of methoxyfenozide.</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f5">link</a></td></tr><br />
<br />
<tr><td>GF4</td><td>BBa_K382031</td><td>RXRLc<td> Part of the Locust Retinoic Acid Receptor and VP16 activation domain fusion protein. RXRLc binds EcR in presence of Methoxyfenozide</td><td>ampicillin</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f4">link</a></td></tr><br />
<br />
<tr><tr><td></td><td>BBa_K382033</td><td>Ecdysone Receptor</td><td> Part of the fusion protein of Ecdysone receptor and Gal4 DNA binding domain. Ecdysone receptor binds RXR-VP16 in presence of Methoxyfenozide </td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f7">link</a></td></tr><br />
<br />
<tr><tr><td></td><td>BBa_K382034</td><td>Act2pLacO</td><td>Actin promoter with LacO sites </td><td>ampicillin</td><td>-</td><td><a href="">link</a></td></tr><br />
<br />
<tr><td>GF3</td><td>BBa_K382035</td><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f3">link</a></td></tr><br />
<br />
<tr><td>GF4</td><td>BBa_K382031</td><td>RXRLc<td> Part of the Locust Retinoic Acid Receptor and VP16 activation domain fusion protein. RXRLc binds EcR in presence of Methoxyfenozide</td><td>ampicillin</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f4">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382035</td><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f3">link</a></td></tr><br />
<br />
<tr><td>GF5</td><td>BBa_K382036</td><td>RXRHm</td><td>Human Retinoic Acid Receptor performs a function analogous to RXRLc. RXRHm has been shown to be sensitive to lower level of methoxyfenozide, but also to have higher background activation in the absence of methoxyfenozide.</td><td>ampicillin</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f5">link</a></td></tr><br />
<br />
<tr><tr><td></td><td>BBa_K382037</td><td>Ecdysone Receptor</td><td> Part of the fusion protein of Ecdysone receptor and Gal4 DNA binding domain. Ecdysone receptor binds RXR-VP16 in presence of Methoxyfenozide </td><td>ampicillin</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/f7">link</a></td></tr><br />
<br />
<tr><td>F6</td><td>BBa_K382040</td><td>Brazzein YFP2x C-terminus</td><td>Brazzein with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/F6">link</a></td></tr><br />
<br />
<tr><td>F7</td><td>BBa_K382041</td><td>Miraculin YFP2x C-terminus</td><td>Miraculin with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/F7">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382050</td><td>Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382051</td><td>Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382052</td><td>Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382053</td><td>Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>kan (bacteria) / nptII (plant)</td><td>-</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382054</td><td>amiRNA GFP</td><td>amiRNA construct for GFP knockdown</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="">amiRNA LUT2</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382055</td><td>amiRNA GFP</td><td>amiRNA construct for GFP knockdown</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="">amiRNA LUT2</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382058</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/2/24/BBa_K382026_C1.txt">amiRNA LUT2</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382059</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f2/BBa_K382027_C2.txt">amiRNA BETA-OHASE 1</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382060</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f8/BBa_K382028_C3.txt">amiRNA LYC</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382061</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2) knockdown</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/2/24/BBa_K382026_C1.txt">amiRNA LUT2</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382062</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f2/BBa_K382027_C2.txt">amiRNA BETA-OHASE 1</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382063</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/f/f8/BBa_K382028_C3.txt">amiRNA LYC</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382064</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382065</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382066</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">ihpRNA GER</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382067</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">ihpRNA GER</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382068</td><td>ihpRNA BetV1</td><td>Intron hairpin Bet Knockdown construct</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<br />
<br />
<tr><td></td><td>BBa_K382069</td><td>ihpRNA BetV1</td><td>Intron hairpin Bet Knockdown construct</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382070</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>kan (bacteria)/pat (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">ihpRNA LTP</a></td></tr><br />
<br />
<tr><td></td><td>BBa_K382071</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>kan (bacteria)/nptII (plant)</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">ihpRNA LTP</a></td></tr></div>Minnisshttp://2010.igem.org/Team:Harvard/fences/designTeam:Harvard/fences/design2010-10-27T00:29:12Z<p>Minniss: </p>
<hr />
<div>{{HarvardFancybox}}<br />
{{harvard_fence}}<br />
<br />
<br />
<html><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>design</h1><br />
<p>The genetic fence combines a chemically-activated gene switch with inhibition of a fatal gene pathway. In the presence of the fence compound, methoxyfenozide, the genetic switch activates transcription of an inhibitory mechanism, which halts an otherwise fatal gene pathway.</p><br />
<br />
<br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td><br />
<div>Genetic Fence Figure 2 &nbsp; <a href="http://openwetware.org/images/6/6c/Flowchart_Jamboree_slide.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="http://openwetware.org/images/6/6c/Flowchart_Jamboree_slide.jpg" id="single_image"><br />
<img src="http://openwetware.org/images/6/6c/Flowchart_Jamboree_slide.jpg" width="300px" border=0><br />
</a><br />
</td><br />
</tr><br />
</table><br />
<br />
<br />
<br />
<p><br />
<b>fatal gene</b><br />
<br><br />
<p><br />
A protein called <a href="http://en.wikipedia.org/wiki/Barnase">Barnase</a> prevents plants from growing outside the fence. Barnase, a non-specific RNAse, cleaves all pieces of RNA it encounters in the cell, thus derailing the cell’s metabolism and causing it to die. Barnase is expressed constitutively in all iGarden plants, so in the absence of Methoxyfenozide none will grow.<br />
</p><br />
<br><br />
<br><br />
<b>inhibitor</b><br />
<br><br />
<p><br />
A protein called <a href="http://en.wikipedia.org/wiki/Barstar">Barstar</a> inhibits Barnase. When expressed in cells, Barstar prevents Barnase from destroying the iGarden plants. By putting Barstar under control of the switch-activated promoter (5xGal4 Upstream Activating Sequence plus 35s minimal promoter), barstar is expressed in the presence of Methoxyfenozide.<br />
</p><br />
<p><br />
In addition to protein inhibition, a second switch-activated promoter regulates expression of a Lac Inhibitor Protein modified with a nuclear localization signal (LacIN). LacIN halts the transcription of the otherwise constitutive Actin2 promoter modified to include LacO sites (Act2LacO promoter). Barnase is placed under control of Act2LacO, so that it is expressed unless LacIN is present as well. Through LacIN and Barstar, Barnase is inhibited at both the transcriptional and the protein levels in the cell.<br />
<br><br />
<br><br />
<b>sensor</b><br />
<br><br />
<p><br />
The sensor component of the fence activates gene transcription in the presence of the fence compound Methoxyfenozide. Two receptor proteins, Ecdysone (EcR) and Retinoic Acid (RXR), form a dimer in the presense of methoxyfenozide. We created two fusion proteins, one combining Ecdysone with VP16 activating domain (which recruits the machinery to start transcription), and one combining Retinoic Acid with Gal4 DNA binding domain (which binds to a specific stretch of DNA where transcription will begin). When Methoxyfenozide dimerizes Ecdysone and Retinoic Acid, VP16 activating domain and Gal4 DNA binding domain act together to initiate transcription of Barstar and LacIN.<br />
</p><br />
<br><br />
<br><br />
<p><br />
Thus, Methoxyfenozide activates the sensor, which results in Barstar and LacIN expression, which inhibits Barnase, allowing the plant to grow.<br />
</p><br />
<br />
<br />
<html><br />
<div id="abstract"><br />
<table style="padding:10px;color:#254117"><br />
<tr><br />
<td width="33%"><br />
<!--<br />
<div>Genetic Fence Flowchart: Full &nbsp; <a href="http://openwetware.org/images/8/80/GeneticFenceFlowChart_Full.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="http://openwetware.org/images/8/80/GeneticFenceFlowChart_Full.jpg" id="single_image"><br />
<img src="http://openwetware.org/images/8/80/GeneticFenceFlowChart_Full.jpg" width="300px" border=0><br />
</a><br />
--><br />
</td><br />
<br />
<br />
<div>Genetic Fence Design &nbsp; <a href="http://openwetware.org/images/f/fc/Updated_Jamboree_slides.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="<br />
http://openwetware.org/images/f/fc/Updated_Jamboree_slides.jpg" id="single_image"><br />
<img src="<br />
http://openwetware.org/images/f/fc/Updated_Jamboree_slides.jpg" width="300px" border=0><br />
</tr><br />
<br />
<td width="33%"><br />
<br /><br /><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</a><br />
</td><br />
<br />
<br />
</table><br />
</div><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/color/resultsTeam:Harvard/color/results2010-10-27T00:26:10Z<p>Minniss: </p>
<hr />
<div>{{Harvard_color}}<br />
<br />
<br />
<html><br />
<div id="abstract"><br />
<h1>results</h1><br />
<p>Our RNAi constructs have been inserted into the BioBrick expression series vector. They have been transformed into <i>Arabidopsis</i> and we are awaiting results.</p><br />
<br />
<p>Here is the latest photo of our seeds:<br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Harvardsprouts.jpg" /><br />
</p><br />
<br/><br />
<br />
</div><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/color/inhibitionTeam:Harvard/color/inhibition2010-10-27T00:24:57Z<p>Minniss: </p>
<hr />
<div>{{Harvard_jquery}}<br />
{{Harvard_color}}<br />
<br />
<br />
<html><br />
<head><br />
<script type="text/javascript"><br />
$(document).ready(function() {<br />
$("#tabs").tabs();<br />
});<br />
</script><br />
</head><br />
<br />
<div id="abstract"><br />
<h1>engineering metabolic pathways</h1><br />
<p>Our goal is to accumulate the pigments lycopene and beta-carotene in the petals of <i>Arabidopsis</i>, and we plan to do so by inhibiting the enzymes lycopene epsilon cyclase (LUT2), carotene beta-ring hydroxylase (BETA-OHASE 1), and lycopene beta cyclase (LYC) via artificial microRNA interference. Ordinarily, these pigments are intermediates in the carotenoid biosynthesis pathway, and we hope that by interfering with the pathway, we can cause an abnormal accumulation of these intermediates and thus produce color.</p><br />
<br />
<div id="tabs" style="font-size:1.0em"><br />
<ul style="height:50px"><br />
<style>a{width:100px};</style><br />
<li><a href="#1"><span>scheme #1</span></a></li><br />
<li><a href="#2"><span>scheme #2</span></a></li><br />
<li><a href="#3"><span>scheme #3</span></a></li><br />
<li><a href="#4"><span>scheme #4</span></a></li><br />
</ul><br />
<div id="1"><br />
<p>In our first scheme, we will knock out LUT2 on its own. We hope that this will induce accumulation of lycopene.</p><br/><br/><br />
<img src="https://static.igem.org/mediawiki/2010/9/9f/Ath00906_carotenoid_1.png" width="550px"><br />
</div><br />
<div id="2"><br />
<p>In our second scheme, we will knock out BETA-OHASE 1 on its own. We hope that this will induce accumulation of beta-carotene.</p><br/><br/><br />
<img src="https://static.igem.org/mediawiki/2010/6/6b/Ath00906_carotenoid_2.png" width="550px"><br />
</div><br />
<div id="3"><br />
<p>In our third scheme, we will knock out both LUT2 and BETA-OHASE1. We hope that this will induce accumulation of some lycopene and some beta-carotene.</p><br/><br />
<img src="https://static.igem.org/mediawiki/2010/5/5e/Ath00906_carotenoid_3.png" width="550px"><br />
</div><br />
<div id="4"><br />
<p>In our fourth scheme, we will knock out both LUT2 and LYC. We hope that this will induce accumulation of lycopene.</p><br/><br/><br />
<img src="https://static.igem.org/mediawiki/2010/5/5e/Ath00906_carotenoid_4.png" width="550px"><br />
</div><br />
</div><br />
<br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/color/metabolismTeam:Harvard/color/metabolism2010-10-27T00:23:51Z<p>Minniss: </p>
<hr />
<div>{{HarvardFancybox}}<br />
{{Harvard_color}}<br />
<br />
<br />
<html><br />
<div id="abstract"><br />
<h1>pigment metabolism</h1><br />
<p>In pigment metabolism, a series of enzymes catalyze the transform of one metabolite to the next, forming a pathway. Metabolic pathways are often very complex, containing many branch points, loops, and interactions between separate pathways. Below is a map of carotenoid metabolism. The enzymes in green are those found in <i>Arabidopsis</i>.</p> <br />
<a href="https://static.igem.org/mediawiki/2010/9/94/Ath00906_carotenoid.png" id="single_image"><img src="https://static.igem.org/mediawiki/2010/9/94/Ath00906_carotenoid.png" width="600px"></a><br />
</div><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/colorTeam:Harvard/color2010-10-27T00:21:08Z<p>Minniss: </p>
<hr />
<div>{{Harvard_color}}<br />
<br />
<br />
<html><br />
<div id="abstract"><br />
<h1>abstract</h1><br />
<p>One of the most interesting properties of plants is their immense metabolic capability. Some of the most important metabolites of plants are pigments which aid in photosynthesis, many of which confer color upon the plant tissue. In this sub-project, we aim to alter the color of <i>Arabidopsis</i> flowers via accumulation of such pigments.</p><br />
<p>Our target pigments are two elements of the carotenoid metabolic pathway - <a href="http://en.wikipedia.org/wiki/Lycopene">lycopene (red)</a> and <a href="http://en.wikipedia.org/wiki/Betacarotene">beta-carotene (orange)</a>. We aim to accumulate these compounds by using RNA interference to knock down enzymes catalyzing the steps in the metabolic pathway that use use pigments as precursors. We have targeted three enzymes for knockdown, and will express these knockdown constructs using a petal specific promoter to localize pigment accumulation</p><br />
<p>The vision for this sub-project is to not only produce an interesting feature, but also to develop a system in which we can color-code our constructs and provide unique visual markers for plants that express differing traits that cannot be detected visually. In addition, as many carotenoids are also important micronutrients, we may be able to use this mechanism to improve the nutritional content of target plants.</p><br />
<br/><br />
<img src="https://static.igem.org/mediawiki/2010/f/ff/Teamcolor.png" width="600px" /><br />
</div><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/flavor/resultsTeam:Harvard/flavor/results2010-10-27T00:19:47Z<p>Minniss: </p>
<hr />
<div>{{HarvardFancybox}}<br />
{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<div id=”abstract><br />
<h1>confirmation results</h1><br />
<img href=”image location:><br />
<br />
<p><br />
The two flavors that are currently ready for transformation into plants are the "taste-inverter" <a href="http://en.wikipedia.org/wiki/Miraculin">miraculin</a> and the sweetener <a href="http://en.wikipedia.org/wiki/Brazzein">brazzein</a>. Given the long time-frame of plant transformation we used two different assays in <i>E. Coli</i> to confirm that our proteins could indeed be transcribed and translated. The results of those assays are shown here.<br />
</p><br />
<br />
<br />
<h2>confirmation with 2xYFP tags</h2><br />
<br />
<p><br />
In order to confirm that miraculin and brazzein are able to be expressed in <i>E. Coli</i>, we attached a 2xYFP tag sequence to both the N- and C-termini of each protein. The proteins were placed under an IPTG-expressible promoter, and spectrophotometry was used to determine the level of YFP fluorescence against a baseline, untagged protein. Figure 1 shows relative-fluorescence at times post induction. In all circumstances the levels of YFP-fluorescence increased.<br />
</p><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>Figure 1 &nbsp; <a href="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br />
<br/><br />
<u>Figure 1. Induced expression of YFP-tagged Miraculin and Brazzein in <i>E. Coli</i></u></br><br />
Figure 1 (A) through (D) are normalized plots of miraculin and brazzein YFP-fused constructs expressed in E. Coli. 2xYFP tags were attached to either N- or C- terminus to ensure that folding was not hindered. In all cases relative YFP fluorescence had appreciably increased after 120 minutes as compared to the non-induced <i>E. Coli</i><br />
</td><br />
</tr><br />
</table><br />
<br />
<h2>confirmation by western blot</h2><br />
<br />
<p><br />
A western blot assay was performed to check for <i>E. Coli</i> expression of miraculin and brazzein. Proteins tagged at either the N- or C- terminus were placed under the control of an IPTG-inducible promoter. In the miraculin assay, no protein expression was seen. It is possible that the protein does not express well in <i>E. Coli</i>, or that the plant-specific codon optimization of the proteins resulted in reduced expressibility. Brazzein, specifically C-terminus tagged brazzein was seen to be highly expressed in <i>E. Coli</i>.<br />
</p><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>Figure 2 &nbsp; <a href="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br />
<br/><br />
<u>Figure 2. Western Blot of Miraculin and Brazzein Expression in <i>E. Coli</i></u></br><br />
Proteins were tagged using a standard <i>StrepII</i> tag, attached to either the N- or C- terminus. Miraculin (A) does not appear to have been expressed in high enough quantities to be visualized. The expected protein weight is 25 kDa. Brazzein (B) shows strong expression of a protein in the 10-15 kDa range. Brazzein has an expected weight of 6.5 kDa, a discrepancy that we have attributed to inconsistencies in the gel.<br />
</td><br />
</tr><br />
</table><br />
<br />
<h2>expression in <i>Arabidopsis</i></h2><br />
<p>We are still waiting for the plants to grow to a size large enough that we can collect samples to verify expression, but we have selected for plants that have integrated the glufosinate resistance marker along with the miraculin and brazzein expression constructs.</p><br />
<br />
<div><strong>Miraculin:</strong> <a href="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><br />
<a href="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" width="300px" border=0><br />
</a><br />
<br />
<div><strong>Brazzein:</strong> <a href="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><br />
<a href="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" width="300px" border=0><br />
</a><br />
</br><br />
</br><br />
</br><br />
<br />
<p><center><b>Stay tuned to our Wiki for updates!</b></center></p><br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/flavor/resultsTeam:Harvard/flavor/results2010-10-27T00:17:58Z<p>Minniss: </p>
<hr />
<div>{{HarvardFancybox}}<br />
{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<div id=”abstract><br />
<h1>confirmation results</h1><br />
<img href=”image location:><br />
<br />
<p><br />
The two flavors that are currently ready for transformation into plants are the "taste-inverter" <a href="http://en.wikipedia.org/wiki/Miraculin">miraculin</a> and the sweetener <a href="http://en.wikipedia.org/wiki/Brazzein">brazzein</a>. Given the long time-frame of plant transformation we used two different assays in <i>E. Coli</i> to confirm that our proteins could indeed be transcribed and translated. The results of those assays are shown here.<br />
</p><br />
<br />
<br />
<h2>confirmation with YFP-2x tags</h2><br />
<br />
<p><br />
In order to confirm that miraculin and brazzein are able to be expressed in <i>E. Coli</i>, we attached a YFP-2x tag sequence to both the N- and C-termini of each protein. The proteins were placed under an IPTG-expressible promoter, and spectrophotometry was used to determine the level of YFP fluorescence against a baseline, untagged protein. Figure 1 shows relative-fluorescence at times post induction. In all circumstances the levels of YFP-fluorescence increased.<br />
</p><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>Figure 1 &nbsp; <a href="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br />
<br/><br />
<u>Figure 1. Induced expression of YFP-tagged Miraculin and Brazzein in <i>E. Coli</i></u></br><br />
Figure 1 (A) through (D) are normalized plots of miraculin and brazzein YFP-fused constructs expressed in E. Coli. YFP-2x tags were attached to either N- or C- terminus to ensure that folding was not hindered. In all cases relative YFP fluorescence had appreciably increased after 120 minutes as compared to the non-induced <i>E. Coli</i><br />
</td><br />
</tr><br />
</table><br />
<br />
<h2>confirmation by western blot</h2><br />
<br />
<p><br />
A western blot assay was performed to check for <i>E. Coli</i> expression of miraculin and brazzein. Proteins tagged at either the N- or C- terminus were placed under the control of an IPTG-inducible promoter. In the miraculin assay, no protein expression was seen. It is possible that the protein does not express well in <i>E. Coli</i>, or that the plant-specific codon optimization of the proteins resulted in reduced expressibility. Brazzein, specifically C-terminus tagged brazzein was seen to be highly expressed in <i>E. Coli</i>.<br />
</p><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>Figure 2 &nbsp; <a href="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br />
<br/><br />
<u>Figure 2. Western Blot of Miraculin and Brazzein Expression in <i>E. Coli</i></u></br><br />
Proteins were tagged using a standard <i>StrepII</i> tag, attached to either the N- or C- terminus. Miraculin (A) does not appear to have been expressed in high enough quantities to be visualized. The expected protein weight is 25 kDa. Brazzein (B) shows strong expression of a protein in the 10-15 kDa range. Brazzein has an expected weight of 6.5 kDa, a discrepancy that we have attributed to inconsistencies in the gel.<br />
</td><br />
</tr><br />
</table><br />
<br />
<h2>expression in <i>Arabidopsis</i></h2><br />
<p>We are still waiting for the plants to grow to a size large enough that we can collect samples to verify expression, but we have selected for plants that have integrated the glufosinate resistance marker along with the miraculin and brazzein expression constructs.</p><br />
<br />
<div><strong>Miraculin:</strong> <a href="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><br />
<a href="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" width="300px" border=0><br />
</a><br />
<br />
<div><strong>Brazzein:</strong> <a href="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><br />
<a href="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" width="300px" border=0><br />
</a><br />
</br><br />
</br><br />
</br><br />
<br />
<p><center><b>Stay tuned to our Wiki for updates!</b></center></p><br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/flavor/resultsTeam:Harvard/flavor/results2010-10-27T00:16:58Z<p>Minniss: </p>
<hr />
<div>{{HarvardFancybox}}<br />
{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<div id=”abstract><br />
<h1>confirmation results</h1><br />
<img href=”image location:><br />
<br />
<p><br />
The two flavors that are currently ready for transformation into plants are the "taste-inverter" <a href:"http://en.wikipedia.org/wiki/Miraculin">miraculin</a> and the sweetener <a href="http://en.wikipedia.org/wiki/Brazzein">brazzein</a>. Given the long time-frame of plant transformation we used two different assays in <i>E. Coli</i> to confirm that our proteins could indeed be transcribed and translated. The results of those assays are shown here.<br />
</p><br />
<br />
<br />
<h2>confirmation with <i>YFP-2x</i> tags</h2><br />
<br />
<p><br />
In order to confirm that miraculin and brazzein are able to be expressed in <i>E. Coli</i>, we attached a <i>YFP-2x</i> tag sequence to both the N- and C-termini of each protein. The proteins were placed under an IPTG-expressible promoter, and spectrophotometry was used to determine the level of YFP fluorescence against a baseline, untagged protein. Figure 1 shows relative-fluorescence at times post induction. In all circumstances the levels of YFP-fluorescence increased.<br />
</p><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>Figure 1 &nbsp; <a href="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br />
<br/><br />
<u>Figure 1. Induced expression of YFP-tagged Miraculin and Brazzein in <i>E. Coli</i></u></br><br />
Figure 1 (A) through (D) are normalized plots of miraculin and brazzein YFP-fused constructs expressed in E. Coli. <i>YFP-2x</i> tags were attached to either N- or C- terminus to ensure that folding was not hindered. In all cases relative YFP fluorescence had appreciably increased after 120 minutes as compared to the non-induced <i>E. Coli</i><br />
</td><br />
</tr><br />
</table><br />
<br />
<h2>confirmation by western blot</h2><br />
<br />
<p><br />
A western blot assay was performed to check for <i>E. Coli</i> expression of miraculin and brazzein. Proteins tagged at either the N- or C- terminus were placed under the control of an IPTG-inducible promoter. In the miraculin assay, no protein expression was seen. It is possible that the protein does not express well in <i>E. Coli</i>, or that the plant-specific codon optimization of the proteins resulted in reduced expressibility. Brazzein, specifically C-terminus tagged brazzein was seen to be highly expressed in <i>E. Coli</i>.<br />
</p><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>Figure 2 &nbsp; <a href="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br />
<br/><br />
<u>Figure 2. Western Blot of Miraculin and Brazzein Expression in <i>E. Coli</i></u></br><br />
Proteins were tagged using a standard <i>StrepII</i> tag, attached to either the N- or C- terminus. Miraculin (A) does not appear to have been expressed in high enough quantities to be visualized. The expected protein weight is 25 kDa. Brazzein (B) shows strong expression of a protein in the 10-15 kDa range. Brazzein has an expected weight of 6.5 kDa, a discrepancy that we have attributed to inconsistencies in the gel.<br />
</td><br />
</tr><br />
</table><br />
<br />
<h2>expression in <i>Arabidopsis</i></h2><br />
<p>We are still waiting for the plants to grow to a size large enough that we can collect samples to verify expression, but we have selected for plants that have integrated the glufosinate resistance marker along with the miraculin and brazzein expression constructs.</p><br />
<br />
<div><strong>Miraculin:</strong> <a href="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><br />
<a href="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" width="300px" border=0><br />
</a><br />
<br />
<div><strong>Brazzein:</strong> <a href="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><br />
<a href="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" width="300px" border=0><br />
</a><br />
</br><br />
</br><br />
</br><br />
<br />
<p><center><b>Stay tuned to our Wiki for updates!</b></center></p><br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/flavor/resultsTeam:Harvard/flavor/results2010-10-27T00:16:16Z<p>Minniss: </p>
<hr />
<div>{{HarvardFancybox}}<br />
{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<div id=”abstract><br />
<h1>confirmation results</h1><br />
<img href=”image location:><br />
<br />
<p><br />
The two flavors that are currently ready for transformation into plants are the "taste-inverter" <a href:"http://en.wikipedia.org/wiki/Miraculin">miraculin</a> and the sweetener <a href="http://en.wikipedia.org/wiki/Brazzein">brazzein</a>. Given the long time-frame of plant transformation we used two different assays in <i>E. Coli</i> to confirm that our proteins could indeed be transcribed and translated. The results of those assays are shown here.<br />
</p><br />
<br />
<br />
<h2>confirmation with <i>YFP-2x</i> tags</h2><br />
<br />
<p><br />
In order to confirm that miraculin and brazzein are able to be expressed in <i>E. Coli</i>, we attached a <i>YFP-2x</i> tag sequence to both the N- and C-termini of each protein. The proteins were placed under an IPTG-expressible promoter, and spectrophotometry was used to determine the level of YFP fluorescence against a baseline, untagged protein. Figure 1 shows relative-fluorescence at times post induction. In all circumstances the levels of YFP-fluorescence increased.<br />
</p><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>Figure 1 &nbsp; <a href="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/7/77/YFP_Fig_1-crop.jpg" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br />
<br/><br />
<u>Figure 1. Induced expression of YFP-tagged Miraculin and Brazzein in E. Coli</u></br><br />
Figure 1 (A) through (D) are normalized plots of miraculin and brazzein YFP-fused constructs expressed in E. Coli. <i>YFP-2x</i> tags were attached to either N- or C- terminus to ensure that folding was not hindered. In all cases relative YFP fluorescence had appreciably increased after 120 minutes as compared to the non-induced <i>E. Coli</i><br />
</td><br />
</tr><br />
</table><br />
<br />
<h2>confirmation by western blot</h2><br />
<br />
<p><br />
A western blot assay was performed to check for <i>E. Coli</i> expression of miraculin and brazzein. Proteins tagged at either the N- or C- terminus were placed under the control of an IPTG-inducible promoter. In the miraculin assay, no protein expression was seen. It is possible that the protein does not express well in <i>E. Coli</i>, or that the plant-specific codon optimization of the proteins resulted in reduced expressibility. Brazzein, specifically C-terminus tagged brazzein was seen to be highly expressed in <i>E. Coli</i>.<br />
</p><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>Figure 2 &nbsp; <a href="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/a/af/Western_Fig_2-crop.jpg" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br />
<br/><br />
<u>Figure 2. Western Blot of Miraculin and Brazzein Expression in <i>E. Coli</i></u></br><br />
Proteins were tagged using a standard <i>StrepII</i> tag, attached to either the N- or C- terminus. Miraculin (A) does not appear to have been expressed in high enough quantities to be visualized. The expected protein weight is 25 kDa. Brazzein (B) shows strong expression of a protein in the 10-15 kDa range. Brazzein has an expected weight of 6.5 kDa, a discrepancy that we have attributed to inconsistencies in the gel.<br />
</td><br />
</tr><br />
</table><br />
<br />
<h2>expression in <i>Arabidopsis</i></h2><br />
<p>We are still waiting for the plants to grow to a size large enough that we can collect samples to verify expression, but we have selected for plants that have integrated the glufosinate resistance marker along with the miraculin and brazzein expression constructs.</p><br />
<br />
<div><strong>Miraculin:</strong> <a href="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><br />
<a href="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/5/53/V21selection.jpg" width="300px" border=0><br />
</a><br />
<br />
<div><strong>Brazzein:</strong> <a href="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" id="single_image" style="font-size:12px">click to enlarge</a></div><br />
<a href="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" width="300px" border=0><br />
</a><br />
</br><br />
</br><br />
</br><br />
<br />
<p><center><b>Stay tuned to our Wiki for updates!</b></center></p><br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/flavor/partsTeam:Harvard/flavor/parts2010-10-27T00:15:19Z<p>Minniss: </p>
<hr />
<div>{{Harvard_flavor}}<br />
<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
<br />
</style><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>parts and primers</h1><br />
<h2>Primers</h2><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Description</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>J45004_F</td><td>Wintergreen pathway part. Encodes SAM benzoic acid/salicylic acid carboxyl methyltransferase I. Forward primer</td><td><a href="https://2010.igem.org/Team:Harvard/J45004_F">link</a></td></tr><br />
<tr><td>J45004_R</td><td>Wintergreen pathway part. Encodes SAM benzoic acid/salicylic acid carboxyl methyltransferase I. Reverse primer</td><td><a href="https://2010.igem.org/Team:Harvard/J45004_R">link</a></td></tr><br />
<tr><td>J45017_F</td><td>Wintergreen pathway part. Encodes an isochorismate pyruvate-lyase and an isochorismate synthase. Forward primer</td><td><a href="https://2010.igem.org/Team:Harvard/J45017_F">link</a></td></tr><br />
<tr><td>J45017_R</td><td>Wintergreen pathway part. Encodes an isochorismate pyruvate-lyase and an isochorismate synthase. Reverse primer</td><td><a href="https://2010.igem.org/Team:Harvard/J45017_R">link</a></td></tr><br />
<tr><td>NOSterm_BB_F</td><td>Plant specific terminator forward primer</td><td><a href="https://2010.igem.org/Team:Harvard/NOSterm_BB_F">link</a></td></tr><br />
<tr><td>NOSterm_BB_R</td><td>Plant specific terminator reverse primer</td><td><a href="https://2010.igem.org/Team:Harvard/NOSterm_BB_R">link</a></td></tr><br />
<tr><td>Stop_NOSterm_BB_F</td><td>NOSt plant specific terminator with stop codon on end</td><td><a href="https://2010.igem.org/Team:Harvard/Stop_NOSterm_BB_F">link</a></td></tr><br />
<tr><td>pENTCUP2_BB_F</td><td>Plant specific promoter forward primer</td><td><a href="https://2010.igem.org/Team:Harvard/pENTCUP2_BB_F">link</a></td></tr><br />
<tr><td>pENTCUP2_BB_R</td><td>Plant specific promoter reverse primer</td><td><a href="https://2010.igem.org/Team:Harvard/pENTCUP2_BB_R">link</a></td></tr><br />
<br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<br />
</style><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h2>Parts</h2><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Description</b></td><td><b>Length</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>BBa_K382020</td><td><i>Arabidopsis</i> optimized Brazzein</td><td>196</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382020">link</a></td></tr><br />
<tr><td>BBa_K382021</td><td><i>Arabidopsis</i> optimized Miraculin</td><td>660</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382021">link</a></td></tr><br />
<tr><td>BBa_K382022</td><td>pENTCUP2 plant specific promoter</td><td>503</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382022">link</a></td></tr><br />
<tr><td>BBa_K382023</td><td>NosT plant specific terminator</td><td>253</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382023">link</a></td></tr><br />
<tr><td>BBa_K382024</td><td>NosT plant specific terminator with STOP codon</td><td>256</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382024">link</a></td></tr><br />
<tr><td>BBa_K382025</td><td><i>Arabidopsis</i> optimized Miraculin with StrepII N-terminus tag</td><td>696</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382025">link</a></td></tr><br />
<tr><td>BBa_K382026</td><td><i>Arabidopsis</i> optimized Brazzein with StrepII N-terminus tag</td><td>201</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382026">link</a></td></tr><br />
<tr><td>BBa_K382027</td><td><i>Arabidopsis</i> optimized Miraculin with StrepII C-terminus tag</td><td>696</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382027">link</a></td></tr><br />
<tr><td>BBa_K382028</td><td><i>Arabidopsis</i> optimized Brazzein with StrepII C-terminus tag</td><td>201</td><td><a href="https://2010.igem.org/Team:Harvard/BBa_K382028">link</a></td></tr><br />
<br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/flavor/flavorsTeam:Harvard/flavor/flavors2010-10-27T00:11:28Z<p>Minniss: </p>
<hr />
<div>{{HarvardFancybox}}<br />
{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<div id=”Flavors"><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>flavors</h1><br />
<p>Flavors are perhaps to most interactive parts of the iGarden project. We currently have 2 flavors inserted into plants that are currently growing, with options and ideas for an additional three.</p><br />
<br />
<br><br />
<h2>miraculin</h2><br />
<br />
<p> Miraculin is a 'flavor inverting' protein, found naturally in the fruit of the plant <i>Synsepalum dulcificum</i>. Not sweet by itself, miraculin binds to taste receptors on the tongue, possibly altering the structure of the receptors and causing traditionally 'sour' flavors to be received as 'sweet'. </p><br />
<br />
<p> We have obtained, synthesized and BioBricked the DNA sequence of miraculin. This has allowed us to work with it in the usual BioBrick fashion, facilitating insertion into the agrobacterium expression vector.</p> <br />
<br />
<p> Preliminary <a href="https://2010.igem.org/Team:Harvard/flavor/results">tests</a> in <i>E. Coli</i> have been positive, with our YFP-tagged proteins showing definite expression </p><br />
<br><br />
<h2>brazzein</h2><br />
<br />
<p> Brazzein is a sweet-tasting protein that is found in the Western African fruit, the Oubli. The protein consists of a 54 amino acid sequence. It is sweeter than sugar and is used as an alternative low calorie sweetener. </p><br />
<br />
<p> We have obtained, synthesized and BioBricked the DNA sequence of brazzein. We were then able to flank this sequence with a plant specific promoter and terminator and insert this construct into the agrobacterium expression vector. </p><br />
<br />
<p> Preliminary tests in <i>E. Coli</i> have been positive, with our YFP-tagged proteins showing definite expression and a Western Blot also showing successful expression of brazzein. </p><br />
<br><br />
<h2>valencene</h2><br />
<br />
<p> We originally tried to extract RNA from Valencia oranges and then make a cDNA library. We then used PCR to amplify the Valencene sequence. Valencene is a gene that codes for a molecule that gives Valencia oranges their citrus flavor and aroma. </p><br />
<br />
<p> Unfortunately, after three attempts, we were not able to obtain a viable cDNA library. We then tried to extract genomic DNA. However, none of our PCR tries worked from the genomic DNA. We therefore plan to synthesize the valencene synthase gene based on available sequences.</p><br />
<br />
<br><br />
<br />
<h2>wintergreen</h2><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>wintergreen expression system &nbsp; <a href="https://static.igem.org/mediawiki/2010/b/bd/Wintergreen_pathway.png" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/b/bd/Wintergreen_pathway.png" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/b/bd/Wintergreen_pathway.png" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top<br />
<p style="padding:10px">The MIT 2006 iGEM team created a BioBricked system to express methyl salicyate, a mint smelling compound. By swapping-in plant specific promoters and inserting the system into the pORE open vector, we would be able to create mint-smelling plants. </p></td><br />
</tr><br />
<br />
</table><br />
<br />
<h2>banana</h2><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>banana expression system &nbsp; <a href="https://static.igem.org/mediawiki/2010/a/ab/BBa_J45200.png" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/a/ab/BBa_J45200.png" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/BBa_J45200.png" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br />
The Banana Scent pathway is also from the MIT 2006 iGEM team and is another example of how the iGarden system is well suited for the modular nature of the Parts Registry. Through addition of plant-specific promoters, and use of the now-BioBrick compatible pORE vectors, banana smelling plants could be achieved.<br />
</p></td><br />
</tr><br />
<br />
</table><br />
<br />
<br />
<img href=”image location:><br />
</div><br />
</div><br />
</div><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/flavor/flavorsTeam:Harvard/flavor/flavors2010-10-27T00:10:51Z<p>Minniss: </p>
<hr />
<div>{{HarvardFancybox}}<br />
{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<div id=”Flavors"><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>flavors</h1><br />
<p>Flavors are perhaps to most interactive parts of the iGarden project. We currently have 2 flavors inserted into plants that are currently growing, with options and ideas for an additional three.</p><br />
<br />
<br><br />
<h2>miraculin</h2><br />
<br />
<p> Miraculin is a 'flavor inverting' protein, found naturally in the fruit of the plant <i>Synsepalum dulcificum</i>. Not sweet by itself, miraculin binds to taste receptors on the tongue, possibly altering the structure of the receptors and causing traditionally 'sour' flavors to be received as 'sweet'. </p><br />
<br />
<p> We have obtained, synthesized and BioBricked the DNA sequence of miraculin. This has allowed us to work with it in the usual BioBrick fashion, facilitating insertion into the agrobacterium expression vector.</p> <br />
<br />
<p> Preliminary <a href="https://2010.igem.org/Team:Harvard/flavor/results">tests</a> in <i>E. Coli</i> have been positive, with our YFP-tagged proteins showing definite expression </p><br />
<br><br />
<h2>brazzein</h2><br />
<br />
<p> Brazzein is a sweet-tasting protein that is found in the Western African fruit, the Oubli. The protein consists of a 54 amino acid sequence. It is sweeter than sugar and is used as an alternative low calorie sweetener. </p><br />
<br />
<p> We have obtained, synthesized and BioBricked the DNA sequence of brazzein. We were then able to flank this sequence with a plant specific promoter and terminator and insert this construct into the agrobacterium expression vector. </p><br />
<br />
<p> Preliminary tests in <i>E. Coli</i> have been positive, with our YFP-tagged proteins showing definite expression and a Western Blot also showing successful expression of brazzein. </p><br />
<br><br />
<h2>valencene</h2><br />
<br />
<p> We originally tried to extract RNA from Valencia oranges and then make a cDNA library. We then used PCR to amplify the Valencene sequence. Valencene is a gene that codes for a molecule that gives Valencia oranges their citrus flavor and aroma. </p><br />
<br />
<p> Unfortunately, after three attempts, we were not able to obtain a viable cDNA library. We then tried to extract genomic DNA. However, none of our PCR tries worked from the genomic DNA. We therefore began to explore alternate methods for obtaining the valencene gene (i.e. from another lab). </p><br />
<br />
<br><br />
<br />
<h2>wintergreen</h2><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>wintergreen expression system &nbsp; <a href="https://static.igem.org/mediawiki/2010/b/bd/Wintergreen_pathway.png" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/b/bd/Wintergreen_pathway.png" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/b/bd/Wintergreen_pathway.png" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px">The MIT 2006 iGEM team created a BioBricked system to express <i>methyl salicyate</i>, a mint smelling compound. By swapping-in plant specific promoters and inserting the system into the pORE open vector, we would be able to create mint-smelling plants. </p></td><br />
</tr><br />
<br />
</table><br />
<br />
<h2>banana</h2><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>banana expression system &nbsp; <a href="https://static.igem.org/mediawiki/2010/a/ab/BBa_J45200.png" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/a/ab/BBa_J45200.png" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/BBa_J45200.png" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br />
The Banana Scent pathway is also from the MIT 2006 iGEM team and is another example of how the iGarden system is well suited for the modular nature of the Parts Registry. Through addition of plant-specific promoters, and use of the now-BioBrick compatible pORE vectors, banana smelling plants could be achieved.<br />
</p></td><br />
</tr><br />
<br />
</table><br />
<br />
<br />
<img href=”image location:><br />
</div><br />
</div><br />
</div><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/flavorTeam:Harvard/flavor2010-10-27T00:10:09Z<p>Minniss: </p>
<hr />
<div>{{harvard_flavor}}<br />
<br />
<br />
<html><br />
<div id="abstract"><br />
<h1>abstract</h1><br />
<p><br />
As flavor and scent are the senses directly associated with food, they help to shape one's attitude towards specific fruits and vegetables. If the smell or flavor of an undesirable but healthy food can be altered, perhaps we can create a nutritious food that more people will want to eat! To approach this problem, the Flavor sub-team chose to express novel proteins and pathways in <i>Arabidopsis</i> that would change the plant's taste and smell. Obviously <i>Arabidopsis</i> is not a commonly consumed food, but the project serves as proof that our goals are workable. The team chose to focus on two proteins that alter taste - miraculin and brazzein - and three pathways that alter scent - valencene (orange/citrus), wintergreen (mint) and banana.<br />
<p/><br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/allergy/methodsTeam:Harvard/allergy/methods2010-10-27T00:08:16Z<p>Minniss: </p>
<hr />
<div>{{harvard_css}}<br />
{{harvard_allergy}}<br />
{{HarvardFancybox}}<br />
<br />
<br />
<html><br />
<style><br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #FFFFFF;<br />
border-width: 1px;<br />
}<br />
</style><br />
</div><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>methods</h1><br />
<br />
<p><br />
Creating hypoallergenic plants is a complicated process. Many proteins that provoke allergic reactions are essential for the plant's survival, and plants frequently several isoforms of the allergen genes. Our ability to reduce and eliminate allergy-inducing proteins from a plant is constrained by what proteins the plants need for survival and our success in eliminating homologous versions of the offending protein. </p><br />
<br />
<p><br />
When plants, or any organism, synthesize proteins, genomic DNA is transcribed into mRNA, which is then translated into a protein. In order to decrease or eliminate protein production, the genomic DNA coding for the mRNA can be removed, or transcription or translation can be stopped.</p><br />
<br />
<p>Targeted removing of genomic regions that code for particular proteins is difficult in plants, and is compounded by the existence of multiple isoforms of allergen genes. The preferred method of decreasing protein production in plants is through the process of RNA interference, where artificially introduced sequences of double stranded RNA interfere with the translation of the native mRNA with a complementary sequence. </p><br />
<br />
<br />
<br />
<h2>RNAi</h2><br />
<p>RNAi (RNA interference) is a process used to control expression of genes in living cells. Since this process down-regulates gene expression by preventing the translation of specific proteins, RNAi is naturally used as a protection mechanism in cells against viruses. In this process, the cell's machinery recognizes double stranded RNA sequences present in the cell. These sequences are then cut up into shorter fragment and mRNA transcripts that are complementary to these shorter sequences are then cleaved, thereby preveting translation of the proteins that would have come from these sequences. By introducing genes into the plant genome that code for synthetic double stranded RNA sequences complementary to the sequences of the various allergens that we would like to target, we hope to knockdown the expression of these allergens and their isoforms. </p><br />
<br />
<h2>hpRNA</h2><br />
<p>With RNAi, the problem of creating a hypoallergenic plant reduces to the problem of introducting short RNA strands into the cell, each with complementarity to allergen’s mRNA. One mechanism of flagging RNA for the RNA interference machinery is to create an RNA hairpin. The hairpin, expressed under a constitutive promoter, is made up of 300 base pairs of sequence that are identical to the targeted gene, a plant intron sequence, and 300 antisense base pairs complementary to the target gene. Upon transcription, this construct will form a hairpin: the targeting sequence and its reverse complement will anneal to each other, the intron will be spliced out, leaving behind a short loop sequence at the top of the hairpin. This structure is called a hpRNA, short for "hairpin RNA." The cell’s RNAi machinery will then process and incorporate part of one of the legs of the hairpin (targeting sequences) with which it will search for and destroy complementary RNA sequences. </p><br />
<br />
<br><br />
<br><br />
<br />
<a name="ihpdiagram"></a><br />
<table cellspacing="0"><br />
<tr><td><b>Overview</b></td><td></td> <td></td> <td></td><td><b>Construction</b </td></tr><br />
<tr><td><br />
<div>ihpRNA creation broad overview &nbsp; <a href="https://static.igem.org/mediawiki/2010/3/3c/Intronbasic.jpg" id="single_image" style="font-size:12px"> click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/3/3c/Intronbasic.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/3/3c/Intronbasic.jpg" width="300px" border=0><br />
</a><br />
</td> <td></td> <td></td> <td></td><br />
<td><br />
<div>ihpRNA creation detailed process &nbsp; <a href="https://static.igem.org/mediawiki/2010/2/29/Detailedintron.jpg" id="single_image" style="font-size:12px"> click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/2/29/Detailedintron.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/2/29/Detailedintron.jpg" width="300px" border=0><br />
</a><br />
</td></tr><br />
</table><br />
<br /><br /><br />
We made ihpRNA constructs for our three allergens (Betv1, Ger, LTP). We used 3 sets of primers for each construct: 1)Forward/Reverse primers specific to the biobrick end and sense sequence for our allergen 2) Forward/Reverse primers specific to the biobrick end and antisense sequence for our allergen 3)Forward/Reverse primers specific to the biobrick end and our PDK intron found in the pHannibal Vector. After we had assembled these parts together using BioBrick assembly we could ligate the completed haripins into our <a href="https://2010.igem.org/Team:Harvard/vectors">agrobacterium expression vector</a>. <br />
<br />
<br />
<h2>amiRNA</h2><br />
<p>Artificial microRNA activates a similar RNA interference mechanism but requires a much shorter input, only 21 base pairs. We used the <a href="http://wmd3.weigelworld.org/cgi-bin/webapp.cgi?page=Home;project=stdwmd">Web MicroRNA Designer</a> to create a constitutively expressed amiRNA construct that is processed by the plant cell to create a short hairpin RNA (shRNA) of 21 base pairs complementary to the target gene. </p><br />
<br />
<a name="diagrams"></a><br />
<table cellspacing="0"><br />
<tr><td><b>Overview</b></td><td></td> <td></td> <td></td><td><b>Construction</b </td></tr><br />
<tr><td><br />
<div>AmiRNA creation broad overview &nbsp; <a href="https://static.igem.org/mediawiki/2010/2/26/Amrina_creation.jpg" id="single_image" style="font-size:12px"> click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/2/26/Amrina_creation.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/2/26/Amrina_creation.jpg" width="300px" border=0><br />
</a><br />
</td> <td></td> <td></td> <td></td><br />
<td><br />
<div>AmiRNA creation detailed process &nbsp; <a href="https://static.igem.org/mediawiki/2010/0/0e/Amirnapcr.jpg" id="single_image" style="font-size:12px"> click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/0/0e/Amirnapcr.jpg" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/0/0e/Amirnapcr.jpg" width="300px" border=0><br />
</a><br />
</td></tr><br />
</table><br />
<br /><br /><br />
<p> In order to create our amiRNA hairpin constructs we used the plasmid RS300 provided by Kirsten Bomblies and Detlef Weigel. RS300 contains short sequences that would come together to form a hairpin and target a particular sequence in plants. Since we wanted to target our sequences instead, we used a multi-step pcr process to replace the plasmid's endogenous miRNA sequences with our miRNA sequences. We created four primers, two of which contained the sequences we wanted to insert. These two primers would be used to amplify the region in between the plant's own miRNA sequence and add on "our" miRNA sequences to the ends of this region. The other two primers were used to amplify the regions before and after the plant's endogenous miRNA sequences and add BioBrick prefix and suffix restriction enzymes for compatibility with our expression vectors. These three pieces were then assembled together through pcr, such that our final construct would contain a biobrick end followed by a stretch of the original RS300, followed by the ~20 base-pairs that were unique to the allergen being targeted, followed by a stretch of RS300, followed by the complementary miRNA sequence of ~20 base pairs, finally ending with a stretch of RS300 and a biobrick end.</p><br />
<br />
<p>The efficiency of knockdown with each method can be significantly different for different targets and both will have to be tested to ensure hypoallergenicity of the resulting plant. For use in synthetic biology, hpRNA is more modular, able to incorporate any plant intron and any plant gene using only PCR and BioBrick assembly. amiRNA is less modular but does not require a PCR template from the plant gene being targeted as the specific miRNA regions can be specified with an oligonucleotide. However, the <a href="http://wmd3.weigelworld.org/cgi-bin/webapp.cgi?page=Designer;project=stdwmd">amiRNA primer designer</a> cannot always find a suitable 20 base pair match in the gene of interest that will function as an effective shRNA and we were thus unable to create amiRNA constructs targeting Ger3 in <i>Arabidopsis</i>. Both methods will therefore likely be valuable for a customizable iGarden requiring efficient knockdown of a wide range of allergens.</p></div>Minnisshttp://2010.igem.org/Team:Harvard/allergy/allergensTeam:Harvard/allergy/allergens2010-10-27T00:07:35Z<p>Minniss: </p>
<hr />
<div>{{harvard_allergy}}<br />
<br />
<br />
<html><br />
<br />
</div><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>allergen targets</h1><br />
<br />
<br />
<h2>LTP (lipid transfer protein) </h2><br />
<br />
<p>The Lipid Transfer Protein helps to transport lipids across cell membranes. Plant lipid transfer proteins are pan allergens responsible for allergies to a wide range of foods such as broccoli, carrots, celery, tomatoes, melons and kiwis. The extent of this protein's cross-reactivity is comparable to that of profilins. LTP is a particularly severe allergen because it is resistant to degradation by pepsin (enzyme used by the stomach to break down proteins).</p><br><br />
<h2>Bet v1 (birch pollen analog) </h2><br />
<br />
<p> Bet v1 is an analog of a birch pollen protein that is, along with other plant pollen proteins, responsible for allergies in 100 million individuals worldwide. Bet v1 is a previously identified allergen whose homologues have been found in hazel, hornbeam, and adder trees, as well as fruits such as apples, cherries, kiwis, and celery. We found a homologue of Bet v1 in <em>Arabadopsis thaliana</em> as a proof of principle specifically for the purpose of this summer's project. Deletion of allergen genes in model systems can potentially allow for characterization of allergen function for a deeper understanding of how and why these proteins cause allergic reactions and better ways to prevent allergy and create hypoallergenic foods.</p><br> <br />
<br />
<h2>Ger3 </h2><br />
<p>Ger3 is a germin like plant protein that causes allergy in many people and is also found in <i>Arabidopsis</i>. Like LTP, Germin like proteins do not get broken down by pepsin (the primary enzyme in the stomach that breaks down proteins). Though the function of Ger3 is not completely known in <i>Arabidopsis</i>, it is hypothesized that this protein acts as a receptor in the extracellular matrix to aid plant development, and is released in response to stress. </p><br><br />
<br />
<h1> proof of concept </h1><br />
<br />
<h2>GFP (green fluorescent protein)</h2> <br />
<p>GFP is a fluorescent protein that shows green florescence when exposed to blue light. Because of its fluorescent property, it is commonly used as a reporter. As a control to show that our BioBrick RNAi constructs are functional, we are knocking down GFP in a strain of <i>Arabadopsis</i> that is modified to express GFP.</p></div>Minnisshttp://2010.igem.org/Team:Harvard/allergy/allergensTeam:Harvard/allergy/allergens2010-10-27T00:06:25Z<p>Minniss: </p>
<hr />
<div>{{harvard_allergy}}<br />
<br />
<br />
<html><br />
<br />
</div><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>allergen targets</h1><br />
<br />
<br />
<h2>LTP (lipid transfer protein) </h2><br />
<br />
<p>The Lipid Transfer Protein helps to transport lipids across cell membranes. Plant lipid transfer proteins are pan allergens responsible for allergies to a wide range of foods such as broccoli, carrots, celery, tomatoes, melons and kiwis. The extent of this protein's cross-reactivity is comparable to that of profilins. LTP is a particularly severe allergen because it is resistant to degradation by pepsin (enzyme used by the stomach to break down proteins).</p><br><br />
<h2>Bet v1 (birch pollen analog) </h2><br />
<br />
<p> Bet v1 is an analog of a birch pollen protein that is, along with other plant pollen proteins, responsible for allergies in 100 million individuals worldwide. Bet v 1 is a previously identified allergen whose homologues have been found in hazel, hornbeam, and adder trees, as well as fruits such as apples, cherries, kiwis, and celery. We found a homologue of Bet v1 in <em>Arabadopsis thaliana</em> as a proof of principle specifically for the purpose of this summer's project. Deletion of allergen genes in model systems can potentially allow for characterization of allergen function for a deeper understanding of how and why these proteins cause allergic reactions and better ways to prevent allergy and create hypoallergenic foods.</p><br> <br />
<br />
<h2>Ger3 </h2><br />
<p>Ger3 is a germin like plant protein that causes allergy in many people and is also found in <i>Arabidopsis</i>. Like LTP, Germin like proteins do not get broken down by pepsin (the primary enzyme in the stomach that breaks down proteins). Though the function of Ger3 is not completely known in <i>Arabidopsis</i>, it is hypothesized that this protein acts as a receptor in the extracellular matrix to aid plant development, and is released in response to stress. </p><br><br />
<br />
<h1> proof of concept </h1><br />
<br />
<h2>GFP (green fluorescent protein)</h2> <br />
<p>GFP is a fluorescent protein that shows green florescence when exposed to blue light. Because of its fluorescent property, it is commonly used as a reporter. As a control to show that our BioBrick RNAi constructs are functional, we are knocking down GFP in a strain of <i>Arabadopsis</i> that is modified to express GFP.</p></div>Minnisshttp://2010.igem.org/Team:Harvard/allergyTeam:Harvard/allergy2010-10-27T00:03:57Z<p>Minniss: </p>
<hr />
<div>{{HarvardFancybox}}<br />
{{harvard_allergy}}<br />
<br />
<br />
<html><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>"Deleting" allergens from plants</h1><br />
<p>Allergies to fruits and vegetables are widespread, affecting millions of people around the <br />
world with symptoms ranging from mild itchiness to life-threatening anaphylaxis. Allergy is caused by an <br />
inappropriate immune response to harmless proteins present in the environment. Several common food allergens <br />
are structurally similar to pollens that cause seasonal allergies and are present in a wide range of fruits <br />
and vegetables. Many allergen proteins have been knocked down in plants using RNA interference, leading to <br />
plants with reduced allergenicity. As part of our iGarden project we are designing modular BioBrick <br />
intron-containing self-complementary hairpin forming RNA (ihpRNA) and artificial microRNA (amiRNA)<br />
constructs for the targeted knockdown of proteins with homology to allergens in <i>Arabidopsis</i>, as well as <a href="http://openwetware.org/wiki/IGEM:Harvard/2010/Team_Allergy#Primers_and_Sequences">designing</a> ihpRNA and miRNA constructs<br />
against allergens in a range of other plants common in home gardens, including strawberry, lettuce, carrots, celery, tomato,<br />
and several herbs. Our goal is to use genetic engineering to make food safer, and to specially tailor gardens <br />
to the needs of each person with a different set of allergies.</p><br />
<hr /><br />
<br />
</div><br />
</body><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/vectors/agrotoplantsTeam:Harvard/vectors/agrotoplants2010-10-26T23:57:22Z<p>Minniss: </p>
<hr />
<div>{{harvard_vector}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>protocol: flower-dip transformation of <i>Arabidopsis</i></h1><br />
<p>When plants have been growing for 4-6 weeks and have flowers it's time to do a flower dip!</p><br />
<img src="https://static.igem.org/mediawiki/2010/e/e9/Arabisopsisreadytodip.JPG" width="600px" /><br />
<p>We followed the procedure outlined in the open access paper <a href="http://www.plantmethods.com/content/2/1/16">Logemann et. al.</a> "An improved method for preparing Agrobacterium cells that simplifies the <i>Arabidopsis</i> transfromation protocol."</P<br />
<p>First, <a href="https://static.igem.org/mediawiki/2010/6/68/YEB_recipe.txt">YEB</a> lawn plates of the Agrobacteria transformed with each of our transformation vectors were scraped and the cells were resuspended in 50mL conical tubes containing 30 mL of YEB or LB.</p><br />
<img src="https://static.igem.org/mediawiki/2010/1/12/Scraping_agro.png" width="600px" /><br />
<br />
<p>This suspension of Agrobacteria is then mixed with 120mL of the surfactant sucrose solution. Per 120 mL dip solution:</p><br />
<ul><li>6 grams sucrose</li><br />
<li>36 uL of L-77 surfactant (<a href="http://greenhouse.ucdavis.edu/pest/labels/Silwet.PDF">PDF info</a>)</li><br />
<li>120 mL of sterile water</li><br />
</ul><br />
<br />
<p>The flower pot is then simply turned upside down and the flowers swished in the surfactant/sucrose/agrobacterium solution for ten seconds</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/7/77/Flowerdip.png" width="600px" /><br />
<br />
<p>The dipped plants are then kept in a humidified chamber for 2-4 days and dipped for a second time in freshly made bacterial solution after 4-7 days. After the second dip plants are monitored for several weeks as the seed pods form and dry, at which point the seeds are harvested.</p><br />
<br />
<h2>protocol: harvesting <i>Arabidopsis</i> seeds</h2><br />
<p>Once the seed pods have dried, it is very easy to pull them off of the stem and onto a piece of paper.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/6/6d/Harvesting.jpg" width="600px" /><br />
<br />
<p>To separate the seeds from the pods, pass everything collected through a small sieve.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/3/3e/Seedsieve.jpg" width="600px" /><br />
<p>Seeds are now ready to be dried further. Place seeds in a coin envelope (make sure to seal all seams with tape to ensure that no seeds are lost) and place the sealed envelope in a sealed container with humidity absorbing rocks for one week at 4 degrees Celsius.</p><br />
<br />
<h2>protocol: seed sterilization</h2><br />
<p>Once seeds are dry they must be sterilized before planting. Place seeds in a 1.5ml eppendorf tube and suspend in 70% ethanol plus 0.1% Triton-X detergent. Allow the seeds to fall to the bottom of the tube, pure off the ethanol and replace with 95% ethanol. Do this twice, then replace with water just up to the top of the seeds. Keep the seeds at 4 degrees in the dark for 3 days to cold shock them into thinking they've survived the winter, preparing them for germination. </p><br />
<br />
<h2>recipe: selective plates</h2><br />
<p>Autoclave 1X Murashige and Skoog with 0.7% agar in deionized water. Once agar has cooled to approximately 50 degrees Celsius, add 150 microgarms/ml carbenicillin and either 50 microgarms/ml kanamycin for <em>nptII</em> selection, or 5mg/Liter <a href="http://en.wikipedia.org/wiki/Glufosinate">glufosinate</a> (Basta) for <em>pat</em> selection.<br />
<br />
<h2>protocol: seed plating</h2><br />
<p>Using a pasteur pipette pick up seeds from the eppendorf tube and spot them at even intervals across a selective agar 15cm petri dish. Seal the dish with parafilm and place under constant bright light until the seeds sprout and untransformed sprouts are selected against.</p><br />
<img src="https://static.igem.org/mediawiki/2010/d/dc/Plantingplates.JPG" /> <br /><br /><br />
<img src="https://static.igem.org/mediawiki/2010/a/a2/Seedsclose-up.JPG" /><br />
<br />
<p><br />
<br />
<p>After a couple days, all of the seeds will sprout.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/28/Harvardsprouts.jpg" /><br />
<br />
<p>A couple days after that, only the plants that have been stably transformed with the selectable marker will survive the selection. Four days after plating, seedlings that integrated the <em>pat</em> glufosinate (Basta) resistance marker began to grow larger leaves while untransformed seedlings began to die.</p><br />
<p>Here is a seedling transformed with our <a href="https://2010.igem.org/Team:Harvard/flavor">brazzein</a> expression construct:</p><br />
<img src="https://static.igem.org/mediawiki/2010/f/fb/V25selection.jpg" /><br />
<br /><br /><br />
</div><br />
</div><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/vectors/agroTeam:Harvard/vectors/agro2010-10-26T23:49:06Z<p>Minniss: </p>
<hr />
<div>{{harvard_vector}}<br />
<br />
<br />
<html><br />
<div id="abstract"><br />
<h1>agrobacteria and plant transformation</h1><br />
<br />
<p>Scientists have known since 1907 that agrobacteria cause tumor formation and other horticultural abnormalities in plants, but it was not until the 1970's that they discovered that agrobacteria induce these changes by incorporating part of their own genetic material into the plant genome. After binding to plant cells, agrobacteria use genes encoded on a tumor-inducing (Ti) plasmid separate from the bacterial chromosome to transfer a segment of DNA into the plant. These segments are then expressed by the plant to produce hormones that stimulate uncontrolled growth and induce tumor formation and to produce opines, amino acid derivatives which serve as a source of carbon and nitrogen for the agrobacteria.</p><br />
<br />
<p>The Ti plasmid contains four main elements: the transfer DNA (T-DNA) region which is transformed into the plant cell, the virulence (<i>vir</i>) region which is responsible for incorporating the T-DNA into the plant genome, genes responsible for opine catabolism, and genes responsible for transfer of the plasmid during bacterial conjugation. Genes on the bacterial chromosome facilitate binding of the agrobacterium to the plant cell surface, triggering activation of the <i>vir</i> region to initiate transformation. <br />
<br />
<p>In this activation, the constitutively expressed VirA transmembrane protein activates the cytoplasmic VirG, which acts as a transcription factor for the VirD operon. VirD1 and VirD2 then cut out the bottom strand of T-DNA from the Ti plasmid, with VirD2 clinging to the 5' end to prevent degradation and to orient the single strand of T-DNA, and this complex is tranported from the agrobacterium cell to the plant cell, where it is coated by the protein expressed by VirE2. VirD2 and VirE2 help direct the complex to the plant nucleus. In the nucleus the T-DNA is incorporated into the plant genome via illegitimate recombination.</p><br />
<br />
<p>Because all material in the T-DNA region is incorporated into the plant genome as a block, and because none of agrobacteria's natural T-DNA is used to drive the transformation itself (it is only expressed once in the plant), we can take advantage of agrobacteria's transformation mechanism by replacing the agrobacteria's natural T-DNA with our own constructs. This strategy forms the basis for agrobacterium-mediated transformation. For the iGarden, we modified an existing system graciously provided by <a href="http://www.arabidopsis.org/">The Arabidopsis Information Resource</a> which splits the Ti Plasmid into two parts - one vector to contain the T-DNA, and one to contain the virulence genes. We inserted our completed plant constructs into the T-DNA plasmid, transformed into agrobacteria containing the virulence plasmid, and transformed <i>Arabidopsis</i> via flower-dipping with the construct-containing agrobacteria.</p><br />
<br /><br /><br />
<p>Sources:<br /><br />
"Agrobacterium-mediated transformation - Overview." <a href="http://www.patentlens.net">www.patentlens.net</a><br /><br />
de la Riva, Gustavo. "Agrobacterium tumefaciens: a natural tool for plant transformation." Electronic Journal of Biotechnology 1.3 (1998)<br /><br />
The Arabidopsis Information Resource <a href="http://www.arabidopsis.org">www.arabidopsis.org</a></p><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/vectorsTeam:Harvard/vectors2010-10-26T23:45:32Z<p>Minniss: </p>
<hr />
<div>{{harvard_vector}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>abstract</h1><br />
<p>Our aim in creating the iGarden was to create a framework for plant engineering following the BioBrick standard. We began by modifying a set of <a href="https://2010.igem.org/Team:Harvard/vectors/vectors">vectors</a> designed to facilitate agrobacterium-mediated transformation to be compatible with the BioBrick standard, and creating a collection of constructs to be expressed in plants - such as <a href="https://2010.igem.org/Team:Harvard/flavor">flavor</a> elements, <a href="https://2010.igem.org/Team:Harvard/allergy">allergen</a> knockdown, <a href="https://2010.igem.org/Team:Harvard/color">pigment</a> accumulation, and <a href="https://2010.igem.org/Team:Harvard/fences">containment</a> mechanisms. We built all constructs in <i>E. coli</i>, and once complete, cloned them into the BioBrick agrobacterium vectors. We then transformed agrobacteria with our constructs via electroporation, and subsequently transformed <i>Arabidopsis</i> seeds by dipping flowers into the transgenic agrobacteria. In our final step, we harvested the transformed seeds and screened them for our designed constructs using antibiotic selection.</p><br />
<div><br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Harvard2010roadmap.png" width="600px"><br />
</div><br />
<br />
<br />
</body><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/vectorsTeam:Harvard/vectors2010-10-26T23:41:47Z<p>Minniss: </p>
<hr />
<div>{{harvard_vector}}<br />
<br />
<br />
<html><br />
<br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>abstract</h1><br />
<p>Our aim in creating the iGarden was to create a framework for plant engineering following the BioBrick standard. We began by modifying a set of <a href="https://2010.igem.org/Team:Harvard/vectors/vectors">vectors</a> designed to facilitate agrobacterium-mediated transformation to be compatible with the BioBrick standard, and creating a collection of constructs to be expressed in plants - such as <a href="https://2010.igem.org/Team:Harvard/flavor">flavor</a> elements, <a href="https://2010.igem.org/Team:Harvard/allergy">allergen</a> knockdown, <a href="https://2010.igem.org/Team:Harvard/color">pigment</a> accumulation, and <a href="https://2010.igem.org/Team:Harvard/fences">containment</a> mechanisms. We built all constructs in E. coli, and once complete, cloned them into the BioBrick agrobacterium vectors. We then transformed agrobacteria with our constructs via electroporation, and subsequently transformed <i>Arabidopsis</i> seeds by dipping flowers into the transgenic agrobacteria. In our final step, we harvested the transformed seeds and screened them for our designed constructs using antibiotic selection.</p><br />
<div><br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Harvard2010roadmap.png" width="600px"><br />
</div><br />
<br />
<br />
</body><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/fences/partsTeam:Harvard/fences/parts2010-10-26T23:21:09Z<p>Minniss: </p>
<hr />
<div>{{harvard_fence}}<br />
<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
<br />
</style><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<br />
<h1>parts and primers</h1><br />
<h2>Parts</h2><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Description</b></td><td><b>Resistance</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>Barnase</td><td> Fatal gene for the genetic fence </td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f1">link</a></td></tr><br />
<tr><td>Barstar</td><td>Protein inhibitor of Barnase</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f2">link</a></td></tr><br />
<tr><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f3">link</a></td></tr><br />
<tr><td>RXRLc</td><td> Part of the Locust Retinoic Acid Receptor and VP16 activation domain fusion protein. RXRLc binds EcR in presence of Methoxyfenozide</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f4">link</a></td></tr><br />
<tr><td>RXRHm</td><td>Human Retinoic Acid Receptor performs a function analogous to RXRLc. RXRHm has been shown to be sensitive to lower level of methoxyfenozide, but also to have higher background activation in the absence of methoxyfenozide.</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f5">link</a></td></tr><br />
<tr><td>VP16</td><td> Part of the Retinoic Acid Receptor and VP16 activation domain fusion protein. VP16 recruits transcription factors, and when colocalized with the Gal4 Upstream Activating Sequence initiates transcription downstream of the 5xGal435s promoter.</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f6">link</a></td></tr><br />
<tr><td>Ecdysone Receptor</td><td> Part of the fusion protein of Ecdysone receptor and Gal4 DNA binding domain. Ecdysone receptor binds RXR-VP16 in presence of Methoxyfenozide </td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f7">link</a></td></tr><br />
<tr><td>Gal4 DNA binding domain</td><td> Part of the Gal4-EcR fusion protein. Gal4 associates with the Gal4 upstream activating sequence, and when RXR-VP16 is bound, it localizes VP16 to the Gal4UAS35s promoter resulting in transcription downstream. </td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f8">link</a></td></tr><br />
</table><br />
<br />
<br><br />
<br />
<h2>Promoters</h2><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Description</b></td><td>Active conditions</td><td><b>Resistance</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>pENT CUP</td><td> Constitutive Plant Promoter</td><td>Constitutive</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f10">link</a></td></tr><br />
<tr><td>5xGal UAS</td><td> 5 time repeat of Gal4 upstream activating sequence</td><td>On in presense of dimerized EcR-Gal and RXRLc-VP16</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f11">link</a></td></tr><br />
<tr><td>Act2lacO</td><td>Actin2 promoter with Lac Inhibitor responsive sites (Lac O sites</td><td>Constitutive, inhibited by LacIN</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f12">link</a></td></tr><br />
<br />
<br />
<br />
</table><br />
<br /><br /><br />
<br />
<h2>Primers</h2><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Description</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>Arp2mutForward</td><td>Point mutagenesis to remove restriction enzyme site</td><td>5'-CAA GAA GCT TGA CTT GTC TAC GAA CTC TTC CAT TTC-3'</td></tr><br />
<tr><td>Arp2mutReverse</td><td>Point mutagenesis to remove restriction enzyme site</td><td>5'-GAA ATG GAA GAA CTC GTA GAC AAG TCA AGC TCC TTG-3'</td></tr><br />
<tr><td>Exp2MutForward</td><td>Point mutagenesis to remove restriction enzyme site</td><td>5'-CCT ACA CAC GGA ACT CCT GGA AAT TAA GAC CG-3'</td></tr><br />
<tr><td>Exp2mutReverse</td><td>Point mutagenesis to remove restriction enzyme site</td><td>5'-CGG TCT TAA TTT CCA GGA ACT CCG TGT GTA GG-3'</td></tr><br />
<tr><td>Bam.Gal4.Fwd</td><td>Attaching BamH1 sites to Gal4 in preparation for yeast vector ligation</td><td>5'-AAA AGG ATC CAA AAA AAT GAA GCT ACT GTC TTC TAT C-3'</td></tr><br />
<tr><td>HmRXR.Hind.Rev</td><td>Attaching HindIII sites to HmRXR in preparation for yeast vector ligation</td><td>5'-AAT TAA GCT TGG ATC CCT CGA GCT GCA GC-3'</td></tr><br />
<tr><td>LcRXR.Hind.Rev</td><td>Attaching HindIII sites to LcRXR in preparation for yeast vector ligation</td><td>5'-GAT GAA GCT TGG ATC CCT CGA GCT GC-3'</td></tr><br />
<tr><td>VP16.Hind.Fwd</td><td>Attaching HindIII sites to VP16 in preparation for yeast vector ligation</td><td>5'-AAA AAA GCT TAA AAA AAT GGC TAG CGC CGC CAC CAT G-3'</td></tr><br />
<tr><td>VP16.Rev</td><td>Reverse primer for VP16.Hind.Fwd PCR - no modification</td><td>5'-CTG CAG CGG CCG CTA CTA GTG CCC TTG GAA TTG ACG AGT AC-3'</td></tr><br />
<tr><td>NLS.serine.BB.Fwd</td><td>Oligo to anneal NLS, with one bp difference to avoid self-complementarity </td><td>5'-/5Phos/CTA GAA GTT CTG TTG TTC ATC CTA AGA AGA AGA GAA AGG TTT GAA CTA GTA GCG GCC GCT GCA-3'</td></tr><br />
<tr><td>NLS.serine.BB.Rev</td><td>Complement to NLS.serine.BB.Fwd. for NLS annealing</td><td>5'-/5Phos/GCG GCC GCT ACT AGT TCA AAC CTT TCT CTT CTT CTT AGG ATG AAC AAC AGA ACT T-3'</td></tr><br />
<tr><td>Fwd.BB.AtEXP2</td><td>for amplification/extraction of an arabidopsis germination-specific promoter</td><td>5'-CCT TTC TAG ACC TGG TGT GGT TTC TTT G-3'</td></tr><br />
<tr><td>Rev.BB.AtEXP2</td><td>for amplification/extraction of an arabidopsis germination-specific promoter</td><td>5'-AAG GCT GCA GCG GCC GCT ACT GAT ATT TGC TGA TGG GCT AAA G-3'</td></tr><br />
<tr><td>Fwd.BB.AtARP2</td><td>for amplification/extraction of the arabidopsis ARP2 promoter</td><td>5'-CCT TTC TAG ACC ATC ACA TAT TTG TAG AAT G-3'</td></tr><br />
<tr><td>Rev.BB.AtARP2</td><td>for amplification/extraction of the arabidopsis ARP2 promoter</td><td>5'-AAG GCT GCA GCG GCC GCT ACT AGT CTT CTC CGA TTT CTA TAG AG-3'</td></tr><br />
<tr><td>barnase2.BB.fwd</td><td>addition of biobrick sites/ends to barnase gene</td><td>5'-CCT TTC TAG AAT GGT ACC GGT TAT CAA CAC G-3'</td></tr><br />
<tr><td>BB.Barnase.Rev</td><td>addition of biobrick sites/ends to barnase gene</td><td>5'-AAG GCT GCA GCG GCC GCT ACT AGT TTA TCT GAT TTT TGT AAA GGT CTG-3'</td></tr><br />
<tr><td>NLS.BB.Fwd</td><td>addition of biobrick sites/ends to the arabidopsis NLS</td><td>5'-/5Phos/CTA GAT CTT CTG TTG TTC ATC CAT AGA AGA AGA GAA AGG TTT GAA CTA GTA GCG GCC GCT GCA-3'</td></tr><br />
<tr><td>NLS.BB.Rev</td><td>addition of biobrick sites/ends to the arabidopsis NLS</td><td>5'/5Phos/GCG GCC GCT ACT AGT TCA AAC CTT TCT CTT CTT CTT AGG ATG AAC AAC AGA AGA-3'</td></tr><br />
<tr><td>LacIn.BB.Fwd</td><td>Addition of NLS to the Lac Inhibitor gene to produce LacIN</td><td>5'-CCT TGA ATT CGC GGC CGC ATC TAG AAT GAA AC AGT AAC GTT ATA CGA TGT C-3'</td></tr><br />
<tr><td>LacIN.BB.Rev</td><td>Addition of NLS to the Lac Inhibitor gene to produce LacIN</td><td>5' AAG GTC GCA GCA GCG GCC GCT ACT AGT TCA AAC CTT TCT CTT CTT CTT AGG ATG AAC AAC AGA AGA CTG CCC GCT TTC CAG TCG GGA AA-3'</td></tr><br />
<tr><td>BB.Gal4DBD.Fwd</td><td>Adding biobrick sites to Gal4 DNA Binding Domain</td><td>5'-CTT TTC TAG AAT GAA GCT ACT GTC TTC TAT C-3'</td></tr><br />
<tr><td>BB.Gal4DBD.Rev</td><td>Adding biobrick sites to Gal4 DNA Binding Domain</td><td>5'-AAG GCT GCA GCG GCC GCT ACT AGT CGA TAC AGT CAA CTG TCT TTG-3'</td></tr><br />
<tr><td>BB.Barstar.Fwd</td><td>addition of biobrick sites/ends to barstar gene</td><td>5'CCT TTC TAG AAT GAA AAA AGC AGT CAT TAA C-3'</td></tr><br />
<tr><td>BB.Barstar.Rev</td><td>addition of biobrick sites/ends to barstar gene</td><td>5'-AAG GCT GCA GCG GCC GCT ACT AGT TTA AGA AAG TATA GAT GGT GAT GTC-3'</td></tr><br />
<br />
<br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/fences/partsTeam:Harvard/fences/parts2010-10-26T23:10:43Z<p>Minniss: </p>
<hr />
<div>{{harvard_fence}}<br />
<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
<br />
</style><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<br />
<h1>parts and primers</h1><br />
<h2>Parts</h2><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Description</b></td><td><b>Resistance</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>Barnase</td><td> Fatal gene for the genetic fence </td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f1">link</a></td></tr><br />
<tr><td>Barstar</td><td>Protein inhibitor of Barnase</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f2">link</a></td></tr><br />
<tr><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f3">link</a></td></tr><br />
<tr><td>RXRLc</td><td> Part of the Locust Retinoic Acid Receptor and VP16 activation domain fusion protein. RXRLc binds EcR in presence of Methoxyfenozide</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f4">link</a></td></tr><br />
<tr><td>RXRHm</td><td>Human Retinoic Acid Receptor performs a function analogous to RXRLc. RXRHm has been shown to be sensitive to lower level of methoxyfenozide, but also to have higher background activation in the absence of methoxyfenozide.</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f5">link</a></td></tr><br />
<tr><td>VP16</td><td> Part of the Retinoic Acid Receptor and VP16 activation domain fusion protein. VP16 recruits transcription factors, and when colocalized with the Gal4 Upstream Activating Sequence initiates transcription downstream of the 5xGal435s promoter.</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f6">link</a></td></tr><br />
<tr><td>Ectysone Receptor</td><td> Part of the fusion protein of Ectysone receptor and Gal4 DNA binding domain. Ectysone receptor binds RXR-VP16 in presence of Methoxyfenozide </td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f7">link</a></td></tr><br />
<tr><td>Gal4 DNA binding domain</td><td> Part of the Gal4-EcR fusion protein. Gal4 associates with the Gal4 upstream activating sequence, and when RXR-VP16 is bound, it localizes VP16 to the Gal4UAS35s promoter resulting in transcription downstream. </td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f8">link</a></td></tr><br />
</table><br />
<br />
<br><br />
<br />
<h2>Promoters</h2><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Description</b></td><td>Active conditions</td><td><b>Resistance</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>pENT CUP</td><td> Constitutive Plant Promoter</td><td>Constitutive</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f10">link</a></td></tr><br />
<tr><td>5xGal UAS</td><td> 5 time repeat of Gal4 upstream activating sequence</td><td>On in presense of dimerized EcR-Gal and RXRLc-VP16</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f11">link</a></td></tr><br />
<tr><td>Act2lacO</td><td>Actin2 promoter with Lac Inhibitor responsive sites (Lac O sites</td><td>Constitutive, inhibited by LacIN</td><td>chloramphenicol</td><td><a href="https://2010.igem.org/Team:Harvard/f12">link</a></td></tr><br />
<br />
<br />
<br />
</table><br />
<br /><br /><br />
<br />
<h2>Primers</h2><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Description</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>Arp2mutForward</td><td>Point mutagenesis to remove restriction enzyme site</td><td>5'-CAA GAA GCT TGA CTT GTC TAC GAA CTC TTC CAT TTC-3'</td></tr><br />
<tr><td>Arp2mutReverse</td><td>Point mutagenesis to remove restriction enzyme site</td><td>5'-GAA ATG GAA GAA CTC GTA GAC AAG TCA AGC TCC TTG-3'</td></tr><br />
<tr><td>Exp2MutForward</td><td>Point mutagenesis to remove restriction enzyme site</td><td>5'-CCT ACA CAC GGA ACT CCT GGA AAT TAA GAC CG-3'</td></tr><br />
<tr><td>Exp2mutReverse</td><td>Point mutagenesis to remove restriction enzyme site</td><td>5'-CGG TCT TAA TTT CCA GGA ACT CCG TGT GTA GG-3'</td></tr><br />
<tr><td>Bam.Gal4.Fwd</td><td>Attaching BamH1 sites to Gal4 in preparation for yeast vector ligation</td><td>5'-AAA AGG ATC CAA AAA AAT GAA GCT ACT GTC TTC TAT C-3'</td></tr><br />
<tr><td>HmRXR.Hind.Rev</td><td>Attaching HindIII sites to HmRXR in preparation for yeast vector ligation</td><td>5'-AAT TAA GCT TGG ATC CCT CGA GCT GCA GC-3'</td></tr><br />
<tr><td>LcRXR.Hind.Rev</td><td>Attaching HindIII sites to LcRXR in preparation for yeast vector ligation</td><td>5'-GAT GAA GCT TGG ATC CCT CGA GCT GC-3'</td></tr><br />
<tr><td>VP16.Hind.Fwd</td><td>Attaching HindIII sites to VP16 in preparation for yeast vector ligation</td><td>5'-AAA AAA GCT TAA AAA AAT GGC TAG CGC CGC CAC CAT G-3'</td></tr><br />
<tr><td>VP16.Rev</td><td>Reverse primer for VP16.Hind.Fwd PCR - no modification</td><td>5'-CTG CAG CGG CCG CTA CTA GTG CCC TTG GAA TTG ACG AGT AC-3'</td></tr><br />
<tr><td>NLS.serine.BB.Fwd</td><td>Oligo to anneal NLS, with one bp difference to avoid self-complementarity </td><td>5'-/5Phos/CTA GAA GTT CTG TTG TTC ATC CTA AGA AGA AGA GAA AGG TTT GAA CTA GTA GCG GCC GCT GCA-3'</td></tr><br />
<tr><td>NLS.serine.BB.Rev</td><td>Complement to NLS.serine.BB.Fwd. for NLS annealing</td><td>5'-/5Phos/GCG GCC GCT ACT AGT TCA AAC CTT TCT CTT CTT CTT AGG ATG AAC AAC AGA ACT T-3'</td></tr><br />
<tr><td>Fwd.BB.AtEXP2</td><td>for amplification/extraction of an arabidopsis germination-specific promoter</td><td>5'-CCT TTC TAG ACC TGG TGT GGT TTC TTT G-3'</td></tr><br />
<tr><td>Rev.BB.AtEXP2</td><td>for amplification/extraction of an arabidopsis germination-specific promoter</td><td>5'-AAG GCT GCA GCG GCC GCT ACT GAT ATT TGC TGA TGG GCT AAA G-3'</td></tr><br />
<tr><td>Fwd.BB.AtARP2</td><td>for amplification/extraction of the arabidopsis ARP2 promoter</td><td>5'-CCT TTC TAG ACC ATC ACA TAT TTG TAG AAT G-3'</td></tr><br />
<tr><td>Rev.BB.AtARP2</td><td>for amplification/extraction of the arabidopsis ARP2 promoter</td><td>5'-AAG GCT GCA GCG GCC GCT ACT AGT CTT CTC CGA TTT CTA TAG AG-3'</td></tr><br />
<tr><td>barnase2.BB.fwd</td><td>addition of biobrick sites/ends to barnase gene</td><td>5'-CCT TTC TAG AAT GGT ACC GGT TAT CAA CAC G-3'</td></tr><br />
<tr><td>BB.Barnase.Rev</td><td>addition of biobrick sites/ends to barnase gene</td><td>5'-AAG GCT GCA GCG GCC GCT ACT AGT TTA TCT GAT TTT TGT AAA GGT CTG-3'</td></tr><br />
<tr><td>NLS.BB.Fwd</td><td>addition of biobrick sites/ends to the arabidopsis NLS</td><td>5'-/5Phos/CTA GAT CTT CTG TTG TTC ATC CAT AGA AGA AGA GAA AGG TTT GAA CTA GTA GCG GCC GCT GCA-3'</td></tr><br />
<tr><td>NLS.BB.Rev</td><td>addition of biobrick sites/ends to the arabidopsis NLS</td><td>5'/5Phos/GCG GCC GCT ACT AGT TCA AAC CTT TCT CTT CTT CTT AGG ATG AAC AAC AGA AGA-3'</td></tr><br />
<tr><td>LacIn.BB.Fwd</td><td>Addition of NLS to the Lac Inhibitor gene to produce LacIN</td><td>5'-CCT TGA ATT CGC GGC CGC ATC TAG AAT GAA AC AGT AAC GTT ATA CGA TGT C-3'</td></tr><br />
<tr><td>LacIN.BB.Rev</td><td>Addition of NLS to the Lac Inhibitor gene to produce LacIN</td><td>5' AAG GTC GCA GCA GCG GCC GCT ACT AGT TCA AAC CTT TCT CTT CTT CTT AGG ATG AAC AAC AGA AGA CTG CCC GCT TTC CAG TCG GGA AA-3'</td></tr><br />
<tr><td>BB.Gal4DBD.Fwd</td><td>Adding biobrick sites to Gal4 DNA Binding Domain</td><td>5'-CTT TTC TAG AAT GAA GCT ACT GTC TTC TAT C-3'</td></tr><br />
<tr><td>BB.Gal4DBD.Rev</td><td>Adding biobrick sites to Gal4 DNA Binding Domain</td><td>5'-AAG GCT GCA GCG GCC GCT ACT AGT CGA TAC AGT CAA CTG TCT TTG-3'</td></tr><br />
<tr><td>BB.Barstar.Fwd</td><td>addition of biobrick sites/ends to barstar gene</td><td>5'CCT TTC TAG AAT GAA AAA AGC AGT CAT TAA C-3'</td></tr><br />
<tr><td>BB.Barstar.Rev</td><td>addition of biobrick sites/ends to barstar gene</td><td>5'-AAG GCT GCA GCG GCC GCT ACT AGT TTA AGA AAG TATA GAT GGT GAT GTC-3'</td></tr><br />
<br />
<br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/partsTeam:Harvard/parts2010-10-25T01:28:12Z<p>Minniss: </p>
<hr />
<div>{{Harvard_css}}<br />
{{Harvard_topbar}}<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
</style><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<br><br><br />
<h1>parts and primers</h1><br />
<br />
<table cellspacing="0" width="900"><br />
<tr><td><b>Name</b></td><td><b>Biobrick Name</b></td><td><b>Original Name</b></td><td><b>Description</b></td><td><b>Resistance</b></td><td><b>Resistance (Plants)</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>V1</td><td>BBa_K382000</td><td>pORE Open Series 1 (O1)</td><td>Agrobacterium vector open series</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/3/37/PORE_O1.gb"> pORE O1 </a></td></tr><br />
<tr><td>V2</td><td>BBa_K382001</td><td>pORE Open Series 2 (O2)</td><td>Agrobacterium vector open series</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/f/fc/PORE_O2.gb"> pORE O2 </a></td></tr><br />
<tr><td>V3</td><td>BBa_K382002</td><td>pORE Expression Series 3 (E3)</td><td>Agrobacterium vector with ENTCUP2 promoter</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/e/e7/PORE_E3.gb"> pORE E3 </a></td></tr><br />
<tr><td>V4</td><td>BBa_K382003</td><td>pORE Expression Series 4 (E4)</td><td>Agrobacterium vector with ENTCUP2 promoter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/b/b9/PORE_E4.gb"> pORE E4 </a></td></tr><br />
<tr><td>V5</td><td>BBa_K382004</td><td>pORE Reporter Series 1 (R1)</td><td>Agrobacterium vector with gusA reporter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/f/fe/PORE_R1.gb"> pORE R1 </a></td></tr><br />
<tr><td>V6</td><td>BBa_K382005</td><td>pORE Reporter Series 3 (R3)</td><td>Agrobacterium vector with smgfp reporter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/e/e8/PORE_R3.gb"> pORE R3 </a></td></tr><br />
<tr><td>V7</td><td>BBa_K382006</td><td><center>-</center></td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/3/3b/V7.gb"> V7 </a></td></tr><br />
<tr><td>V8</td><td>BBa_K382007</td><td><center>-</center></td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/0/0f/V8.gb"> V8 </a></td></tr><br />
<tr><td>V9</td><td>BBa_K382008</td><td><center>-</center></td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/d/d2/V9.gb"> V9 </a></td></tr><br />
<tr><td>V10</td><td>BBa_K382009</td><td><center>-</center></td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/3/33/V10.gb"> V10 </a></td></tr><br />
<tr><td>V11</td><td>BBa_K382010</td><td><center>-</center></td><td>Agrobacterium vector with gusA reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/5/56/V11.gb"> V11 </a></td></tr><br />
<tr><td>V12</td><td>BBa_K382011</td><td><center>-</center></td><td>Agrobacterium vector with smgfp reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/a/a8/V12.gb"> V12 </a></td></tr><br />
<br />
<tr><td>A1</td><td>BBa_K382012</td><td>amiRNA GFP</td><td>GFP knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/c/cb/AmirnaGFP.txt"> amiRNA GFP</a></td></tr><br />
<tr><td>A2</td><td>BBa_K382013</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>chloramphenicol</td><td>-</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<tr><td>A3</td><td>BBa_K382014</td><td>ihpRNA Bet</td><td>Intron hairpin Bet Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/e/ee/Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<tr><td>A4</td><td>BBa_K382015</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/6/6f/LTP.txt">ihpRNA LTP</a></td></tr><br />
<tr><td>A5</td><td>BBa_K382016</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="https://static.igem.org/mediawiki/2010/8/82/Ger.txt">ihpRNA GER</a></td></tr><br />
<br />
<tr><td>F1</td><td>BBa_K382017</td><td>pENTCUP2 promoter</td><td>Plant specific promoter. Used to drive expression of our flavor constructs in plants. </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F2</td><td>BBa_K382018</td><td>NOSt terminator</td><td>Plant specific terminator. Terminates transcription but no stop codon on end.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F3</td><td>BBa_K382019</td><td>NOSt terminator + stop</td><td>Plant specific terminator. Terminates transcription with stop codon on 5' end.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F4</td><td>BBa_K382020</td><td>Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F5</td><td>BBa_K382021</td><td>Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F6</td><td>BBa_K382022</td><td>Brazzein YFP2x C-terminus</td><td>Brazzein with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F7</td><td>BBa_K382023</td><td>Miraculin YFP2x C-terminus</td><td>Miraculin with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F8</td><td>BBa_K382024</td><td>Brazzein StrepII C-terminus</td><td>Brazzein with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F9</td><td>BBa_K382025</td><td>Miraculin StrepII C-terminus</td><td>Miraculin with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C1</td><td>BBa_K382026</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2)knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C2</td><td>BBa_K382027</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C3</td><td>BBa_K382028</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<br />
<tr><td>GF1</td><td>BBa_K382029</td><td>Barnase</td><td> Fatal gene for the genetic fence </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF2</td><td>BBa_K382030</td><td>Barstar</td><td>Protein inhibitor of Barnase</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF3</td><td>BBa_K382031</td><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td>-</td><td></td> </tr><br />
<tr><td>GF4</td><td>BBa_K382032</td><td>RXRLc-VP16</td><td> Fusion protein of Locust Retinoic Acid Receptor and VP16 activation domain - binds EcR-Gal4 in presence of Methoxyfenozide</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF5</td><td>BBa_K382033</td><td>EcR-Gal4</td><td> Fusion protein of Ecdysone receptor and Gal4 DNA binding domain - binds RXRLc-VP16 and initiates transcription downstream of Gal Upstream Activating Sequence in presence of Methoxyfenozide </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
</table><br />
<br /><br /></div>Minnisshttp://2010.igem.org/Template:Harvard_topbarTemplate:Harvard topbar2010-10-24T22:42:18Z<p>Minniss: </p>
<hr />
<div><html><br />
<div id="headerlinks"><br />
<ul id="nav"><br />
<li><br />
<a class="bannertoplinks" href="https://2010.igem.org/Team:Harvard">home</a><br />
</li><br />
<br />
<li><a class="bannertoplinks" href="#">project</a><br />
<ul style="z-index:1"><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/vectors">vectors</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/allergy">allergy</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/flavor">flavor</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/color">color</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/fences">genetic fence</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/human_practices">human practices</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/parts">parts</a></li><br />
</ul><br />
</li><br />
<br />
<li><a class="bannertoplinks" href="https://2010.igem.org/Team:Harvard/results">results</a><br />
</li><br />
<br />
<li><a class="bannertoplinks" href="#">people</a><br />
<ul style="z-index:1"><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/students">students</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/tfs">teaching fellows</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/advisors">advisors</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/sponsors">acknowledgements</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/gallery">gallery</a></li><br />
</ul><br />
</li> <br />
<li><a class="bannertoplinks" href="#">online</a><br />
<ul style="z-index:1"><br />
<li><a class="bannerlinks" href="http://harvardigem.org">blog</a></li><br />
<li><a class="bannerlinks" href="http://twitter.com/harvardigem">twitter</a></li><br />
<li><a class="bannerlinks" href="http://openwetware.org/wiki/IGEM:Harvard/2010">openwetware</a></li><br />
<li><a class="bannerlinks" href="http://www.facebook.com/pages/Cambridge-MA/Harvard-iGEM/269794024286?ref=ts">facebook</a></li><br />
</ul><br />
</li> <br />
<li><a class="bannertoplinks" href="https://2010.igem.org/Team:Harvard/contact">contact us</a><br />
</li><br />
</ul> <br />
</div><br />
</html></div>Minnisshttp://2010.igem.org/Template:Harvard_topbarTemplate:Harvard topbar2010-10-24T22:37:02Z<p>Minniss: </p>
<hr />
<div><html><br />
<div id="headerlinks"><br />
<ul id="nav"><br />
<li><br />
<a class="bannertoplinks" href="https://2010.igem.org/Team:Harvard">home</a><br />
</li><br />
<br />
<li><a class="bannertoplinks" href="#">project</a><br />
<ul style="z-index:1"><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/vectors">vectors</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/allergy">allergy</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/flavor">flavor</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/color">color</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/fences">genetic fence</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/human_practices">human practices</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/parts">parts</a></li><br />
</ul><br />
</li><br />
<li><a class="bannertoplinks" href="#">people</a><br />
<ul style="z-index:1"><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/students">students</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/tfs">teaching fellows</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/advisors">advisors</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/sponsors">acknowledgements</a></li><br />
<li><a class="bannerlinks" href="https://2010.igem.org/Team:Harvard/gallery">gallery</a></li><br />
</ul><br />
</li> <br />
<li><a class="bannertoplinks" href="#">online</a><br />
<ul style="z-index:1"><br />
<li><a class="bannerlinks" href="http://harvardigem.org">blog</a></li><br />
<li><a class="bannerlinks" href="http://twitter.com/harvardigem">twitter</a></li><br />
<li><a class="bannerlinks" href="http://openwetware.org/wiki/IGEM:Harvard/2010">openwetware</a></li><br />
<li><a class="bannerlinks" href="http://www.facebook.com/pages/Cambridge-MA/Harvard-iGEM/269794024286?ref=ts">facebook</a></li><br />
</ul><br />
</li> <br />
<li><a class="bannertoplinks" href="https://2010.igem.org/Team:Harvard/contact">contact us</a><br />
</li><br />
</ul> <br />
</div><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/flavorTeam:Harvard/flavor2010-10-24T21:48:57Z<p>Minniss: </p>
<hr />
<div>{{harvard_flavor}}<br />
<br />
<br />
<html><br />
<div id="abstract"><br />
<h1>abstract</h1><br />
<p><br />
As flavor and scent are the senses directly associated with food, they help to shape one's attitude towards specific fruits and vegetables. If the smell or flavor of an undesirable but healthy food can be altered, perhaps we can create a nutritious food that more people will want to eat! To approach this problem, Team Flavor chose to express novel proteins and pathways in Arabidopsis that would change the plant's taste and smell. Obviously Arabidopsis is not a commonly consumed food, but the project serves as proof that our goals are workable. The team chose to focus on two proteins that alter taste - Miraculin and Brazzein - and two pathways that alter scent - wintergreen (mint) and valencene (orange/citrus).<br />
<p/><br />
<p><br />
Miraculin is a protein derived from the plant <i>Synsepalum dulcificum</i> and works by binding taste receptors, causing sour foods to taste sweet. Brazzein is a sweetener derived from the West African fruit of the plant Oubli; it is more potent than sugar or even other natural sweeteners. Both proteins can be easily extracted from their native sources and directly expressed within Arabidopsis.<p/><br />
<p><br />
The wintergreen and valencene scents are derived from chemical compounds that naturally exist within the plant. The wintergreen scent results from expression of methyl salicylate, an organic ester naturally found in many plants. Using BioBrick parts created by the <a href="http://openwetware.org/wiki/IGEM:MIT/2006/Blurb">2006 MIT iGEM team</a>, we aimed to install a pathway in Arabidopsis that produces methyl salicylate from a precursor called chorismate in a three-step process.<br />
<p/><br />
<p><br />
The orange-citrus smell of valencene requires only a single gene, found in Valencia oranges. The gene can simply be extracted from the genomic DNA of a valencia orange and then directly expressed in Arabidopsis.<br />
<p/><br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/flavor/flavorsTeam:Harvard/flavor/flavors2010-10-24T21:36:06Z<p>Minniss: </p>
<hr />
<div>{{HarvardFancybox}}<br />
{{Harvard_flavor}}<br />
<br />
<br />
<html><br />
<div id=”Flavors"><br />
<div id="mainconent"><br />
<h1>Flavors</h1><br />
Flavors are perhaps to most interactive parts of the iGarden project. We currently have 2 flavors inserted into plants that are currently growing, with options and ideas for an additional three.<br />
<br />
<br />
<h2>Miraculin</h2><br />
<br />
<p> Miraculin is a 'flavor inverting' protein, found naturally in the fruit of the plant fruit of <i>Synsepalum dulcificum</i>. Not sweet by itself, miraculin binds to taste receptors on the tongue, possibly altering the structure of the receptors and causing traditionally 'sour' flavors to be received as 'sweet'. </p><br />
<br />
<p> We have obtained, synthesized and BioBricked the DNA sequence of miraculin. This has allowed us to work with it in the usual BioBrick fashion, facilitating insertion into the agrobacterium expression vector.</p> <br />
<br />
<p> Preliminary <a href="https://2010.igem.org/Team:Harvard/flavor/results">tests</a> in <i>E. Coli</i> have been positive, with our YFP-tagged proteins showing definite expression </p><br />
<br />
<h2>Brazzein</h2><br />
<br />
<p> Brazzein is a sweet-tasting protein that is found in the Western African fruit, the Oubli. The protein consists of a 191 amino acid sequence. It is sweeter than sugar and is used as an alternative low calorie sweetener. </p><br />
<br />
<p> We have obtained, synthesized and BioBricked the DNA sequence of brazzein. We were then able to flank this sequence with a plant specific promoter and terminator and insert this construct into the agrobacterium expression vector. </p><br />
<br />
<p> Preliminary tests in <i>E. Coli</i> have been positive, with our YFP-tagged proteins showing definite expression and a Western Blot also showing successful expression of Brazzein. </p><br />
<br />
<h2>Valencene</h2><br />
<br />
<p> We originally tried to extract RNA from Valencia oranges and then make a cDNA library. We then used PCR to amplify the Valencene sequence. Valencene is a gene that codes for a molecule that gives Valencia oranges their citrus flavor and aroma. </p><br />
<br />
<p> Unfortunately, after three attempts, we were not able to obtain a viable cDNA library. We then tried to extract genomic DNA. However, none of our PCR tries worked from the genomic DNA. We therefore began to explore alternate methods for obtaining the valencene gene (i.e. from another lab). </p><br />
<br />
<br />
<br />
<h2>Wintergreen</h2><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>wintergreen expression system &nbsp; <a href="https://static.igem.org/mediawiki/2010/b/bd/Wintergreen_pathway.png" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/b/bd/Wintergreen_pathway.png" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/b/bd/Wintergreen_pathway.png" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br/>The MIT 2006 iGEM team created a BioBricked system to express <i>methyl salicyate</i>, a mint smelling compound. By swapping-in plant specific promoters and inserting the system into the pORE open vector, we would be able to create mint-smelling plants. </p></td><br />
</tr><br />
<br />
</table><br />
<br />
<h2>Banana</h2><br />
<br />
<table style="padding:10px;color:#254117"><br />
<br />
<tr><br />
<td width="33%"><br />
<div>banana expression system &nbsp; <a href="https://static.igem.org/mediawiki/2010/a/ab/BBa_J45200.png" id="single_image" style="font-size:12px">click to enlarge</a></div><hr/><br />
<a href="https://static.igem.org/mediawiki/2010/a/ab/BBa_J45200.png" id="single_image"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/BBa_J45200.png" width="300px" border=0><br />
</a><br />
</td><br />
<td style="vertical-align:top"><br />
<p style="padding:10px"><br/>BANANA B a N A N A S! </p></td><br />
</tr><br />
<br />
</table><br />
<br />
<br />
<img href=”image location:><br />
</div><br />
</div><br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/partsTeam:Harvard/parts2010-10-24T21:33:04Z<p>Minniss: </p>
<hr />
<div>{{Harvard_css}}<br />
{{Harvard_topbar}}<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
</style><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<br><br><br />
<h1>parts and primers</h1><br />
<br />
<table cellspacing="0" width="900"><br />
<tr><td><b>Name</b></td><td><b>Biobrick Name</b></td><td><b>Original Name</b></td><td><b>Description</b></td><td><b>Resistance</b></td><td><b>Resistance (Plants)</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>V1</td><td>BBa_K382000</td><td>pORE Open Series 1 (O1)</td><td>Agrobacterium vector open series</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/3/37/PORE_O1.gb"> pORE O1 </a></td></tr><br />
<tr><td>V2</td><td>BBa_K382001</td><td>pORE Open Series 2 (O2)</td><td>Agrobacterium vector open series</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/f/fc/PORE_O2.gb"> pORE O2 </a></td></tr><br />
<tr><td>V3</td><td>BBa_K382002</td><td>pORE Expression Series 3 (E3)</td><td>Agrobacterium vector with ENTCUP2 promoter</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/e/e7/PORE_E3.gb"> pORE E3 </a></td></tr><br />
<tr><td>V4</td><td>BBa_K382003</td><td>pORE Expression Series 4 (E4)</td><td>Agrobacterium vector with ENTCUP2 promoter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/b/b9/PORE_E4.gb"> pORE E4 </a></td></tr><br />
<tr><td>V5</td><td>BBa_K382004</td><td>pORE Reporter Series 1 (R1)</td><td>Agrobacterium vector with gusA reporter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/f/fe/PORE_R1.gb"> pORE R1 </a></td></tr><br />
<tr><td>V6</td><td>BBa_K382005</td><td>pORE Reporter Series 3 (R3)</td><td>Agrobacterium vector with smgfp reporter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/e/e8/PORE_R3.gb"> pORE R3 </a></td></tr><br />
<tr><td>V7</td><td>BBa_K382006</td><td><center>-</center></td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/3/3b/V7.gb"> V7 </a></td></tr><br />
<tr><td>V8</td><td>BBa_K382007</td><td><center>-</center></td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/0/0f/V8.gb"> V8 </a></td></tr><br />
<tr><td>V9</td><td>BBa_K382008</td><td><center>-</center></td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/d/d2/V9.gb"> V9 </a></td></tr><br />
<tr><td>V10</td><td>BBa_K382009</td><td><center>-</center></td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/3/33/V10.gb"> V10 </a></td></tr><br />
<tr><td>V11</td><td>BBa_K382010</td><td><center>-</center></td><td>Agrobacterium vector with gusA reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/5/56/V11.gb"> V11 </a></td></tr><br />
<tr><td>V12</td><td>BBa_K382011</td><td><center>-</center></td><td>Agrobacterium vector with smgfp reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/a/a8/V12.gb"> V12 </a></td></tr><br />
<br />
<tr><td>A1</td><td>BBa_K382012</td><td>amiRNA GFP</td><td>GFP knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="AmirnaGFP.txt"> amirnaGFP</a></td></tr><br />
<tr><td>A2</td><td>BBa_K382013</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>chloramphenicol</td><td>-</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<tr><td>A3</td><td>BBa_K382014</td><td>ihpRNA Bet</td><td>Intron hairpin Bet Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<tr><td>A4</td><td>BBa_K382015</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="LTP.txt">ihpRNA LTP</a></td></tr><br />
<tr><td>A5</td><td>BBa_K382016</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="Ger.txt">ihpRNA GER</a></td></tr><br />
<br />
<tr><td>F1</td><td>BBa_K382017</td><td>pENTCUP2 promoter</td><td>Plant specific promoter. Used to drive expression of our flavor constructs in plants. </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F2</td><td>BBa_K382018</td><td>NOSt terminator</td><td>Plant specific terminator. Terminates transcription but no stop codon on end.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F3</td><td>BBa_K382019</td><td>NOSt terminator + stop</td><td>Plant specific terminator. Terminates transcription with stop codon on 5' end.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F4</td><td>BBa_K382020</td><td>Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F5</td><td>BBa_K382021</td><td>Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F6</td><td>BBa_K382022</td><td>Brazzein YFP2x C-terminus</td><td>Brazzein with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F7</td><td>BBa_K382023</td><td>Miraculin YFP2x C-terminus</td><td>Miraculin with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F8</td><td>BBa_K382024</td><td>Brazzein StrepII C-terminus</td><td>Brazzein with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F9</td><td>BBa_K382025</td><td>Miraculin StrepII C-terminus</td><td>Miraculin with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C1</td><td>BBa_K382026</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2)knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C2</td><td>BBa_K382027</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C3</td><td>BBa_K382028</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<br />
<tr><td>GF1</td><td>BBa_K382029</td><td>Barnase</td><td> Fatal gene for the genetic fence </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF2</td><td>BBa_K382030</td><td>Barstar</td><td>Protein inhibitor of Barnase</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF3</td><td>BBa_K382031</td><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td>-</td><td></td> </tr><br />
<tr><td>GF4</td><td>BBa_K382032</td><td>RXRLc-VP16</td><td> Fusion protein of Locust Retinoic Acid Receptor and VP16 activation domain - binds EcR-Gal4 in presence of Methoxyfenozide</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF5</td><td>BBa_K382033</td><td>EcR-Gal4</td><td> Fusion protein of Ecdysone receptor and Gal4 DNA binding domain - binds RXRLc-VP16 and initiates transcription downstream of Gal Upstream Activating Sequence in presence of Methoxyfenozide </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
</table><br />
<br /><br /></div>Minnisshttp://2010.igem.org/Team:Harvard/partsTeam:Harvard/parts2010-10-24T21:31:50Z<p>Minniss: </p>
<hr />
<div>{{Harvard_css}}<br />
{{Harvard_topbar}}<br />
<html><br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
</style><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>parts and primers</h1><br />
<br />
<table cellspacing="0" width="900"><br />
<tr><td><b>Name</b></td><td><b>Biobrick Name</b></td><td><b>Original Name</b></td><td><b>Description</b></td><td><b>Resistance</b></td><td><b>Resistance (Plants)</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>V1</td><td>BBa_K382000</td><td>pORE Open Series 1 (O1)</td><td>Agrobacterium vector open series</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/3/37/PORE_O1.gb"> pORE O1 </a></td></tr><br />
<tr><td>V2</td><td>BBa_K382001</td><td>pORE Open Series 2 (O2)</td><td>Agrobacterium vector open series</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/f/fc/PORE_O2.gb"> pORE O2 </a></td></tr><br />
<tr><td>V3</td><td>BBa_K382002</td><td>pORE Expression Series 3 (E3)</td><td>Agrobacterium vector with ENTCUP2 promoter</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/e/e7/PORE_E3.gb"> pORE E3 </a></td></tr><br />
<tr><td>V4</td><td>BBa_K382003</td><td>pORE Expression Series 4 (E4)</td><td>Agrobacterium vector with ENTCUP2 promoter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/b/b9/PORE_E4.gb"> pORE E4 </a></td></tr><br />
<tr><td>V5</td><td>BBa_K382004</td><td>pORE Reporter Series 1 (R1)</td><td>Agrobacterium vector with gusA reporter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/f/fe/PORE_R1.gb"> pORE R1 </a></td></tr><br />
<tr><td>V6</td><td>BBa_K382005</td><td>pORE Reporter Series 3 (R3)</td><td>Agrobacterium vector with smgfp reporter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/e/e8/PORE_R3.gb"> pORE R3 </a></td></tr><br />
<tr><td>V7</td><td>BBa_K382006</td><td><center>-</center></td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/3/3b/V7.gb"> V7 </a></td></tr><br />
<tr><td>V8</td><td>BBa_K382007</td><td><center>-</center></td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/0/0f/V8.gb"> V8 </a></td></tr><br />
<tr><td>V9</td><td>BBa_K382008</td><td><center>-</center></td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/d/d2/V9.gb"> V9 </a></td></tr><br />
<tr><td>V10</td><td>BBa_K382009</td><td><center>-</center></td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/3/33/V10.gb"> V10 </a></td></tr><br />
<tr><td>V11</td><td>BBa_K382010</td><td><center>-</center></td><td>Agrobacterium vector with gusA reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/5/56/V11.gb"> V11 </a></td></tr><br />
<tr><td>V12</td><td>BBa_K382011</td><td><center>-</center></td><td>Agrobacterium vector with smgfp reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/a/a8/V12.gb"> V12 </a></td></tr><br />
<br />
<tr><td>A1</td><td>BBa_K382012</td><td>amiRNA GFP</td><td>GFP knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="AmirnaGFP.txt"> amirnaGFP</a></td></tr><br />
<tr><td>A2</td><td>BBa_K382013</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>chloramphenicol</td><td>-</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<tr><td>A3</td><td>BBa_K382014</td><td>ihpRNA Bet</td><td>Intron hairpin Bet Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<tr><td>A4</td><td>BBa_K382015</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="LTP.txt">ihpRNA LTP</a></td></tr><br />
<tr><td>A5</td><td>BBa_K382016</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="Ger.txt">ihpRNA GER</a></td></tr><br />
<br />
<tr><td>F1</td><td>BBa_K382017</td><td>pENTCUP2 promoter</td><td>Plant specific promoter. Used to drive expression of our flavor constructs in plants. </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F2</td><td>BBa_K382018</td><td>NOSt terminator</td><td>Plant specific terminator. Terminates transcription but no stop codon on end.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F3</td><td>BBa_K382019</td><td>NOSt terminator + stop</td><td>Plant specific terminator. Terminates transcription with stop codon on 5' end.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F4</td><td>BBa_K382020</td><td>Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F5</td><td>BBa_K382021</td><td>Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F6</td><td>BBa_K382022</td><td>Brazzein YFP2x C-terminus</td><td>Brazzein with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F7</td><td>BBa_K382023</td><td>Miraculin YFP2x C-terminus</td><td>Miraculin with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F8</td><td>BBa_K382024</td><td>Brazzein StrepII C-terminus</td><td>Brazzein with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F9</td><td>BBa_K382025</td><td>Miraculin StrepII C-terminus</td><td>Miraculin with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C1</td><td>BBa_K382026</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2)knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C2</td><td>BBa_K382027</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C3</td><td>BBa_K382028</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<br />
<tr><td>GF1</td><td>BBa_K382029</td><td>Barnase</td><td> Fatal gene for the genetic fence </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF2</td><td>BBa_K382030</td><td>Barstar</td><td>Protein inhibitor of Barnase</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF3</td><td>BBa_K382031</td><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td>-</td><td></td> </tr><br />
<tr><td>GF4</td><td>BBa_K382032</td><td>RXRLc-VP16</td><td> Fusion protein of Locust Retinoic Acid Receptor and VP16 activation domain - binds EcR-Gal4 in presence of Methoxyfenozide</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF5</td><td>BBa_K382033</td><td>EcR-Gal4</td><td> Fusion protein of Ecdysone receptor and Gal4 DNA binding domain - binds RXRLc-VP16 and initiates transcription downstream of Gal Upstream Activating Sequence in presence of Methoxyfenozide </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
</table><br />
<br /><br /></div>Minnisshttp://2010.igem.org/Team:Harvard/allergy/partsTeam:Harvard/allergy/parts2010-10-24T20:09:05Z<p>Minniss: </p>
<hr />
<div>{{harvard_css}}<br />
{{harvard_allergy}}<br />
<br />
<br />
<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
</style><br />
<br />
</div><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>parts and primers</h1><br />
<br />
<br />
</style><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h2>Allergy</h2><br />
For more information on the allergens visit our "<a href="allergens">allergen targets</a>" page<br /><br /><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Original Name</b></td><td><b>Description</b></td><td><b>Resistance</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>A1</td><td>amiRNA GFP</td><td>GFP knockdown construct</td><td>chloramphenicol</td><td><a href="AmirnaGFP.txt"> amiRNA GFP</a></td></tr><br />
<tr><td>A2</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>chloramphenicol</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<tr><td>A3</td><td>ihpRNA Bet</td><td>Intron hairpin Bet Knockdown construct</td><td>chloramphenicol</td><td><a href="Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<tr><td>A4</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>chloramphenicol</td><td><a href="LTP.txt">ihpRNA LTP</a></td></tr><br />
<tr><td>A5</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>chloramphenicol</td><td><a href="Ger.txt">ihpRNA GER</a></td></tr><br />
</table><br />
<br /><br /><br />
<br />
<h2>Primers</h2><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Description</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>AP1</td><td>1 of 4 primers used to create the amiRNA GFP construct</td><td><a href="AmirnaGFP.txt"> GFP primer1</a> </td></tr><br />
<tr><td>AP2</td><td>2 of 4 primers used to create the amiRNA GFP construct</td><td><a href="AmirnaGFP.txt"> GFP primer2</a></td></tr><br />
<tr><td>AP3</td><td>3 of 4 primers used to create the amiRNA GFP construct</td><td><a href="AmirnaGFP.txt"> GFP primer3</a></td></tr><br />
<tr><td>AP4</td><td>4 of 4 primers used to create the amiRNA GFP construct</td><td><a href="AmirnaGFP.txt"> GFP primer4</a></td></tr><br />
<tr><td>AP5</td><td>1 of 4 primers used to create the amiRNA LTP construct</td><td><a href="LTP.txt"> Bet1 Primer 1</a></td></tr><br />
<tr><td>AP6</td><td>2 of 4 primers used to create the amiRNA LTP construct</td><td><a href="LTP.txt"> Bet1 Primer 2</a></td></tr><br />
<tr><td>AP7</td><td>3 of 4 primers used to create the amiRNA LTP construct</td><td><a href="LTP.txt"> Bet1 Primer 3</a></td></tr><br />
<tr><td>AP8</td><td>4 of 4 primers used to create the amiRNA LTP construct</td><td><a href="LTP.txt"> Bet1 Primer 4</a></td></tr><br />
<tr><td>AP9</td><td>Forward primer for Bet v1 Sense</td><td><a href="Bet1.txt"> Bet1 Sense Forward</a></td></tr><br />
<tr><td>AP10</td><td>Reverse primer for Bet v1 Sense </td><td><a href="Bet1.txt"> Bet1 Sense Reverse</a></td></tr><br />
<tr><td>AP11</td><td>Forward primer for Bet v1 Antisense</td><td><a href="Bet1.txt">Bet1 Antisense Forward</a></td></tr><br />
<tr><td>AP12</td><td>Reverse primer for Bet v1 Antisense</td><td><a href="Bet1.txt"> Bet1 Antisense Reverse</a></td></tr><br />
<tr><td>AP13</td><td>Forward primer for LTP Sense</td><td><a href="LTP.txt"> LTP Sense Forward</a></td></tr><br />
<tr><td>AP14</td><td>Reverse primer for LTP Sense</td><td><a href="LTP.txt">LTP Sense Reverse</a></td></tr><br />
<tr><td>AP15</td><td>Forward primer for LTP Antisense</td><td><a href="LTP.txt">LTP Antisense Forward</a></td></tr><br />
<tr><td>AP16</td><td>Reverse primer for LTP Antisense</td><td><a href="LTP.txt">LTP Antisense Reverse</a></td></tr><br />
<tr><td>AP17</td><td>Forward primer for Ger Sense</td><td><a href="Ger.txt">Ger Sense Forward</a></td></tr><br />
<tr><td>AP18</td><td>Reverse primer for Ger Sense</td><td><a href="Ger.txt">Ger Sense Reverse</a></td></tr><br />
<tr><td>AP19</td><td>Forward primer for Ger Antisense</td><td><a href="Ger.txt">Ger Antisense Forward</a></td></tr><br />
<tr><td>AP20</td><td>Reverse primer for Ger Antisense</td><td><a href="Ger.txt">Ger Antisense Reverse</a></td></tr><br />
<tr><td>AP21</td><td>Forward Primer for PDK intron</td><td><a href="Introns"> PDK forward</a></td></tr><br />
<tr><td>AP22</td><td>Reverse Primer for PDK intron</td><td><a href="Introns"> PDK reverse</a></td></tr><br />
<tr><td>AP23</td><td>Forward Primer to make amiRNA Biobrick compatible</td><td><a href="amiRNA"> Biobrick forward</a></td></tr><br />
<tr><td>AP24</td><td>Reverse Primer to make amiRNA Biobrick compatible</td><td><a href="amiRNA"> Biobrick reverse</a></td></tr><br />
<tr><td>AP25</td><td>1 of 4 primers used to create the amiRNA Bet construct</td><td><a href="Bet1.txt">LTP primer 1</a></td></tr><br />
<tr><td>AP26</td><td>2 of 4 primers used to create the amiRNA Bet construct</td><td><a href="Bet1.txt">LTP primer 2</a></td></tr><br />
<tr><td>AP27</td><td>3 of 4 primers used to create the amiRNA Bet construct</td><td><a href="Bet1.txt">LTP primer 3</a></td></tr><br />
<tr><td>AP28</td><td>4 of 4 primers used to create the amiRNA Bet construct</td><td><a href="Bet1.txt">LTP primer 4</a></td></tr><br />
<br />
<br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/allergy/partsTeam:Harvard/allergy/parts2010-10-24T20:08:06Z<p>Minniss: </p>
<hr />
<div>{{harvard_css}}<br />
{{harvard_allergy}}<br />
<br />
<br />
<br />
<html><br />
<br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
</style><br />
<br />
</div><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>parts and primers</h1><br />
<br />
<br />
</style><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h2>Allergy</h2><br />
For more information on the allergens visit our "<a href="allergens">meet the allergens</a>" page<br /><br /><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Original Name</b></td><td><b>Description</b></td><td><b>Resistance</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>A1</td><td>amiRNA GFP</td><td>GFP knockdown construct</td><td>chloramphenicol</td><td><a href="AmirnaGFP.txt"> amiRNA GFP</a></td></tr><br />
<tr><td>A2</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>chloramphenicol</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<tr><td>A3</td><td>ihpRNA Bet</td><td>Intron hairpin Bet Knockdown construct</td><td>chloramphenicol</td><td><a href="Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<tr><td>A4</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>chloramphenicol</td><td><a href="LTP.txt">ihpRNA LTP</a></td></tr><br />
<tr><td>A5</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>chloramphenicol</td><td><a href="Ger.txt">ihpRNA GER</a></td></tr><br />
</table><br />
<br /><br /><br />
<br />
<h2>Primers</h2><br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Description</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>AP1</td><td>1 of 4 primers used to create the amiRNA GFP construct</td><td><a href="AmirnaGFP.txt"> GFP primer1</a> </td></tr><br />
<tr><td>AP2</td><td>2 of 4 primers used to create the amiRNA GFP construct</td><td><a href="AmirnaGFP.txt"> GFP primer2</a></td></tr><br />
<tr><td>AP3</td><td>3 of 4 primers used to create the amiRNA GFP construct</td><td><a href="AmirnaGFP.txt"> GFP primer3</a></td></tr><br />
<tr><td>AP4</td><td>4 of 4 primers used to create the amiRNA GFP construct</td><td><a href="AmirnaGFP.txt"> GFP primer4</a></td></tr><br />
<tr><td>AP5</td><td>1 of 4 primers used to create the amiRNA LTP construct</td><td><a href="LTP.txt"> Bet1 Primer 1</a></td></tr><br />
<tr><td>AP6</td><td>2 of 4 primers used to create the amiRNA LTP construct</td><td><a href="LTP.txt"> Bet1 Primer 2</a></td></tr><br />
<tr><td>AP7</td><td>3 of 4 primers used to create the amiRNA LTP construct</td><td><a href="LTP.txt"> Bet1 Primer 3</a></td></tr><br />
<tr><td>AP8</td><td>4 of 4 primers used to create the amiRNA LTP construct</td><td><a href="LTP.txt"> Bet1 Primer 4</a></td></tr><br />
<tr><td>AP9</td><td>Forward primer for Bet v1 Sense</td><td><a href="Bet1.txt"> Bet1 Sense Forward</a></td></tr><br />
<tr><td>AP10</td><td>Reverse primer for Bet v1 Sense </td><td><a href="Bet1.txt"> Bet1 Sense Reverse</a></td></tr><br />
<tr><td>AP11</td><td>Forward primer for Bet v1 Antisense</td><td><a href="Bet1.txt">Bet1 Antisense Forward</a></td></tr><br />
<tr><td>AP12</td><td>Reverse primer for Bet v1 Antisense</td><td><a href="Bet1.txt"> Bet1 Antisense Reverse</a></td></tr><br />
<tr><td>AP13</td><td>Forward primer for LTP Sense</td><td><a href="LTP.txt"> LTP Sense Forward</a></td></tr><br />
<tr><td>AP14</td><td>Reverse primer for LTP Sense</td><td><a href="LTP.txt">LTP Sense Reverse</a></td></tr><br />
<tr><td>AP15</td><td>Forward primer for LTP Antisense</td><td><a href="LTP.txt">LTP Antisense Forward</a></td></tr><br />
<tr><td>AP16</td><td>Reverse primer for LTP Antisense</td><td><a href="LTP.txt">LTP Antisense Reverse</a></td></tr><br />
<tr><td>AP17</td><td>Forward primer for Ger Sense</td><td><a href="Ger.txt">Ger Sense Forward</a></td></tr><br />
<tr><td>AP18</td><td>Reverse primer for Ger Sense</td><td><a href="Ger.txt">Ger Sense Reverse</a></td></tr><br />
<tr><td>AP19</td><td>Forward primer for Ger Antisense</td><td><a href="Ger.txt">Ger Antisense Forward</a></td></tr><br />
<tr><td>AP20</td><td>Reverse primer for Ger Antisense</td><td><a href="Ger.txt">Ger Antisense Reverse</a></td></tr><br />
<tr><td>AP21</td><td>Forward Primer for PDK intron</td><td><a href="Introns"> PDK forward</a></td></tr><br />
<tr><td>AP22</td><td>Reverse Primer for PDK intron</td><td><a href="Introns"> PDK reverse</a></td></tr><br />
<tr><td>AP23</td><td>Forward Primer to make amiRNA Biobrick compatible</td><td><a href="amiRNA"> Biobrick forward</a></td></tr><br />
<tr><td>AP24</td><td>Reverse Primer to make amiRNA Biobrick compatible</td><td><a href="amiRNA"> Biobrick reverse</a></td></tr><br />
<tr><td>AP25</td><td>1 of 4 primers used to create the amiRNA Bet construct</td><td><a href="Bet1.txt">LTP primer 1</a></td></tr><br />
<tr><td>AP26</td><td>2 of 4 primers used to create the amiRNA Bet construct</td><td><a href="Bet1.txt">LTP primer 2</a></td></tr><br />
<tr><td>AP27</td><td>3 of 4 primers used to create the amiRNA Bet construct</td><td><a href="Bet1.txt">LTP primer 3</a></td></tr><br />
<tr><td>AP28</td><td>4 of 4 primers used to create the amiRNA Bet construct</td><td><a href="Bet1.txt">LTP primer 4</a></td></tr><br />
<br />
<br />
<br />
</table><br />
<br />
</div><br />
</div><br />
<br />
<br />
</html></div>Minnisshttp://2010.igem.org/Team:Harvard/allergy/allergensTeam:Harvard/allergy/allergens2010-10-24T20:03:54Z<p>Minniss: </p>
<hr />
<div>{{harvard_allergy}}<br />
<br />
<br />
<html><br />
<br />
</div><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>allergen targets</h1><br />
<br />
<br />
<h2>LTP (lipid transfer protein) </h2><br />
<br />
<p>The Lipid transfer protein helps to transport lipids across cell membranes. Plant lipid transfer proteins are pan allergens responsible for allergies to a wide range of foods such as broccoli, carrots, celery, tomatoes, melons and kiwis. The extent of this protein's cross-reactivity is comparable to that of profilins. LTP is a particularly severe allergen because it is resistant to degradation by pepsin (enzyme used by the stomach to break down proteins).</p><br><br />
<h2>Bet v1 (birch pollen analog) </h2><br />
<br />
<p> Bet v1 is an analog of a birch pollen protein that is, along with other plant pollen proteins, responsible for allergies in 100 million individuals worldwide. Bet v 1 is a previously identified allergen whose homologues have been found in hazel, hornbeam, and adder trees, as well as fruits such as apples, cherries, kiwis, and celery. We found a homologue of Bet v1 in <em>Arabadopsis thaliana</em> as a proof of principle specifically for the purpose of this summer's project. Deletion of allergen genes in model systems can potentially allow for characterization of allergen function for a deeper understanding of how and why these proteins cause allergic reactions and better ways to prevent allergy and create hypoallergenic foods.</p><br> <br />
<br />
<h2>Ger3 </h2><br />
<p>Ger3 is a germin like plant protein that causes allergy in many people and is also found in Arabidopsis. Like LTP, Germin like proteins do not get broken down by pepsin (the primary enzyme in the stomach that breaks down proteins). Though the function of Ger3 is not completely known in Arabidopsis, it is hypothesized that this protein acts as a receptor in the extracellular matrix to aid plant development, and is released in response to stress. </p><br><br />
<br />
<h1> proof of concept </h1><br />
<br />
<h2>GFP (green fluorescent protein)</h2> <br />
<p>GFP is a fluorescent protein that shows green florescence when exposed to blue light. Because of its fluorescent property, it is commonly used as a reporter. As a control to show that our BioBrick RNAi constructs are functional, we are knocking down GFP in a strain of Arabadopsis that is modified to express GFP.</p></div>Minnisshttp://2010.igem.org/Team:Harvard/allergy/allergensTeam:Harvard/allergy/allergens2010-10-24T20:02:57Z<p>Minniss: </p>
<hr />
<div>{{harvard_allergy}}<br />
<br />
<br />
<html><br />
<br />
</div><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>meet the allergens</h1><br />
<br />
<br />
<h2>LTP (lipid transfer protein) </h2><br />
<br />
<p>The Lipid transfer protein helps to transport lipids across cell membranes. Plant lipid transfer proteins are pan allergens responsible for allergies to a wide range of foods such as broccoli, carrots, celery, tomatoes, melons and kiwis. The extent of this protein's cross-reactivity is comparable to that of profilins. LTP is a particularly severe allergen because it is resistant to degradation by pepsin (enzyme used by the stomach to break down proteins).</p><br><br />
<h2>Bet v1 (birch pollen analog) </h2><br />
<br />
<p> Bet v1 is an analog of a birch pollen protein that is, along with other plant pollen proteins, responsible for allergies in 100 million individuals worldwide. Bet v 1 is a previously identified allergen whose homologues have been found in hazel, hornbeam, and adder trees, as well as fruits such as apples, cherries, kiwis, and celery. We found a homologue of Bet v1 in <em>Arabadopsis thaliana</em> as a proof of principle specifically for the purpose of this summer's project. Deletion of allergen genes in model systems can potentially allow for characterization of allergen function for a deeper understanding of how and why these proteins cause allergic reactions and better ways to prevent allergy and create hypoallergenic foods.</p><br> <br />
<br />
<h2>Ger3 </h2><br />
<p>Ger3 is a germin like plant protein that causes allergy in many people and is also found in Arabidopsis. Like LTP, Germin like proteins do not get broken down by pepsin (the primary enzyme in the stomach that breaks down proteins). Though the function of Ger3 is not completely known in Arabidopsis, it is hypothesized that this protein acts as a receptor in the extracellular matrix to aid plant development, and is released in response to stress. </p><br><br />
<br />
<h1> proof of concept </h1><br />
<br />
<h2>GFP (green fluorescent protein)</h2> <br />
<p>GFP is a fluorescent protein that shows green florescence when exposed to blue light. Because of its fluorescent property, it is commonly used as a reporter. As a control to show that our BioBrick RNAi constructs are functional, we are knocking down GFP in a strain of Arabadopsis that is modified to express GFP.</p></div>Minnisshttp://2010.igem.org/Team:Harvard/partsTeam:Harvard/parts2010-10-24T03:34:42Z<p>Minniss: </p>
<hr />
<div><html><br />
<br />
<style type="text/css"><br />
<br />
table<br />
{<br />
border-collapse:collapse;<br />
font-size:10pt;<br />
}<br />
<br />
<br />
td<br />
{<br />
padding-left: 5px;<br />
padding-right: 5px;<br />
padding-top: 2px;<br />
padding-bottom: 2px;<br />
border-style: solid;<br />
border-color: #827B60;<br />
border-width: 1px;<br />
}<br />
<br />
<br />
</style><br />
<div id="maincontent"><br />
<div id="abstract"><br />
<h1>parts and primers</h1><br />
<br />
<table cellspacing="0"><br />
<tr><td><b>Name</b></td><td><b>Original Name</b></td><td><b>Description</b></td><td><b>Resistance</b></td><td><b>Resistance (Plants)</b></td><td><b>Sequence</b></td></tr><br />
<tr><td>V1</td><td>pORE Open Series 1 (O1)</td><td>Agrobacterium vector open series</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/3/37/PORE_O1.gb"> pORE O1 </a></td></tr><br />
<tr><td>V2</td><td>pORE Open Series 2 (O2)</td><td>Agrobacterium vector open series</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/f/fc/PORE_O2.gb"> pORE O2 </a></td></tr><br />
<tr><td>V3</td><td>pORE Expression Series 3 (E3)</td><td>Agrobacterium vector with ENTCUP2 promoter</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/e/e7/PORE_E3.gb"> pORE E3 </a></td></tr><br />
<tr><td>V4</td><td>pORE Expression Series 4 (E4)</td><td>Agrobacterium vector with ENTCUP2 promoter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/b/b9/PORE_E4.gb"> pORE E4 </a></td></tr><br />
<tr><td>V5</td><td>pORE Reporter Series 1 (R1)</td><td>Agrobacterium vector with gusA reporter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/f/fe/PORE_R1.gb"> pORE R1 </a></td></tr><br />
<tr><td>V6</td><td>pORE Reporter Series 3 (R3)</td><td>Agrobacterium vector with smgfp reporter</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/e/e8/PORE_R3.gb"> pORE R3 </a></td></tr><br />
<tr><td>V7</td><td><center>-</center></td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/3/3b/V7.gb"> V7 </a></td></tr><br />
<tr><td>V8</td><td><center>-</center></td><td>Agrobacterium vector open series with biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/0/0f/V8.gb"> V8 </a></td></tr><br />
<tr><td>V9</td><td><center>-</center></td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>pat</td><td><a href="http://openwetware.org/images/d/d2/V9.gb"> V9 </a></td></tr><br />
<tr><td>V10</td><td><center>-</center></td><td>Agrobacterium vector with ENTCUP2 promoter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/3/33/V10.gb"> V10 </a></td></tr><br />
<tr><td>V11</td><td><center>-</center></td><td>Agrobacterium vector with gusA reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/5/56/V11.gb"> V11 </a></td></tr><br />
<tr><td>V12</td><td><center>-</center></td><td>Agrobacterium vector with smgfp reporter and biobrick cloning site</td><td>Kanamycin</td><td>nptII</td><td><a href="http://openwetware.org/images/a/a8/V12.gb"> V12 </a></td></tr><br />
<br />
<tr><td>A1</td><td>amiRNA GFP</td><td>GFP knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="AmirnaGFP.txt"> amirnaGFP</a></td></tr><br />
<tr><td>A2</td><td>amiRNA LTP </td><td>LTP knockdown construct</td><td>chloramphenicol</td><td>-</td><td> <a href="LTP.txt">amiRNA LTP</a></td></tr><br />
<tr><td>A3</td><td>ihpRNA Bet</td><td>Intron hairpin Bet Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="Bet1.txt"> ihpRNA Bet1</a></td></tr><br />
<tr><td>A4</td><td>ihpRNA LTP</td><td>Intron hairpin LTP Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="LTP.txt">ihpRNA LTP</a></td></tr><br />
<tr><td>A5</td><td>ihpRNA Ger </td><td>Intron hairpin Ger Knockdown construct</td><td>chloramphenicol</td><td>-</td><td><a href="Ger.txt">ihpRNA GER</a></td></tr><br />
<br />
<tr><td>F1</td><td>pENTCUP2 promoter</td><td>Plant specific promoter. Used to drive expression of our flavor constructs in plants. </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F2</td><td>NOSt terminator</td><td>Plant specific terminator. Terminates transcription but no stop codon on end.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F3</td><td>NOSt terminator + stop</td><td>Plant specific terminator. Terminates transcription with stop codon on end.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F4</td><td>Brazzein</td><td>Sweet-tasting protein. 54 amino acid sequence. </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F5</td><td>Miraculin</td><td>Taste-inverting protein turns sour to sweet. 191 amino acid sequence</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F6</td><td>Brazzein YFP2x C-terminus</td><td>Brazzein with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F7</td><td>Miraculin YFP2x C-terminus</td><td>Miraculin with two Yellow Fluorescent Protein sequences on C-Terminus. Allows visualization of expression</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F8</td><td>Brazzein StrepII C-terminus</td><td>Brazzein with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>F9</td><td>Miraculin StrepII C-terminus</td><td>Miraculin with StrepII tag on C-terminus for Western Blot.</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C1</td><td>amiRNA LUT2</td><td>amiRNA construct for lycopene epsilon cyclase (LUT2)knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C2</td><td>amiRNA BETA-OHASE 1</td><td>amiRNA construct for carotene beta-ring hydroxylase (BETA-OHASE 1) knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>C3</td><td>amiRNA LYC</td><td>amiRNA construct for lycopene beta cyclase (LYC) knockdown</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<br />
<tr><td>GF1</td><td>Barnase</td><td> Fatal gene for the genetic fence </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF2</td><td>Barstar</td><td>Protein inhibitor of Barnase</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF3</td><td>LacIN</td><td>Lac Inhibitor with Nuclear Localization sequence - transcriptional inhibitor of the Act2LacO promoter</td><td>chloramphenicol</td><td>-</td><td></td> </tr><br />
<tr><td>GF4</td><td>RXRLc-VP16</td><td> Fusion protein of Locust Retinoic Acid Receptor and VP16 activation domain - binds EcR-Gal4 in presence of Methoxyfenozide</td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
<tr><td>GF5</td><td>EcR-Gal4</td><td> Fusion protein of Ecdysone receptor and Gal4 DNA binding domain - binds RXRLc-VP16 and initiates transcription downstream of Gal Upstream Activating Sequence in presence of Methoxyfenozide </td><td>chloramphenicol</td><td>-</td><td></td></tr><br />
</table><br />
<br /><br /></div>Minniss