http://2010.igem.org/wiki/index.php?title=Special:Contributions/Laura_Nadine&feed=atom&limit=50&target=Laura_Nadine&year=&month=2010.igem.org - User contributions [en]2024-03-28T20:46:39ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:Heidelberg/Project/IntroductionTeam:Heidelberg/Project/Introduction2010-10-28T03:59:26Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
<br />
{{:Team:Heidelberg/Single_Pagetop|Introduction}}<br />
<br />
<div class="t1">Introduction</div><br />
<br><br />
<div class="t2">Motivation</div><br />
Introduction<br />
<br />
Motivation<br />
Referring to the team abstracts, most of the iGEM Teams are still dealing with what we would call "classical synthetic biology", meaning bacterial engineering. Since the last year's project established to some degree "mammalian synthetic biology", they paved the way for entering the real medical track focussing on gene therapy. The most important issue in terms of gene therapy is regulation of transgene expression. After last year's team characterized synthetic promoters for tuning of gene expression in vitro, we have taken one step further, introducing synthetic microRNAs and their binding sites as a new level of expression control.<br />
<br />
<br />
Background<br />
Micro RNAs (miRNAs), a class of abundant small noncoding RNAs, are key regulators in all kinds of organisms ranging from viruses to mammals. By binding to target sequences most commonly found in the 3' untranslated region (UTR) of the mRNA, miRNAs inhibit the translation of their target mRNAs and thereby adjust the expression of many proteins related to the miRNA expression in a cell {{HDref|Brenecke et al. 2005}}. The importance of miRNA-mediated gene regulation is impressively reflected by the fact that roughly 1% of the human genome codes for miRNAs which target 20-25% of all protein coding genes {{HDref|Lewis et al. 2005}}. Therefore, a large proportion of the transcriptome may be subjected to miRNA-mediated control {{HDref|Lau et al. 2001}}. The broad regulatory scope of miRNAs underlines their key roles in a wide range of biological processes including proliferation, apoptosis, hematopoeisis and oncogenesis {{HDref|Bushati and Cohen, 2007}}. The expression patterns of miRNAs in different cell types, tissues and developmental stages of a cell vary highly, but remain relatively constant within a certain single cell type in a certain stage {{HDref|Brown et al. 2006 , Gangaragu and Lin 2009}}. The special properties of miRNA binding sites and the inhibiting character of miRNAs are excellent devices to be exploited for gene therapy. Not only the fine-tuning capabilities of varying miRNA binding sites but also tissue specificity can play an important role (Brenecke et al., 2005). <br><br />
A combination of random and rational design of binding sites could become a powerful tool to achieve a narrow range of resulting gene expression knockdown. To ease in silico construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the miBS designer. Using all of our theoretical models gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell. <br />
The miBS designer allows for in silico construction of binding sites but also rational design is possible. The readily constructed binding sites can then be introduced into the miMeasure standard plasmid. This plasmid has been engineered to enable the easy input of synthetic microRNA binding sites behind one of two fluorescent proteins while the second is used for normalization. Expression of regulated reporter and control from a bidirectional CMV promter guarantee faithful and reproducible measurements in any kind of cell. The fluorescence readout can be used to quantify the regulatory efficiency of the binding site in knockdown percentage. Once the properties of a synthetic binding site are elucidated, they can be used to manipulate and accurately fine-tune gene expression in vitro and in vivo. <br><br />
After having characterized the binding sites via fluorescent measurement they can be used in our synthetic miRNA Kit. This guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The miTuner (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied dual-luciferase assay, since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an integrative feedback loop between experiments and in silico simulation. <br><br />
<br />
Next to that we follow two virus shuffling approaches to re-engineer the AAV capsid gene by directed evolution. This is used for production of a virus that is specifically infected into hepatocytes.<br />
We test the hepatocyte specificity of the fittest AAV clone via a luciferase reporter in living mice. We show that organ specific targeting is readily achieved in our mouse model.<br />
The following project sections give more background on the individual topics and provide detailed overviews on the corresponding results. A detailed documentation of the laboratory work can further be found in the notebook.<br />
<br />
<br />
For the first time, we could show miRNA mediated fine tuning and cell targeting in vitro and in vivo. Furthermore we wanted to create a library of synthetic viruses that could be evolved to enhance target specificity of our approach. In the combination of the two, we see doors open to the future of RNA based gene regulatory therapy.</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/IntroductionTeam:Heidelberg/Project/Introduction2010-10-28T03:48:27Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
<br />
{{:Team:Heidelberg/Single_Pagetop|Introduction}}<br />
<br />
<div class="t1">Introduction</div><br />
<br><br />
<div class="t2">Motivation</div><br />
Introduction<br />
<br />
Motivation<br />
Referring to the team abstracts, most of the iGEM Teams are still dealing with what we would call "classical synthetic biology", meaning bacterial engineering. Since the last year's project established to some degree "mammalian synthetic biology", they paved the way for entering the real medical track focussing on gene therapy. The most important issue in terms of gene therapy is regulation of transgene expression. After last year's team characterized synthetic promoters for tuning of gene expression in vitro, we have taken one step further, introducing synthetic microRNAs and their binding sites as a new level of expression control.<br />
<br />
<br />
Background<br />
<br />
Micro RNAs (miRNAs), a class of abundant small noncoding RNAs, are key regulators in all kinds of organisms ranging from viruses to mammals. By binding to target sequences most commonly found in the 3' untranslated region (UTR) of the mRNA, miRNAs inhibit the translation of their target mRNAs and thereby adjust the expression of many proteins related to the miRNA expression in a cell (Brenecke et al. 2005). The importance of miRNA-mediated gene regulation is impressively reflected by the fact that roughly 1% of the human genome codes for miRNAs which target 20-25% of all protein coding genes (Lewis et al. 2005). Therefore, a large proportion of the transcriptome may be subjected to miRNA-mediated control (Lau et al. 2001). The broad regulatory scope of miRNAs underlines their key roles in a wide range of biological processes including proliferation, apoptosis, hematopoeisis and oncogenesis (Bushati and Cohen, 2007). The expression patterns of miRNAs in different cell types, tissues and developmental stages of a cell vary highly, but remain relatively constant within a certain single cell type in a certain stage (Brown et al. 2006 , Gangaragu and Lin 2009).<br />
- <br />
The special properties of miRNA binding sites and the inhibiting character of miRNAs are excellent devices to be exploited for gene therapy. Not only the fine-tuning capabilities of varying miRNA binding sites, but also the possibility to distinguish different cell types by their miRNA expression profile make synthetic miRNA binding sites an excellent tool to regulate translation in vitro and in vivo.<br />
<br />
<br />
miRNAs are a class of small regulatory RNAs derived from endogenously expressed primary micro-RNA (pri-miRNA) [8-10]. After being processed in the nucleus and transported in pre-miRNA form to the cytoplasm where it forms a hairpin structure that is recognized by Dicer and cleaved into 22nt long mature miRNA. The miRNA is then loaded into the RNA-induced silencing complex (RISC) which recognizes a specific binding site sequence in the 3' untranslated region (3'-UTR) of a target mRNA and inhibit its translation, thereby downregulating the overall protein expression of the target gene.<br />
Endogenous miRNAs can have thousands of gene targets and are therefore considered to be key players in expression regulation.<br />
<br />
<br />
, because the sequence homology with the target is highly imperfect. This is possible because the nucleotides two to eight (5') are mainly responsible for target binding (seed region). It hampers in this way RISC to nick the bound mRNA strand and results in various but moderate strengths of post-transcriptional gene silencing [9-12].<br />
siRNA is artificially synthesized and exogenously transfected into cells; it resembles miRNA in its structure [2,10]. It is usually designed to perfectly match a sequence in the 3'-UTR or the open reading frame (ORF) of a target gene and allows RISC to cleave the mRNA strand [13,14]. Intracellular RNases are then attracted for complete degradation resulting in high post-transcriptional gene silencing. siRNA is however not stable in serum and not taken up by target cells in an organism [7,15]. These burdens can be overcome by endogenous expression of shRNA, which resembles pre-miRNA and is analogously processed by Dicer [5].<br />
Overall Project Aim<br />
Our project delivers a whole new cassette of tools around miRNA including miMeasure, miTuner, and miBEAT:<br />
1) We design a standard measurement construct (miMeasure), which enables an accurate and comparable measurement of silencing strengths of miRNAs or miRNAs derived from shRNAs. The miMeasure construct allows a convenient exchange of miRNA binding sites. To test the sensitivity of miMeasure we create randomly assembled (miRaPCR) patterns of binding sites for miR-122 - a species of miRNA, which is specifically upregulated in hepatocytes.<br />
2) We design a shRNA expression construct (miTuner), which allows a convenient exchange of shRNA genes and to tune the expression level of its target gene in a precise way.<br />
3) We analyze the silencing strengths for a variety of imperfect miRNA/binding sites in order to understand the quantitative structure-activity relationship (QSAR). The data is used to train a model (miBEAT), which allows the design of shRNA/binding site sequences to deliberately adjust the expression rate of any other target gene.<br />
Since it is not yet shown in the literature to what extent imperfect miRNA sequences can be utilized for controlled gene regulation, our project provides a fundamentally new insight into the nature of mi/siRNA regulation. To complement our "miTechnology" for a complete gene therapy approach, we use the adeno-associated virus (AAV) for transduction of the shRNA gene into target cells and encounter the challenge of tissue specific gene delivery [16-19]:<br />
4) We follow two virus shuffling approaches to re-engineer the AAV capsid gene by directed evolution. This is used for production of a virus that is specifically infected into hepatocytes.<br />
5) We test the hepatocyte specificity of the fittest AAV clone via a luciferase reporter in living mice. We show that organ specific targeting is readily achieved in our mouse model.<br />
The following project sections give more background on the individual topics and provide detailed overviews on the corresponding results. A detailed documentation of the laboratory work can further be found in the notebook.<br />
<br />
<br />
For the first time, we could show miRNA mediated fine tuning and cell targeting in vitro and in vivo. Furthermore we wanted to create a library of synthetic viruses that could be evolved to enhance target specificity of our approach. In the combination of the two, we see doors open to the future of RNA based gene regulatory therapy.<br />
<br />
<div class="t2">Background</div><br />
miRNA is derived from endogenously expressed primary micro-RNA (pri-miRNA) [8-10], which is cleaved in the nucleus by the endoribonuclease Drosha to pre-miRNA. In the cytoplasm this pre-miRNA self-hybridizes via a hairpin loop and is further processed by the enzyme Dicer, leaving a double stranded and approximately 22 nucleotide long miRNA with characteristic overhangs of 2 nucleotides at each side. The miRNA is recognized by and loaded onto the RNA-induced silencing complex (RISC) enabling RISC to recognize a specific sequence of the 3' untranslated region (3'-UTR) of a target mRNA. A miRNA can have hundreds of gene targets, because the sequence homology with the target is highly imperfect. This is possible because the nucleotides two to eight (5') are mainly responsible for target binding (seed region). It hampers in this way RISC to nick the bound mRNA strand and results in various but moderate strengths of post-transcriptional gene silencing [9-12]. <br />
<br />
siRNA is artificially synthesized and exogenously transfected into cells; it resembles miRNA in its structure [2,10]. It is usually designed to perfectly match a sequence in the 3'-UTR or the open reading frame (ORF) of a target gene and allows RISC to cleave the mRNA strand [13,14]. Intracellular RNases are then attracted for complete degradation resulting in high post-transcriptional gene silencing. siRNA is however not stable in serum and not taken up by target cells in an organism [7,15]. These burdens can be overcome by endogenous expression of shRNA, which resembles pre-miRNA and is analogously processed by Dicer [5]. <br />
<br />
<div class="t2">Overall Project Aim</div><br />
<br />
Our project delivers a whole new cassette of tools around miRNA including miMeasure, miTuner, and miBEAT:<br />
<br />
<b>1) We design a standard measurement construct (miMeasure), which enables an accurate and comparable measurement of silencing strengths of miRNAs or miRNAs derived from shRNAs. The miMeasure construct allows a convenient exchange of miRNA binding sites. To test the sensitivity of miMeasure we create randomly assembled (miRaPCR) patterns of binding sites for miR-122 - a species of miRNA, which is specifically upregulated in hepatocytes.<br />
<br />
2) We design a shRNA expression construct (miTuner), which allows a convenient exchange of shRNA genes and to tune the expression level of its target gene in a precise way.<br />
<br />
3) We analyze the silencing strengths for a variety of imperfect miRNA/binding sites in order to understand the quantitative structure-activity relationship (QSAR). The data is used to train a model (miBEAT), which allows the design of shRNA/binding site sequences to deliberately adjust the expression rate of any other target gene. </b><br />
<br />
Since it is not yet shown in the literature to what extent imperfect miRNA sequences can be utilized for controlled gene regulation, our project provides a fundamentally new insight into the nature of mi/siRNA regulation. To complement our "miTechnology" for a complete gene therapy approach, we use the adeno-associated virus (AAV) for transduction of the shRNA gene into target cells and encounter the challenge of tissue specific gene delivery [16-19]:<br />
<br />
<b>4) We follow two virus shuffling approaches to re-engineer the AAV capsid gene by directed evolution. This is used for production of a virus that is specifically infected into hepatocytes.<br />
<br />
5) We test the hepatocyte specificity of the fittest AAV clone via a luciferase reporter in living mice. We show that organ specific targeting is readily achieved in our mouse model. </b><br />
<br />
The following project sections give more background on the individual topics and provide detailed overviews on the corresponding results. A detailed documentation of the laboratory work can further be found in the notebook.<br />
<br />
<div class="t2">References</div><br />
[1] A. Fire et al., Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans, Nature 391:806-811 (1998)<br><br />
[2] S. M. Elbashir et al., Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells, Nature 411:494-498 (2001)<br><br />
[3] G. Meister et al., Mechanisms of gene silencing by double-stranded RNA, Nature 431:343-349 (2004)<br><br />
[4] G. J. Hannon et al., Unlocking the potential of the human genome with RNA interference, Nature 431:371-378 (2004)<br><br />
[5] D. H. Kim et al., Strategies for silencing human disease using RNA interference, Nat. Rev. Genet. 8:173-184 (2007)<br><br />
[6] D. Castanotto et al., The promises and pitfalls of RNA-interference-based therapeutics, Nature 457:426-433 (2009)<br><br />
[7] M. A. Behlke et al., Chemical modification of siRNAs for in vivo use, Oligonucleotides 18:305-319 (2008)<br><br />
[8] M. Lagos-Quintana et al., Identification of novel genes coding for small expressed RNAs, Science 294:853-858 (2001)<br><br />
[9] R. W. Carthew et al., Origins and mechanisms of miRNAs and siRNAs, Cell 136:642-655 (2009)<br><br />
[10] P. Brodersen et al., Revisiting the principles of microRNA target recognition and mode of action, Nat.Rev. Mol. Cell Biol. 10:141-148 (2009)<br><br />
[11] D. P. Bartel et al., MicroRNAs: target recognition and regulatory functions, Cell 136:215-233 (2009)<br><br />
[12] W. Filipowicz et al., Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight? Nat. Rev. Gen. 9:102-114 (2008)<br><br />
[13] G. Hutvagner et al., Argonaute proteins: key players in RNA silencing, Nat. Rev., Mol. Cell Biol. 9:22-32 (2008)<br><br />
[14] Y. Pei et al., On the art of identifying effective and specific siRNAs, Nat. Methods 3:670-676 (2006)<br><br />
[15] D. R. Corey et al., Chemical modification: the key to clinical application of RNA interference?, J. Clin. Invest. 117:3613-3622 (2007)<br><br />
[16] D. Grimm et al., RNAi and gene therapy: a mutual attraction, Hematology 473-481 (2007)<br><br />
[17] D. Grimm et al., Adeno-associated virus vectors for short hairpin RNA expression, Methods Enzymol. 392:381-405 (2005)<br><br />
[18] D. Grimm et al., From virus evolution to vector revolution: use of naturally occurring serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy, Curr. Gene Ther. 3:281-304 (2003)<br><br />
[19] D. Grimm et al, Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways, Nature 441:537-541 (2006)<br><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Parts/CharacterizationTeam:Heidelberg/Parts/Characterization2010-10-28T03:16:19Z<p>Laura Nadine: /* Characterization */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts_char}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__TOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
=Characterization=<br />
<br /><br />
We characterized intensively four different part groups:<br />
* the 8 engineered miTuner construct differing in the promoter combinations (SV40, RSV, CMV, CMV_TetO2) the cassettes on the parts are expressed from (<partinfo>BBa_K337036</partinfo>, <partinfo>BBa_K337038</partinfo>, <partinfo>BBa_K337032</partinfo>, <partinfo>BBa_K337035</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337042</partinfo>, <partinfo>BBa_K337044</partinfo>, <partinfo>BBa_K337046</partinfo>)<br />
* the pSMB_miMeasure Standard Plasmid (<partinfo>BBa_K337049</partinfo>)<br />
* a whole variety of different microRNA binding sites out of which we submitted 6 interesting candidates to the registry. (hsa-mir122 and shRNAmir_hAAT binding sites, parts <partinfo>BBa_K337052</partinfo>, <partinfo>BBa_K337053</partinfo>, <partinfo>BBa_K337054</partinfo>, <partinfo>BBa_K337055</partinfo>, <partinfo>BBa_K337056</partinfo>, <partinfo>BBa_K337057</partinfo>)<br />
* MicroRNA binding site patterns consisting of more than 1 single perfect or imperfect binding sites for microRNA hsa-mir122 (<partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>)<br />
<br />
<br><br />
===Characterization of promoters in tuning constructs in T-Rex cells===<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay]<br/><br />
In order to test for promoter efficiency and to check whether the miRNA kit assembly works fine<br />
50ng of each construct with different promoter set-ups (table 1) were transfected into HEK 293 T-REx cells and other cell lines HEK, HeLa, Huh7 in 96-well plate format using FuGENE transfection reagent. As every construct is expressing firefly luciferase (luc2) and renilla luciferase (hRluc) at the same time the setup allows is unaffected by transfection efficiency and cell number. Each sample was transfected and measured by Dual luciferase assay in 8 replicates. As by this time no shRNA has been cloned into plasmid no knock-down of luc2 is expected and the different expression efficiencies allow for characterization of the different promoters. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337032 BBa_K337032] leads to a relative luciferase unit (RLU) of luc2 to hRluc expression of 6 RLU. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] are showing a comparable expression of 12 - 13 RLU, which is in line with the knowledge that both luciferases are driven by the CMV promoter. Hek 293 T-Rex cells stably express the Tet repressor thus allows us to observe very efficient repression of Firefly luciferse expression if a CMV-TetO2 promoter is driving luc2 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337038 BBa_K337038] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337046 BBa_K337046]). [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337040 BBa_K337040] transfection into Hek T-Rex cells results in an expression of 15 RLU. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337042 BBa_K337042] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337044 BBa_K337044] are constructed in a way that luc2 is driven by the CMV promoter and hRluc is driven by the RSV promoter and show a comparable expression of 17-20 RLU. This leads to the conclusion that the CMV promoter shows comparable expression to the RSV promoter in Hek T-Rex cell lines.<br />
<br><br />
Table 1<br />
{| class="wikitable sortable" border="0" style="text-align: center"<br />
|-bgcolor=#cccccc <br />
!part!!promoter driving luc2 (Firefly)!!promoter driving (Renilla)!!promoter driving shRNA expression<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337032 BBa_K337032]||RSV||CMV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035]||CMV||CMV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036]||CMV||CMV||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337038 BBa_K337038]||CMV TetO2||CMV ||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337040 BBa_K337040]||RSV||RSV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337042 BBa_K337042]||CMV||RSV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337044 BBa_K337044]||CMV||RSV||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337046 BBa_K337046]||CMV TetO2||RSV||RSV<br />
|-<br />
|}<br />
<br><br />
[[Image:Promoter_test_220910_hd2010.jpg| thumb | 700px | centre | Promoter strength characterization of tuning constructs in HEK 293 T-REx cell line]]<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br><br />
===Characterization of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] in different cell lines===<br />
[[Image:K2_k3differentcelllinesHD2010.jpg | thumb | 500px | right | Promoter strength characterization in different cell lines]]<br />
If [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] are transfected into different cell lines it is obvious that Hek293T cells are the easiest to transfect with both constructs an expression of 17-22 RLU is to be measured. Hek T-Rex cells are showing and expression level of 12 RLU of both constructs. Hela cells are also showing constant expression levels of 8 RLU with both constructs. A rather low expression of 2RLU is to be seen by transfecting the 2 constructs in Huh7 cells. This might be due to low transfection efficiency of this cell line in general. All together it is to say that [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] show comparable expression.<br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
=== Characterization of part binding sites ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]) ===<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites into the 3'UTR of a GOI. In case a referring shRNA miR is endogenously present or co-expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interaction <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3] . It turned out, that no obvious effect of different binding sites on reporter gene expression could be measured (data not shown). We assume that the RSV promoter driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. Luc2 and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. This was achieved by co-transfection the tuning construct with corresponding shRNA miRhaat and as a control a miRNA w/o binding sites in the target 3'UTR. The experiment was done in a 96-well plate by plating 5000 Hela cells/well 24h before transfection. Transfection was done using Fugene transfection reagent. 2.5ng of tuning construct were co-transfected with the shRNA miR construct of a concentration of 25 ng (1:10). Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. The data preciously shows a tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through cloning of perfect binding sites into the 3'UTR to the reporter gene(always green bar on the left hand side of the figures). 100% refers to ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). We chose the data obtained by the construct with the U6 promoter as this promoter is more efficient than the H1 promoter, ensuring that the system is saturated and ensuring that the data is reproducible. The same constructs were also used for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be used for mice injections since the expressed shRNA miR against human alpha-1-antitrypsine (hAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
[[Image:Haat U6HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_SV40_Luc2 construct cotransfected with a reference renilla construct.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT. The shhAAT was expressed from a pSB_U6 plasmid]]<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_SV40 Luc2 double transfected with a reference renilla construct.''' The shRNA_hAAT construct was expressed from a pSB_H1 construct.]]<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. The perfect binding site [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052] shows knockdown of about 96%. point mut 10 (1), point mut 10 (2) and point mut 11 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053] (2) always show strong knockdown, whereas bulge 16-18 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054] , only seed and bulge 9-12(2) show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
<br/><br />
<br />
=== Characterization of synthetic single microRNA binding sites ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]) ===<br />
<br />
Binding sites for miR122 were experimentally characterized by cloning them into psiCHECK-2 backbone (Promega). [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual luciferase assay] was conducted using this time Renilla Luciferase as a reporter and the other luciferase as a reference for normalization. Figure 3 shows again a broad range of regulation depending on binding site sequence properties. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055] (mut 99) is the construct with the perfect binding site and leads to an knock-down percentage of 96%. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056] (mut 7) is an imperfect binding site which leads to a knockdown percentage of 64%. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057](mut 111) is an imperfect binding site with a knockdown efficiency of 24%. All this contributes to a real tuning effect by introducing binding sites with introduced mismatches following the rational design protocol.<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br /><br />
<br />
<br />
<br />
=== Characterization of synthetic microRNA binding site patterns against endogenous miR122 3.1[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337008 BBa_K337008] and 1.3 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337000 BBa_K337000] ===<br />
<br />
We used the miMeasure plasmid with the BB-2 standard to characterise binding sites for the endogenously expressed miR122. We cloned two different synthetic microRNA binding site patterns into our miMeasure construct plasmid: 3.1 BBa_K337008 and 1.3 BBa_K337000. As the binding site is inserted downstream of green fluorescent protein (EGFP), a regulation of EGFP expression is to be expected. miMeasure normalizes knockdown of EGFP to the unregulated blue fluorescent protein (EBFP2). By calculating the ratio of EGFP to EBFP2 we determined the knockdown percentage characteristic of the binding site patterns. <br><br />
<br />
We tested these constructs in four different set-ups with three different cell lines: <br><br />
• HeLa cells, which do not express miR122 endogenously <br><br />
• HeLa cells cotransfected with miR122 to mimic endogenous expression <br><br />
• HuH7 cells, which are liver cells known to express miR122 <br><br />
• HepG2 cells, liver cells known to express low amounts of miR122 (Douglas, 2010) <br><br />
<br />
EGFP to EBFP2 ratios were measured with flow cytometry and microscopy. Measurement results for the four cell lines and the binding sites 3.1 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337008 BBa_K337008] and 1.3 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337000 BBa_K337000] are shown in Fig. 4 for all four cell line setups. As expected, no down regulation of EGFP expression was measured in HeLa cells due to the lack of miR122 therein. This serves as a control for the design of our binding sites as it is clear that they do not cross-react with other endogenously expressed miRNAs but are specific for miR122. Similarly, no down regulation was observed in HepG2 cells. The levels of miR122 expression in those cells are reportedly reduced by 99.5&, therefore also serving as a negative control. Both the construct 1.3 (containing two perfect binding sites with the extra 10bp spacer in between) and 3.1 (containing 3 perfect binding sites) lead to an increase in downregulation effect of EGFP in Huh7 cells and in HeLa cells cotransfected with miR122 in comparison to the single perfect binding site. <br />
<br />
[[Image:Download-1.jpg|thumb|center|600px|'''Figure 4: miMeasure in four different set-ups with three different cell lines''' The construct containing synthetic microRNA binding site patterns against endogenous miR122 transfected into different cell lines. The EGFP/EBFP2 ratio for the construct containing no binding site was set to one.]]<br />
<br />
=== Characterization of the bidirectional CMV promoter ===<br />
<br />
The bidirectional CMV promoter [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337017 BBa_K337017] is a new standard part out of our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure construct]. <br />
The promoter was used to express two reporter genes with a comparable transcription rate. Referring to the figures below, this is the case.<br />
<br />
[[Image:HeLa nobinding imageOverview.png|thumb|center|600px| Left panel: EGFP channel. Middle panel: EBFP channel. Right panel: merge of both the others.]]<br />
<br />
[[Image:GFPvsBFPHeLa nobinding miM.png|thumb|center|400px| EBFP intensities against EGFP intensities. Correlation coefficient is given.]]<br />
<br />
==References==<br />
*Douglas D:Small Molecule Modifiers of MicroRNA miR-122 Function for the Treatment of Hepatitis C Virus Infection and Hepatocellular Carcinoma. JACS. 2010 May 15; 132(23):7976-81.<br><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Parts/CharacterizationTeam:Heidelberg/Parts/Characterization2010-10-28T03:07:54Z<p>Laura Nadine: /* Characterization of synthetic microRNA binding site patterns against endogenous miR122 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts_char}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__TOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
=Characterization=<br />
<br /><br />
We characterized intensively four different part groups:<br />
* the 8 engineered miTuner construct differing in the promoter combinations (SV40, RSV, CMV, CMV_TetO2) the cassettes on the parts are expressed from (<partinfo>BBa_K337036</partinfo>, <partinfo>BBa_K337038</partinfo>, <partinfo>BBa_K337032</partinfo>, <partinfo>BBa_K337035</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337042</partinfo>, <partinfo>BBa_K337044</partinfo>, <partinfo>BBa_K337046</partinfo>)<br />
* the pSMB_miMeasure Standard Plasmid (<partinfo>BBa_K337049</partinfo>)<br />
* a whole variety of different microRNA binding sites out of which we submitted 6 interesting candidates to the registry. (hsa-mir122 and shRNAmir_hAAT binding sites, parts <partinfo>BBa_K337052</partinfo>, <partinfo>BBa_K337053</partinfo>, <partinfo>BBa_K337054</partinfo>, <partinfo>BBa_K337055</partinfo>, <partinfo>BBa_K337056</partinfo>, <partinfo>BBa_K337057</partinfo>)<br />
* MicroRNA binding site patterns consisting of more than 1 single perfect or imperfect binding sites for microRNA hsa-mir122 (<partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>)<br />
<br />
<br><br />
===Characterization of promoters in tuning constructs in T-Rex cells===<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay]<br/><br />
In order to test for promoter efficiency and to check whether the miRNA kit assembly works fine<br />
50ng of each construct with different promoter set-ups (table 1) were transfected into HEK 293 T-REx cells and other cell lines HEK, HeLa, Huh7 in 96-well plate format using FuGENE transfection reagent. As every construct is expressing firefly luciferase (luc2) and renilla luciferase (hRluc) at the same time the setup allows is unaffected by transfection efficiency and cell number. Each sample was transfected and measured by Dual luciferase assay in 8 replicates. As by this time no shRNA has been cloned into plasmid no knock-down of luc2 is expected and the different expression efficiencies allow for characterization of the different promoters. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337032 BBa_K337032] leads to a relative luciferase unit (RLU) of luc2 to hRluc expression of 6 RLU. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] are showing a comparable expression of 12 - 13 RLU, which is in line with the knowledge that both luciferases are driven by the CMV promoter. Hek 293 T-Rex cells stably express the Tet repressor thus allows us to observe very efficient repression of Firefly luciferse expression if a CMV-TetO2 promoter is driving luc2 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337038 BBa_K337038] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337046 BBa_K337046]). [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337040 BBa_K337040] transfection into Hek T-Rex cells results in an expression of 15 RLU. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337042 BBa_K337042] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337044 BBa_K337044] are constructed in a way that luc2 is driven by the CMV promoter and hRluc is driven by the RSV promoter and show a comparable expression of 17-20 RLU. This leads to the conclusion that the CMV promoter shows comparable expression to the RSV promoter in Hek T-Rex cell lines.<br />
<br><br />
Table 1<br />
{| class="wikitable sortable" border="0" style="text-align: center"<br />
|-bgcolor=#cccccc <br />
!part!!promoter driving luc2 (Firefly)!!promoter driving (Renilla)!!promoter driving shRNA expression<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337032 BBa_K337032]||RSV||CMV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035]||CMV||CMV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036]||CMV||CMV||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337038 BBa_K337038]||CMV TetO2||CMV ||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337040 BBa_K337040]||RSV||RSV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337042 BBa_K337042]||CMV||RSV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337044 BBa_K337044]||CMV||RSV||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337046 BBa_K337046]||CMV TetO2||RSV||RSV<br />
|-<br />
|}<br />
<br><br />
[[Image:Promoter_test_220910_hd2010.jpg| thumb | 700px | centre | Promoter strength characterization of tuning constructs in HEK 293 T-REx cell line]]<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br><br />
===Characterization of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] in different cell lines===<br />
[[Image:K2_k3differentcelllinesHD2010.jpg | thumb | 500px | right | Promoter strength characterization in different cell lines]]<br />
If [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] are transfected into different cell lines it is obvious that Hek293T cells are the easiest to transfect with both constructs an expression of 17-22 RLU is to be measured. Hek T-Rex cells are showing and expression level of 12 RLU of both constructs. Hela cells are also showing constant expression levels of 8 RLU with both constructs. A rather low expression of 2RLU is to be seen by transfecting the 2 constructs in Huh7 cells. This might be due to low transfection efficiency of this cell line in general. All together it is to say that [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] show comparable expression.<br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
=== Characterization of part binding sites ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]) ===<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites into the 3'UTR of a GOI. In case a referring shRNA miR is endogenously present or co-expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interaction <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3] . It turned out, that no obvious effect of different binding sites on reporter gene expression could be measured (data not shown). We assume that the RSV promoter driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. Luc2 and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. This was achieved by co-transfection the tuning construct with corresponding shRNA miRhaat and as a control a miRNA w/o binding sites in the target 3'UTR. The experiment was done in a 96-well plate by plating 5000 Hela cells/well 24h before transfection. Transfection was done using Fugene transfection reagent. 2.5ng of tuning construct were co-transfected with the shRNA miR construct of a concentration of 25 ng (1:10). Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. The data preciously shows a tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through cloning of perfect binding sites into the 3'UTR to the reporter gene(always green bar on the left hand side of the figures). 100% refers to ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). We chose the data obtained by the construct with the U6 promoter as this promoter is more efficient than the H1 promoter, ensuring that the system is saturated and ensuring that the data is reproducible. The same constructs were also used for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be used for mice injections since the expressed shRNA miR against human alpha-1-antitrypsine (hAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
[[Image:Haat U6HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_SV40_Luc2 construct cotransfected with a reference renilla construct.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT. The shhAAT was expressed from a pSB_U6 plasmid]]<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_SV40 Luc2 double transfected with a reference renilla construct.''' The shRNA_hAAT construct was expressed from a pSB_H1 construct.]]<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. The perfect binding site [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052] shows knockdown of about 96%. point mut 10 (1), point mut 10 (2) and point mut 11 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053] (2) always show strong knockdown, whereas bulge 16-18 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054] , only seed and bulge 9-12(2) show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
<br/><br />
<br />
=== Characterization of synthetic single microRNA binding sites ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]) ===<br />
<br />
Binding sites for miR122 were experimentally characterized by cloning them into psiCHECK-2 backbone (Promega). [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual luciferase assay] was conducted using this time Renilla Luciferase as a reporter and the other luciferase as a reference for normalization. Figure 3 shows again a broad range of regulation depending on binding site sequence properties. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055] (mut 99) is the construct with the perfect binding site and leads to an knock-down percentage of 96%. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056] (mut 7) is an imperfect binding site which leads to a knockdown percentage of 64%. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057](mut 111) is an imperfect binding site with a knockdown efficiency of 24%. All this contributes to a real tuning effect by introducing binding sites with introduced mismatches following the rational design protocol.<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br /><br />
<br />
<br />
<br />
=== Characterization of synthetic microRNA binding site patterns against endogenous miR122 3.1[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337008 BBa_K337008] and 1.3 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337000 BBa_K337000] ===<br />
<br />
We used the miMeasure plasmid with the BB-2 standard to characterise binding sites for the endogenously expressed miR122. We cloned two different synthetic microRNA binding site patterns into our miMeasure construct plasmid: 3.1 BBa_K337008 and 1.3 BBa_K337000. As the binding site is inserted downstream of green fluorescent protein (EGFP), a regulation of EGFP expression is to be expected. miMeasure normalizes knockdown of EGFP to the unregulated blue fluorescent protein (EBFP2). By calculating the ratio of EGFP to EBFP2 we determined the knockdown percentage characteristic of the binding site patterns. <br><br />
<br />
We tested these constructs in four different set-ups with three different cell lines: <br><br />
• HeLa cells, which do not express miR122 endogenously <br><br />
• HeLa cells cotransfected with miR122 to mimic endogenous expression <br><br />
• HuH7 cells, which are liver cells known to express miR122 <br><br />
• HepG2 cells, liver cells known to express low amounts of miR122 (Douglas, 2010) <br><br />
<br />
EGFP to EBFP2 ratios were measured with flow cytometry and microscopy. Measurement results for the four cell lines and the binding sites 3.1 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337008 BBa_K337008] and 1.3 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337000 BBa_K337000] are shown in Fig. 4 for all four cell line setups. As expected, no down regulation of EGFP expression was measured in HeLa cells due to the lack of miR122 therein. This serves as a control for the design of our binding sites as it is clear that they do not cross-react with other endogenously expressed miRNAs but are specific for miR122. Similarly, no down regulation was observed in HepG2 cells. The levels of miR122 expression in those cells are reportedly reduced by 99.5&, therefore also serving as a negative control. Both the construct 1.3 (containing two perfect binding sites with the extra 10bp spacer in between) and 3.1 (containing 3 perfect binding sites) lead to an increase in downregulation effect of EGFP in Huh7 cells and in HeLa cells cotransfected with miR122 in comparison to the single perfect binding site. <br />
<br />
[[Image:Download-1.jpg|thumb|center|600px|'''Figure 4: miMeasure in four different set-ups with three different cell lines''' The construct containing synthetic microRNA binding site patterns against endogenous miR122 transfected into different cell lines. The EGFP/EBFP2 ratio for the construct containing no binding site was set to one.]]<br />
<br />
=== Characterization of the bidirectional CMV promoter ===<br />
<br />
The bidirectional CMV promoter is a new standard part out of our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure construct]. <br />
The promoter was used to express two reporter genes with a comparable transcription rate. Referring to the figures below, this is the case.<br />
<br />
[[Image:HeLa nobinding imageOverview.png|thumb|center|600px| Left panel: EGFP channel. Middle panel: EBFP channel. Right panel: merge of both the others.]]<br />
<br />
[[Image:GFPvsBFPHeLa nobinding miM.png|thumb|center|400px| EBFP intensities against EGFP intensities. Correlation coefficient is given.]]<br />
<br />
==References==<br />
*Douglas D:Small Molecule Modifiers of MicroRNA miR-122 Function for the Treatment of Hepatitis C Virus Infection and Hepatocellular Carcinoma. JACS. 2010 May 15; 132(23):7976-81.<br><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Parts/CharacterizationTeam:Heidelberg/Parts/Characterization2010-10-28T02:51:05Z<p>Laura Nadine: /* Characterization of synthetic microRNA binding site patterns against endogenous miR122 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts_char}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__TOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
=Characterization=<br />
<br /><br />
We characterized intensively four different part groups:<br />
* the 8 engineered miTuner construct differing in the promoter combinations (SV40, RSV, CMV, CMV_TetO2) the cassettes on the parts are expressed from (<partinfo>BBa_K337036</partinfo>, <partinfo>BBa_K337038</partinfo>, <partinfo>BBa_K337032</partinfo>, <partinfo>BBa_K337035</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337042</partinfo>, <partinfo>BBa_K337044</partinfo>, <partinfo>BBa_K337046</partinfo>)<br />
* the pSMB_miMeasure Standard Plasmid (<partinfo>BBa_K337049</partinfo>)<br />
* a whole variety of different microRNA binding sites out of which we submitted 6 interesting candidates to the registry. (hsa-mir122 and shRNAmir_hAAT binding sites, parts <partinfo>BBa_K337052</partinfo>, <partinfo>BBa_K337053</partinfo>, <partinfo>BBa_K337054</partinfo>, <partinfo>BBa_K337055</partinfo>, <partinfo>BBa_K337056</partinfo>, <partinfo>BBa_K337057</partinfo>)<br />
* MicroRNA binding site patterns consisting of more than 1 single perfect or imperfect binding sites for microRNA hsa-mir122 (<partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>)<br />
<br />
<br><br />
===Characterization of promoters in tuning constructs in T-Rex cells===<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay]<br/><br />
In order to test for promoter efficiency and to check whether the miRNA kit assembly works fine<br />
50ng of each construct with different promoter set-ups (table 1) were transfected into HEK 293 T-REx cells and other cell lines HEK, HeLa, Huh7 in 96-well plate format using FuGENE transfection reagent. As every construct is expressing firefly luciferase (luc2) and renilla luciferase (hRluc) at the same time the setup allows is unaffected by transfection efficiency and cell number. Each sample was transfected and measured by Dual luciferase assay in 8 replicates. As by this time no shRNA has been cloned into plasmid no knock-down of luc2 is expected and the different expression efficiencies allow for characterization of the different promoters. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337032 BBa_K337032] leads to a relative luciferase unit (RLU) of luc2 to hRluc expression of 6 RLU. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] are showing a comparable expression of 12 - 13 RLU, which is in line with the knowledge that both luciferases are driven by the CMV promoter. Hek 293 T-Rex cells stably express the Tet repressor thus allows us to observe very efficient repression of Firefly luciferse expression if a CMV-TetO2 promoter is driving luc2 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337038 BBa_K337038] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337046 BBa_K337046]). [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337040 BBa_K337040] transfection into Hek T-Rex cells results in an expression of 15 RLU. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337042 BBa_K337042] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337044 BBa_K337044] are constructed in a way that luc2 is driven by the CMV promoter and hRluc is driven by the RSV promoter and show a comparable expression of 17-20 RLU. This leads to the conclusion that the CMV promoter shows comparable expression to the RSV promoter in Hek T-Rex cell lines.<br />
<br><br />
Table 1<br />
{| class="wikitable sortable" border="0" style="text-align: center"<br />
|-bgcolor=#cccccc <br />
!part!!promoter driving luc2 (Firefly)!!promoter driving (Renilla)!!promoter driving shRNA expression<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337032 BBa_K337032]||RSV||CMV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035]||CMV||CMV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036]||CMV||CMV||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337038 BBa_K337038]||CMV TetO2||CMV ||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337040 BBa_K337040]||RSV||RSV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337042 BBa_K337042]||CMV||RSV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337044 BBa_K337044]||CMV||RSV||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337046 BBa_K337046]||CMV TetO2||RSV||RSV<br />
|-<br />
|}<br />
<br><br />
[[Image:Promoter_test_220910_hd2010.jpg| thumb | 700px | centre | Promoter strength characterization of tuning constructs in HEK 293 T-REx cell line]]<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br><br />
===Characterization of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] in different cell lines===<br />
[[Image:K2_k3differentcelllinesHD2010.jpg | thumb | 500px | right | Promoter strength characterization in different cell lines]]<br />
If [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] are transfected into different cell lines it is obvious that Hek293T cells are the easiest to transfect with both constructs an expression of 17-22 RLU is to be measured. Hek T-Rex cells are showing and expression level of 12 RLU of both constructs. Hela cells are also showing constant expression levels of 8 RLU with both constructs. A rather low expression of 2RLU is to be seen by transfecting the 2 constructs in Huh7 cells. This might be due to low transfection efficiency of this cell line in general. All together it is to say that [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] show comparable expression.<br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
=== Characterization of part binding sites ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]) ===<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites into the 3'UTR of a GOI. In case a referring shRNA miR is endogenously present or co-expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interaction <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3] . It turned out, that no obvious effect of different binding sites on reporter gene expression could be measured (data not shown). We assume that the RSV promoter driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. Luc2 and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. This was achieved by co-transfection the tuning construct with corresponding shRNA miRhaat and as a control a miRNA w/o binding sites in the target 3'UTR. The experiment was done in a 96-well plate by plating 5000 Hela cells/well 24h before transfection. Transfection was done using Fugene transfection reagent. 2.5ng of tuning construct were co-transfected with the shRNA miR construct of a concentration of 25 ng (1:10). Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. The data preciously shows a tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through cloning of perfect binding sites into the 3'UTR to the reporter gene(always green bar on the left hand side of the figures). 100% refers to ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). We chose the data obtained by the construct with the U6 promoter as this promoter is more efficient than the H1 promoter, ensuring that the system is saturated and ensuring that the data is reproducible. The same constructs were also used for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be used for mice injections since the expressed shRNA miR against human alpha-1-antitrypsine (hAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
[[Image:Haat U6HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_SV40_Luc2 construct cotransfected with a reference renilla construct.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT. The shhAAT was expressed from a pSB_U6 plasmid]]<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_SV40 Luc2 double transfected with a reference renilla construct.''' The shRNA_hAAT construct was expressed from a pSB_H1 construct.]]<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. The perfect binding site [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052] shows knockdown of about 96%. point mut 10 (1), point mut 10 (2) and point mut 11 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053] (2) always show strong knockdown, whereas bulge 16-18 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054] , only seed and bulge 9-12(2) show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
<br/><br />
<br />
=== Characterization of synthetic single microRNA binding sites ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]) ===<br />
<br />
Binding sites for miR122 were experimentally characterized by cloning them into psiCHECK-2 backbone (Promega). [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual luciferase assay] was conducted using this time Renilla Luciferase as a reporter and the other luciferase as a reference for normalization. Figure 3 shows again a broad range of regulation depending on binding site sequence properties. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055] (mut 99) is the construct with the perfect binding site and leads to an knock-down percentage of 96%. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056] (mut 7) is an imperfect binding site which leads to a knockdown percentage of 64%. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057](mut 111) is an imperfect binding site with a knockdown efficiency of 24%. All this contributes to a real tuning effect by introducing binding sites with introduced mismatches following the rational design protocol.<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br /><br />
<br />
<br />
<br />
=== Characterization of synthetic microRNA binding site patterns against endogenous miR122 ===<br />
<br />
We used the miMeasure plasmid with the BB-2 standard to characterise binding sites for the endogenously expressed miR122. We cloned two different synthetic microRNA binding site patterns into our miMeasure construct plasmid: 3.1 BBa_K337008 and 1.3 BBa_K337000. As the binding site is inserted downstream of green fluorescent protein (EGFP), a regulation of EGFP expression is to be expected. miMeasure normalizes knockdown of EGFP to the unregulated blue fluorescent protein (EBFP2). By calculating the ratio of EGFP to EBFP2 we determined the knockdown percentage characteristic of the binding site patterns. <br><br />
<br />
We tested these constructs in four different set-ups with three different cell lines: <br><br />
• HeLa cells, which do not express miR122 endogenously <br><br />
• HeLa cells cotransfected with miR122 to mimic endogenous expression <br><br />
• HuH7 cells, which are liver cells known to express miR122 <br><br />
• HepG2 cells, liver cells known to express low amounts of miR122 (Douglas, 2010) <br><br />
<br />
EGFP to EBFP2 ratios were measured with flow cytometry and microscopy. Measurement results for the four cell lines and the binding sites 3.1 BBa_K337008 and 1.3 BBa_K337000 are shown in Fig. 4 for all four cell line setups. As expected, no down regulation of EGFP expression was measured in HeLa cells due to the lack of miR122 therein. This serves as a control for the design of our binding sites as it is clear that they do not cross-react with other endogenously expressed miRNAs but are specific for miR122. Similarly, no down regulation was observed in HepG2 cells. The levels of miR122 expression in those cells are reportedly reduced by 99.5&, therefore also serving as a negative control. Both the construct 1.3 (containing two perfect binding sites with the extra 10bp spacer in between) and 3.1 (containing 3 perfect binding sites) lead to an increase in downregulation effect of EGFP in Huh7 cells and in HeLa cells cotransfected with miR122 in comparison to the single perfect binding site. <br />
<br />
[[Image:Download-1.jpg|thumb|center|600px|'''Figure 4: miMeasure in four different set-ups with three different cell lines''' The construct containing synthetic microRNA binding site patterns against endogenous miR122 transfected into different cell lines. The EGFP/EBFP2 ratio for the construct containing no binding site was set to one.]]<br />
<br />
<br />
=== Characterization of the bidirectional CMV promoter ===<br />
<br />
The bidirectional CMV promoter is a new standard part out of our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure construct]. <br />
The promoter was used to express two reporter genes with a comparable transcription rate. Referring to the figures below, this is the case.<br />
<br />
[[Image:HeLa nobinding imageOverview.png|thumb|center|600px| Left panel: EGFP channel. Middle panel: EBFP channel. Right panel: merge of both the others.]]<br />
<br />
[[Image:GFPvsBFPHeLa nobinding miM.png|thumb|center|400px| EBFP intensities against EGFP intensities. Correlation coefficient is given.]]<br />
<br />
==References==<br />
*Douglas D:Small Molecule Modifiers of MicroRNA miR-122 Function for the Treatment of Hepatitis C Virus Infection and Hepatocellular Carcinoma. JACS. 2010 May 15; 132(23):7976-81.<br><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Parts/CharacterizationTeam:Heidelberg/Parts/Characterization2010-10-28T02:40:21Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts_char}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__TOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
=Characterization=<br />
<br /><br />
We characterized intensively four different part groups:<br />
* the 8 engineered miTuner construct differing in the promoter combinations (SV40, RSV, CMV, CMV_TetO2) the cassettes on the parts are expressed from (<partinfo>BBa_K337036</partinfo>, <partinfo>BBa_K337038</partinfo>, <partinfo>BBa_K337032</partinfo>, <partinfo>BBa_K337035</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337042</partinfo>, <partinfo>BBa_K337044</partinfo>, <partinfo>BBa_K337046</partinfo>)<br />
* the pSMB_miMeasure Standard Plasmid (<partinfo>BBa_K337049</partinfo>)<br />
* a whole variety of different microRNA binding sites out of which we submitted 6 interesting candidates to the registry. (hsa-mir122 and shRNAmir_hAAT binding sites, parts <partinfo>BBa_K337052</partinfo>, <partinfo>BBa_K337053</partinfo>, <partinfo>BBa_K337054</partinfo>, <partinfo>BBa_K337055</partinfo>, <partinfo>BBa_K337056</partinfo>, <partinfo>BBa_K337057</partinfo>)<br />
* MicroRNA binding site patterns consisting of more than 1 single perfect or imperfect binding sites for microRNA hsa-mir122 (<partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>)<br />
<br />
<br><br />
===Characterization of promoters in tuning constructs in T-Rex cells===<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay]<br/><br />
In order to test for promoter efficiency and to check whether the miRNA kit assembly works fine<br />
50ng of each construct with different promoter set-ups (table 1) were transfected into HEK 293 T-REx cells and other cell lines HEK, HeLa, Huh7 in 96-well plate format using FuGENE transfection reagent. As every construct is expressing firefly luciferase (luc2) and renilla luciferase (hRluc) at the same time the setup allows is unaffected by transfection efficiency and cell number. Each sample was transfected and measured by Dual luciferase assay in 8 replicates. As by this time no shRNA has been cloned into plasmid no knock-down of luc2 is expected and the different expression efficiencies allow for characterization of the different promoters. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337032 BBa_K337032] leads to a relative luciferase unit (RLU) of luc2 to hRluc expression of 6 RLU. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] are showing a comparable expression of 12 - 13 RLU, which is in line with the knowledge that both luciferases are driven by the CMV promoter. Hek 293 T-Rex cells stably express the Tet repressor thus allows us to observe very efficient repression of Firefly luciferse expression if a CMV-TetO2 promoter is driving luc2 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337038 BBa_K337038] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337046 BBa_K337046]). [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337040 BBa_K337040] transfection into Hek T-Rex cells results in an expression of 15 RLU. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337042 BBa_K337042] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337044 BBa_K337044] are constructed in a way that luc2 is driven by the CMV promoter and hRluc is driven by the RSV promoter and show a comparable expression of 17-20 RLU. This leads to the conclusion that the CMV promoter shows comparable expression to the RSV promoter in Hek T-Rex cell lines.<br />
<br><br />
Table 1<br />
{| class="wikitable sortable" border="0" style="text-align: center"<br />
|-bgcolor=#cccccc <br />
!part!!promoter driving luc2 (Firefly)!!promoter driving (Renilla)!!promoter driving shRNA expression<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337032 BBa_K337032]||RSV||CMV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035]||CMV||CMV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036]||CMV||CMV||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337038 BBa_K337038]||CMV TetO2||CMV ||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337040 BBa_K337040]||RSV||RSV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337042 BBa_K337042]||CMV||RSV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337044 BBa_K337044]||CMV||RSV||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337046 BBa_K337046]||CMV TetO2||RSV||RSV<br />
|-<br />
|}<br />
<br><br />
[[Image:Promoter_test_220910_hd2010.jpg| thumb | 700px | centre | Promoter strength characterization of tuning constructs in HEK 293 T-REx cell line]]<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br><br />
===Characterization of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] in different cell lines===<br />
[[Image:K2_k3differentcelllinesHD2010.jpg | thumb | 500px | right | Promoter strength characterization in different cell lines]]<br />
If [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] are transfected into different cell lines it is obvious that Hek293T cells are the easiest to transfect with both constructs an expression of 17-22 RLU is to be measured. Hek T-Rex cells are showing and expression level of 12 RLU of both constructs. Hela cells are also showing constant expression levels of 8 RLU with both constructs. A rather low expression of 2RLU is to be seen by transfecting the 2 constructs in Huh7 cells. This might be due to low transfection efficiency of this cell line in general. All together it is to say that [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] show comparable expression.<br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
=== Characterization of part binding sites ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]) ===<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites into the 3'UTR of a GOI. In case a referring shRNA miR is endogenously present or co-expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interaction <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3] . It turned out, that no obvious effect of different binding sites on reporter gene expression could be measured (data not shown). We assume that the RSV promoter driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. Luc2 and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. This was achieved by co-transfection the tuning construct with corresponding shRNA miRhaat and as a control a miRNA w/o binding sites in the target 3'UTR. The experiment was done in a 96-well plate by plating 5000 Hela cells/well 24h before transfection. Transfection was done using Fugene transfection reagent. 2.5ng of tuning construct were co-transfected with the shRNA miR construct of a concentration of 25 ng (1:10). Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. The data preciously shows a tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through cloning of perfect binding sites into the 3'UTR to the reporter gene(always green bar on the left hand side of the figures). 100% refers to ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). We chose the data obtained by the construct with the U6 promoter as this promoter is more efficient than the H1 promoter, ensuring that the system is saturated and ensuring that the data is reproducible. The same constructs were also used for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be used for mice injections since the expressed shRNA miR against human alpha-1-antitrypsine (hAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
[[Image:Haat U6HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_SV40_Luc2 construct cotransfected with a reference renilla construct.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT. The shhAAT was expressed from a pSB_U6 plasmid]]<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_SV40 Luc2 double transfected with a reference renilla construct.''' The shRNA_hAAT construct was expressed from a pSB_H1 construct.]]<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. The perfect binding site [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052] shows knockdown of about 96%. point mut 10 (1), point mut 10 (2) and point mut 11 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053] (2) always show strong knockdown, whereas bulge 16-18 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054] , only seed and bulge 9-12(2) show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
<br/><br />
<br />
=== Characterization of synthetic single microRNA binding sites ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]) ===<br />
<br />
Binding sites for miR122 were experimentally characterized by cloning them into psiCHECK-2 backbone (Promega). [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual luciferase assay] was conducted using this time Renilla Luciferase as a reporter and the other luciferase as a reference for normalization. Figure 3 shows again a broad range of regulation depending on binding site sequence properties. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055] (mut 99) is the construct with the perfect binding site and leads to an knock-down percentage of 96%. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056] (mut 7) is an imperfect binding site which leads to a knockdown percentage of 64%. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057](mut 111) is an imperfect binding site with a knockdown efficiency of 24%. All this contributes to a real tuning effect by introducing binding sites with introduced mismatches following the rational design protocol.<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br /><br />
<br />
=== Characterization of synthetic microRNA binding site patterns against endogenous miR122 ===<br />
<br />
=== Characterization of synthetic microRNA binding site patterns against endogenous miR122 ===<br />
<br />
We used the miMeasure plasmid with the BB-2 standard to characterise binding sites for the endogenously expressed miR122. We cloned two different synthetic microRNA binding site patterns into our miMeasure construct plasmid: 3.1 BBa_K337008 and 1.3 BBa_K337000. As the binding site is inserted downstream of green fluorescent protein (EGFP), a regulation of EGFP expression is to be expected. miMeasure normalizes knockdown of EGFP to the unregulated blue fluorescent protein (EBFP2). By calculating the ratio of EGFP to EBFP2 we determined the knockdown percentage characteristic of the binding site patterns. <br><br />
<br />
We tested these constructs in four different set-ups with three different cell lines: <br><br />
• HeLa cells, which do not express miR122 endogenously <br><br />
• HeLa cells cotransfected with miR122 to mimic endogenous expression <br><br />
• HuH7 cells, which are liver cells known to express miR122 <br><br />
• HepG2 cells, liver cells known to express low amounts of miR122 (Douglas, 2010) <br><br />
<br />
EGFP to EBFP2 ratios were measured with flow cytometry and microscopy. Measurement results for the four cell lines and the binding sites 3.1 BBa_K337008 and 1.3 BBa_K337000 are shown in Fig. 4 for all four cell line setups. As expected, no down regulation of EGFP expression was measured in HeLa cells due to the lack of miR122 therein. This serves as a control for the design of our binding sites as it is clear that they do not cross-react with other endogenously expressed miRNAs but are specific for miR122. Similarly, no down regulation was observed in HepG2 cells. The levels of miR122 expression in those cells are reportedly reduced by 99.5&, therefore also serving as a negative control. Both the construct 1.3 (containing two perfect binding sites with the extra 10bp spacer in between) and 3.1 (containing 3 perfect binding sites) lead to an increase in downregulation effect of EGFP in Huh7 cells and in HeLa cells cotransfected with miR122 in comparison to the single perfect binding site. <br />
<br />
[[Image:Download-1.jpg|thumb|center|600px|'''Figure 4: miMeasure in four different set-ups with three different cell lines''' The construct containing synthetic microRNA binding site patterns against endogenous miR122 transfected into different cell lines. The EGFP/EBFP2 ratio for the construct containing no binding site was set to one.]]<br />
<br />
<br />
=== Characterization of the bidirectional CMV promoter ===<br />
<br />
The bidirectional CMV promoter is a new standard part out of our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure construct]. <br />
The promoter was used to express two reporter genes with a comparable transcription rate. Referring to the figures below, this is the case.<br />
<br />
[[Image:HeLa nobinding imageOverview.png|thumb|center|600px| Left panel: EGFP channel. Middle panel: EBFP channel. Right panel: merge of both the others.]]<br />
<br />
[[Image:GFPvsBFPHeLa nobinding miM.png|thumb|center|400px| EBFP intensities against EGFP intensities. Correlation coefficient is given.]]<br />
<br />
==References==<br />
*Douglas D:Small Molecule Modifiers of MicroRNA miR-122 Function for the Treatment of Hepatitis C Virus Infection and Hepatocellular Carcinoma. JACS. 2010 May 15; 132(23):7976-81.<br><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Parts/CharacterizationTeam:Heidelberg/Parts/Characterization2010-10-28T02:13:04Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts_char}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__TOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
=Characterization=<br />
<br /><br />
We characterized intensively four different part groups:<br />
* the 8 engineered miTuner construct differing in the promoter combinations (SV40, RSV, CMV, CMV_TetO2) the cassettes on the parts are expressed from (<partinfo>BBa_K337036</partinfo>, <partinfo>BBa_K337038</partinfo>, <partinfo>BBa_K337032</partinfo>, <partinfo>BBa_K337035</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337042</partinfo>, <partinfo>BBa_K337044</partinfo>, <partinfo>BBa_K337046</partinfo>)<br />
* the pSMB_miMeasure Standard Plasmid (<partinfo>BBa_K337049</partinfo>)<br />
* a whole variety of different microRNA binding sites out of which we submitted 6 interesting candidates to the registry. (hsa-mir122 and shRNAmir_hAAT binding sites, parts <partinfo>BBa_K337052</partinfo>, <partinfo>BBa_K337053</partinfo>, <partinfo>BBa_K337054</partinfo>, <partinfo>BBa_K337055</partinfo>, <partinfo>BBa_K337056</partinfo>, <partinfo>BBa_K337057</partinfo>)<br />
* MicroRNA binding site patterns consisting of more than 1 single perfect or imperfect binding sites for microRNA hsa-mir122 (<partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>, <partinfo>BBa_K337040</partinfo>)<br />
<br />
<br><br />
===Characterization of promoters in tuning constructs in T-Rex cells===<br />
[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay]<br/><br />
In order to test for promoter efficiency and to check whether the miRNA kit assembly works fine<br />
50ng of each construct with different promoter set-ups (table 1) were transfected into HEK 293 T-REx cells and other cell lines HEK, HeLa, Huh7 in 96-well plate format using FuGENE transfection reagent. As every construct is expressing firefly luciferase (luc2) and renilla luciferase (hRluc) at the same time the setup allows is unaffected by transfection efficiency and cell number. Each sample was transfected and measured by Dual luciferase assay in 8 replicates. As by this time no shRNA has been cloned into plasmid no knock-down of luc2 is expected and the different expression efficiencies allow for characterization of the different promoters. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337032 BBa_K337032] leads to a relative luciferase unit (RLU) of luc2 to hRluc expression of 6 RLU. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] are showing a comparable expression of 12 - 13 RLU, which is in line with the knowledge that both luciferases are driven by the CMV promoter. Hek 293 T-Rex cells stably express the Tet repressor thus allows us to observe very efficient repression of Firefly luciferse expression if a CMV-TetO2 promoter is driving luc2 ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337038 BBa_K337038] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337046 BBa_K337046]). [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337040 BBa_K337040] transfection into Hek T-Rex cells results in an expression of 15 RLU. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337042 BBa_K337042] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337044 BBa_K337044] are constructed in a way that luc2 is driven by the CMV promoter and hRluc is driven by the RSV promoter and show a comparable expression of 17-20 RLU. This leads to the conclusion that the CMV promoter shows comparable expression to the RSV promoter in Hek T-Rex cell lines.<br />
<br><br />
Table 1<br />
{| class="wikitable sortable" border="0" style="text-align: center"<br />
|-bgcolor=#cccccc <br />
!part!!promoter driving luc2 (Firefly)!!promoter driving (Renilla)!!promoter driving shRNA expression<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337032 BBa_K337032]||RSV||CMV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035]||CMV||CMV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036]||CMV||CMV||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337038 BBa_K337038]||CMV TetO2||CMV ||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337040 BBa_K337040]||RSV||RSV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337042 BBa_K337042]||CMV||RSV||SV40<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337044 BBa_K337044]||CMV||RSV||RSV<br />
|-<br />
|[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337046 BBa_K337046]||CMV TetO2||RSV||RSV<br />
|-<br />
|}<br />
<br><br />
[[Image:Promoter_test_220910_hd2010.jpg| thumb | 700px | centre | Promoter strength characterization of tuning constructs in HEK 293 T-REx cell line]]<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br><br><br />
===Characterization of [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] in different cell lines===<br />
[[Image:K2_k3differentcelllinesHD2010.jpg | thumb | 500px | right | Promoter strength characterization in different cell lines]]<br />
If [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] are transfected into different cell lines it is obvious that Hek293T cells are the easiest to transfect with both constructs an expression of 17-22 RLU is to be measured. Hek T-Rex cells are showing and expression level of 12 RLU of both constructs. Hela cells are also showing constant expression levels of 8 RLU with both constructs. A rather low expression of 2RLU is to be seen by transfecting the 2 constructs in Huh7 cells. This might be due to low transfection efficiency of this cell line in general. All together it is to say that [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337035 BBa_K337035] and [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337036 BBa_K337036] show comparable expression.<br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
=== Characterization of part binding sites ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053], [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]) ===<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites into the 3'UTR of a GOI. In case a referring shRNA miR is endogenously present or co-expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interaction <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3] . It turned out, that no obvious effect of different binding sites on reporter gene expression could be measured (data not shown). We assume that the RSV promoter driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. Luc2 and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. This was achieved by co-transfection the tuning construct with corresponding shRNA miRhaat and as a control a miRNA w/o binding sites in the target 3'UTR. The experiment was done in a 96-well plate by plating 5000 Hela cells/well 24h before transfection. Transfection was done using Fugene transfection reagent. 2.5ng of tuning construct were co-transfected with the shRNA miR construct of a concentration of 25 ng (1:10). Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. The data preciously shows a tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through cloning of perfect binding sites into the 3'UTR to the reporter gene(always green bar on the left hand side of the figures). 100% refers to ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). We chose the data obtained by the construct with the U6 promoter as this promoter is more efficient than the H1 promoter, ensuring that the system is saturated and ensuring that the data is reproducible. The same constructs were also used for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be used for mice injections since the expressed shRNA miR against human alpha-1-antitrypsine (hAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
[[Image:Haat U6HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_SV40_Luc2 construct cotransfected with a reference renilla construct.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT. The shhAAT was expressed from a pSB_U6 plasmid]]<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_SV40 Luc2 double transfected with a reference renilla construct.''' The shRNA_hAAT construct was expressed from a pSB_H1 construct.]]<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. The perfect binding site [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052] shows knockdown of about 96%. point mut 10 (1), point mut 10 (2) and point mut 11 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053] (2) always show strong knockdown, whereas bulge 16-18 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054] , only seed and bulge 9-12(2) show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
<br/><br />
<br />
=== Characterization of synthetic single microRNA binding sites ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]) ===<br />
<br />
Binding sites for miR122 were experimentally characterized by cloning them into psiCHECK-2 backbone (Promega). [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual luciferase assay] was conducted using this time Renilla Luciferase as a reporter and the other luciferase as a reference for normalization. Figure 3 shows again a broad range of regulation depending on binding site sequence properties. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055] (mut 99) is the construct with the perfect binding site and leads to an knock-down percentage of 96%. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056] (mut 7) is an imperfect binding site which leads to a knockdown percentage of 64%. [http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057](mut 111) is an imperfect binding site with a knockdown efficiency of 24%. All this contributes to a real tuning effect by introducing binding sites with introduced mismatches following the rational design protocol.<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br /><br />
<br />
=== Characterization of synthetic microRNA binding site patterns against endogenous miR122 ===<br />
<br />
We used the miMeasure plasmid with the BB-2 standard to characterise binding sites for the endogenously expressed miR122. We cloned two different synthetic microRNA binding site patterns into our miMeasure construct plasmid: 3.1 BBa_K337008 and 1.3 BBa_K337000. As the binding site is inserted downstream of green fluorescent protein (EGFP), a regulation of EGFP expression is to be expected. miMeasure normalizes knockdown of EGFP to the unregulated blue fluorescent protein (EBFP2). By calculating the ratio of EGFP to EBFP2 we determined the knockdown percentage characteristic of the binding site patterns. <br><br />
<br />
We tested these constructs in four different set-ups with three different cell lines: <br />
• HeLa cells, which do not express miR122 endogenously <br />
• HeLa cells cotransfected with miR122 to mimic endogenous expression<br />
• HuH7 cells, which are liver cells known to express miR122, and <br />
• HepG2 cells, liver cells known to express low amounts of miR122 (Douglas, 2010) <br><br />
<br />
EGFP to EBFP2 ratios were measured with flow cytometry and microscopy. Measurement results for the four cell lines and the binding sites 3.1 BBa_K337008 and 1.3 BBa_K337000 are shown in Fig. 4 for all four cell line setups. As expected, no down regulation of EGFP expression was measured in HeLa cells. Similarly, no down regulation was observed in HepG2 cells. Both the construct 1.3 (containing two perfect binding sites with the extra 10bp spacer in between) and 3.1 (containing 3 perfect binding sites) managed to increase the down regulation effect of EGFP in Huh7 cells and in HeLa cells cotransfected with miR122 in comparison to the single perfect binding site. <br />
<br />
[[Image:Download-1.jpg|thumb|center|600px|'''Figure 4: miMeasure in four different set-ups with three different cell lines''' The construct containing synthetic microRNA binding site patterns against endogenous miR122 transfected into different cell lines. The EGFP/EBFP2 ratio for the construct containing no binding site was set to one.]]<br />
<br />
=== Characterization of the bidirectional CMV promoter ===<br />
<br />
The bidirectional CMV promoter is a new standard part out of our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure construct]. <br />
The promoter was used to express two reporter genes with a comparable transcription rate. Referring to the figures below, this is the case.<br />
<br />
[[Image:HeLa nobinding imageOverview.png|thumb|center|600px| Left panel: EGFP channel. Middle panel: EBFP channel. Right panel: merge of both the others.]]<br />
<br />
[[Image:GFPvsBFPHeLa nobinding miM.png|thumb|center|400px| EBFP intensities against EGFP intensities. Correlation coefficient is given.]]<br />
<br />
==References==<br />
*Douglas D:Small Molecule Modifiers of MicroRNA miR-122 Function for the Treatment of Hepatitis C Virus Infection and Hepatocellular Carcinoma. JACS. 2010 May 15; 132(23):7976-81.<br><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-28T00:58:31Z<p>Laura Nadine: /* Off-Targeting Using Endogenous miRNA */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Single_Pagetop|project_miRNA_Kit}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [https://2010.igem.org/Team:Heidelberg/Notebook/Material pBS_U6])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
<br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with [https://2010.igem.org/Team:Heidelberg/Parts miBricks] <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from either the same or a second construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operator (Tet02) that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor tagged with binding sites for an endogenous miRNA, that is specifically expressed in the target cells/tissue. In consequence, the TetR is knocked down, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and in silico simulation'''.<br />
<br />
=== miTuner Kit components ===<br />
The miTuner Kit consists of three basic components: <br /><br />
:a) A kit of standardized synthetic microRNAs, corresponding binding sites, promoters and luciferase expression constructs as well as measurement constructs assembled in the BB-2 standard. As the miTuner kit was enabled <br /><br />
:b) Protocols for engineering synthetic microRNAs, synthetic single microRNA binding sites as well as microRNA binding site patterns <br />
Please find further information about the kit components and engineering of the kit [[2010.igem.org/wiki/index.php?title=Team:Heidelberg/Project/miRNA_Kit|here]].<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
In our experiment, we transfected Huh7 (human hepatoma) cells that endogenously overexpress miR122 with the miTuner construct after cloning different variations of binding sites for miR122 behind firefly luciferase. Figure 5 shows the results of the dual luciferase assay. Perfect binding sites result in almost complete inhibition of expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Mutated Binding Sites Against miR122'''<br />
|Sequence||Mutation||Description<br />
|-<br />
|G ACAAACACCATTGTCACACTCCA TCTAGA GC||none||perfect BS<br />
|-<br />
|G ACAAACACCAT_ACGG_ACACTCCAGAGACACAAACACCAT_GAAG_ACACTCCA GC ||none||2x perfect BS<br />
|-<br />
|G C*C*CCTG*A*TGGGG*G*CGACACTCCA TCTAGA GC ||point mutations outside seed||HCV5 BS<br />
|-<br />
|TCGA G *AC*T*AA*GGCTGCT*CCAT*CAacactcca TCTAGA GC||one mutation inside seed||Aldo<br />
|-<br />
|TCGA G ACAAACACCATTGTCA*G*A*T*TC*G*A TCTAGA GC ||3 mutations in seed||3mutseed<br />
|-<br />
|G ACAAACACCAT_ACGA_ACACTCCA TCTAGA GC ||ACGA bulge||bulge region<br />
|-<br />
|TCGA G ACAAACACCAT_GCAG_ACACTCCA TCTAGA GC||GCAG bulge||bulge region<br />
|}<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (Jopling et al., 2005). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
[[Image:101010on system.jpg|thumb|center|500px|'''Figure 6: Activation of gene expression upon Tet Repressor knockdown by liver-specific miR122]]<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
<!--Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).--><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== <i>In Vitro</i> Regulation of a Therapeutic Gene hAAT ===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, i. e. human alpha-1-antitrypsin (hAAT). Tight control of the genetic activity is fundamental, since deficiencies of hAAT can cause emphysema {{HDref|Lu et al., 2006}}. With our tuning kit we have a powerful mean at hand to mediate expression levels. In this approach, we tagged hAAT, that we used as our GOI, with binding sites (for miRsAg) that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand (data not shown). There is some evidence, that the principle works also with this therapeutic gene in HeLa cells (fig. 7). This is a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.<br />
[[Image:HAAT ELISA.png|thumb|center|400px|'''Figure 7: hAAT expression in relative units depending on binding site properties.''' SV40 driven hAAT was fused to binding sites for miRsAg that was expressed from a co-transfected plasmid in HeLa cells.]]<br />
It is obvious: different binding sites result in different knockdowns of gene expression. Some imperfect binding sites - e. g. single seed region - indicate even similar expression levels in accordance to the figures shown before. It can be stated, that the tuning idea seems to work for attempts varying in applied miRNAs, binding sites and reporter genes. <br />
The hAAT as a GOI is worth testing because it is mainly secreted in liver -our target tissue of choice. Efficient transduction can be accomplished by infection with [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based selected viruses]. Dealing with hAAt intertwines our two approaches of specific gene therapy, therefor being a relevant field for future research.<br />
<br />
===<i>In Vivo</i> Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
*Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23;116(2):281-97.<br><br />
*Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA-target recognition. PLoS Biol. 2005 Mar;3(3):e85.<br><br />
*Brown BD, Naldini L.: Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat Rev *Genet. 2009 Aug;10(8):578-8<br><br />
*Chekulaeva M, Filipowicz W.:Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr Opin Cell Biol. 2009 Jun;21(3):452-60.<br><br />
*Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
*Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br><br />
*Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P.: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005 Sep 2;309(5740):1577-81.<br><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/Homology_BasedTeam:Heidelberg/Notebook/Capsid Shuffling/Homology Based2010-10-28T00:41:49Z<p>Laura Nadine: /* Homology Based Capsid Shuffling */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_homology}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#009be1; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|colspan="6"| ||'''1'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''2'''||'''3'''||'''4'''||'''5'''||'''6'''||'''7'''||'''8'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''9'''||'''10'''||'''11'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/August#31.2F08.2F2010 31]'''||colspan="5"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#03.2F09.2F2010 3]'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#10.2F09.2F2010 10]'''||'''11'''||'''12'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''13'''||'''14'''||'''15'''||'''16'''||'''17'''||'''18'''||'''19'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#30.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#15.2F10.2F2010 15]'''||'''16'''||'''17'''||'''18'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''19'''||'''20'''||'''21'''||'''22'''||'''23'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
= Homology Based Capsid Shuffling =<br />
<br />
<br />
<br><br />
<br><br><br><br />
<center><br />
[[Image:HomBasShuffling_934px.png|600px]]<br />
</center><br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/Homology_BasedTeam:Heidelberg/Notebook/Capsid Shuffling/Homology Based2010-10-28T00:38:19Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_homology}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#009be1; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|colspan="6"| ||'''1'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''2'''||'''3'''||'''4'''||'''5'''||'''6'''||'''7'''||'''8'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''9'''||'''10'''||'''11'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''21'''||'''22'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''23'''||'''24'''||'''25'''||'''26'''||'''27'''||'''28'''||'''29'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''30'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/August#31.2F08.2F2010 31]'''||colspan="5"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#03.2F09.2F2010 3]'''||'''4'''||'''5'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#10.2F09.2F2010 10]'''||'''11'''||'''12'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''13'''||'''14'''||'''15'''||'''16'''||'''17'''||'''18'''||'''19'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/September#30.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/Homology_Based/October#15.2F10.2F2010 15]'''||'''16'''||'''17'''||'''18'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''19'''||'''20'''||'''21'''||'''22'''||'''23'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
= Homology Based Capsid Shuffling =<br />
<br />
<center><br />
[[Image:HomBasShuffling_934px.png|500px]]<br />
</center><br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Notebook/miRNA_KitTeam:Heidelberg/Notebook/miRNA Kit2010-10-28T00:35:15Z<p>Laura Nadine: /* Synthetic miRNA Kit */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_mirna_kit}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#009be1; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|colspan="6"| ||'''1'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''2'''||'''3'''||'''4'''||'''5'''||'''6'''||'''7'''||'''8'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''9'''||'''10'''||'''11'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#21/08/2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#22.2F08.2F2010 22]'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#23.2F08.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#24.2F08.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#25.2F08.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#26.2F08.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#27.2F08.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#28.2F08.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#29.2F08.2F2010 29]'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''[[Igem2010/Main/synthetic_miR_Kit/August#30/08/2010|30]]'''||'''[[Igem2010/Main/synthetic_miR_Kit/August#31/08/2010|31]]'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#19/10/2010 19]'''||'''20'''||'''21'''||'''22'''||'''23'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
<br />
<br />
= Synthetic miRNA Kit =<br />
<center><br />
[[Image:MiTuner p.png|400px| miTuner plasmid]]<br />
<br />
>/center><br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Notebook/miRNA_KitTeam:Heidelberg/Notebook/miRNA Kit2010-10-28T00:27:07Z<p>Laura Nadine: /* Synthetic miRNA Kit */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_mirna_kit}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#009be1; border: 1.5px solid #000000;"<br />
|- border="0"<br />
! colspan="7" style="background:#f09600;" | [https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August<font color="white">August</font>]<br />
|- style="background:#f09600; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|colspan="6"| ||'''1'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''2'''||'''3'''||'''4'''||'''5'''||'''6'''||'''7'''||'''8'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''9'''||'''10'''||'''11'''||'''12'''||'''13'''||'''14'''||'''15'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''16'''||'''17'''||'''18'''||'''19'''||'''20'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#21/08/2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#22.2F08.2F2010 22]'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#23.2F08.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#24.2F08.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#25.2F08.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#26.2F08.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#27.2F08.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#28.2F08.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/August#29.2F08.2F2010 29]'''<br />
|- style="background:#f2f2f2; color:#009be1"<br />
|'''[[Igem2010/Main/synthetic_miR_Kit/August#30/08/2010|30]]'''||'''[[Igem2010/Main/synthetic_miR_Kit/August#31/08/2010|31]]'''||colspan="5"|<br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/miRNA_Kit/October#19/10/2010 19]'''||'''20'''||'''21'''||'''22'''||'''23'''||'''24'''||'''25'''<br />
|- style="background:#f2f2f2; color:#f09600"<br />
|'''26'''||'''27'''||'''28'''||'''29'''||'''30'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#f09600"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
<br />
<br />
= Synthetic miRNA Kit =<br />
<br />
[[Image:MiTuner p.png|400px| miTuner plasmid]]<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-28T00:22:17Z<p>Laura Nadine: /* In Vitro Regulation of a Therapeutic Gene, hAAT */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Single_Pagetop|project_miRNA_Kit}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [https://2010.igem.org/Team:Heidelberg/Notebook/Material pBS_U6])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
<br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with [https://2010.igem.org/Team:Heidelberg/Parts miBricks] <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from either the same or a second construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operator (Tet02) that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor tagged with binding sites for an endogenous miRNA, that is specifically expressed in the target cells/tissue. In consequence, the TetR is knocked down, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and in silico simulation'''.<br />
<br />
=== miTuner Kit components ===<br />
The miTuner Kit consists of three basic components: <br /><br />
:a) A kit of standardized synthetic microRNAs, corresponding binding sites, promoters and luciferase expression constructs as well as measurement constructs assembled in the BB-2 standard. As the miTuner kit was enabled <br /><br />
:b) Protocols for engineering synthetic microRNAs, synthetic single microRNA binding sites as well as microRNA binding site patterns <br />
Please find further information about the kit components and engineering of the kit [[2010.igem.org/wiki/index.php?title=Team:Heidelberg/Project/miRNA_Kit|here]].<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
In our experiment, we transfected Huh7 (human hepatoma) cells that endogenously overexpress miR122 with the miTuner construct after cloning different variations of binding sites for miR122 behind firefly luciferase. Figure 5 shows the results of the dual luciferase assay. Perfect binding sites result in almost complete inhibition of expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Mutated Binding Sites Against miR122'''<br />
|Number||Sequence||Mutation||Description<br />
|-<br />
|102||G ACAAACACCATTGTCACACTCCA TCTAGA GC||none||perfect BS<br />
|-<br />
|134||G ACAAACACCAT_ACGG_ACACTCCAGAGACACAAACACCAT_GAAG_ACACTCCA GC ||none||2x perfect BS<br />
|-<br />
|140||G C*C*CCTG*A*TGGGG*G*CGACACTCCA TCTAGA GC ||point mutations outside seed||HCV5 BS<br />
|-<br />
|142||TCGA G *AC*T*AA*GGCTGCT*CCAT*CAacactcca TCTAGA GC||one mutation inside seed||Aldo<br />
|-<br />
|155||TCGA G ACAAACACCATTGTCA*G*A*T*TC*G*A TCTAGA GC ||3 mutations in seed||<br />
|-<br />
|201||G ACAAACACCAT_ACGA_ACACTCCA TCTAGA GC ||ACGA bulge||bulge region<br />
|-<br />
|203||TCGA G ACAAACACCAT_GCAG_ACACTCCA TCTAGA GC||GCAG bulge||bulge region<br />
|}<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (Jopling et al., 2005). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
[[Image:101010on system.jpg|thumb|center|500px|'''Figure 6: Activation of gene expression upon Tet Repressor knockdown by liver-specific miR122]]<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
<!--Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).--><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== <i>In Vitro</i> Regulation of a Therapeutic Gene hAAT ===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, i. e. human alpha-1-antitrypsin (hAAT). Tight control of the genetic activity is fundamental, since deficiencies of hAAT can cause emphysema {{HDref|Lu et al., 2006}}. With our tuning kit we have a powerful mean at hand to mediate expression levels. In this approach, we tagged hAAT, that we used as our GOI, with binding sites (for miRsAg) that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand (data not shown). There is some evidence, that the principle works also with this therapeutic gene in HeLa cells (fig. 7). This is a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.<br />
[[Image:HAAT ELISA.png|thumb|center|400px|'''Figure 7: hAAT expression in relative units depending on binding site properties.''' SV40 driven hAAT was fused to binding sites for miRsAg that was expressed from a co-transfected plasmid in HeLa cells.]]<br />
It is obvious: different binding sites result in different knockdowns of gene expression. Some imperfect binding sites - e. g. single seed region - indicate even similar expression levels in accordance to the figures shown before. It can be stated, that the tuning idea seems to work for attempts varying in applied miRNAs, binding sites and reporter genes. <br />
The hAAT as a GOI is worth testing because it is mainly secreted in liver -our target tissue of choice. Efficient transduction can be accomplished by infection with [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based selected viruses]. Dealing with hAAt intertwines our two approaches of specific gene therapy, therefor being a relevant field for future research.<br />
<br />
===<i>In Vivo</i> Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
*Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23;116(2):281-97.<br><br />
*Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA-target recognition. PLoS Biol. 2005 Mar;3(3):e85.<br><br />
*Brown BD, Naldini L.: Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat Rev *Genet. 2009 Aug;10(8):578-8<br><br />
*Chekulaeva M, Filipowicz W.:Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr Opin Cell Biol. 2009 Jun;21(3):452-60.<br><br />
*Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
*Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br><br />
*Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P.: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005 Sep 2;309(5740):1577-81.<br><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-28T00:16:19Z<p>Laura Nadine: /* Discussion */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Single_Pagetop|project_miRNA_Kit}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [https://2010.igem.org/Team:Heidelberg/Notebook/Material pBS_U6])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
<br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with [https://2010.igem.org/Team:Heidelberg/Parts miBricks] <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from either the same or a second construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operator (Tet02) that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor tagged with binding sites for an endogenous miRNA, that is specifically expressed in the target cells/tissue. In consequence, the TetR is knocked down, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and in silico simulation'''.<br />
<br />
=== miTuner Kit components ===<br />
The miTuner Kit consists of three basic components: <br /><br />
:a) A kit of standardized synthetic microRNAs, corresponding binding sites, promoters and luciferase expression constructs as well as measurement constructs assembled in the BB-2 standard. As the miTuner kit was enabled <br /><br />
:b) Protocols for engineering synthetic microRNAs, synthetic single microRNA binding sites as well as microRNA binding site patterns <br />
Please find further information about the kit components and engineering of the kit [[2010.igem.org/wiki/index.php?title=Team:Heidelberg/Project/miRNA_Kit|here]].<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
In our experiment, we transfected Huh7 (human hepatoma) cells that endogenously overexpress miR122 with the miTuner construct after cloning different variations of binding sites for miR122 behind firefly luciferase. Figure 5 shows the results of the dual luciferase assay. Perfect binding sites result in almost complete inhibition of expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Mutated Binding Sites Against miR122'''<br />
|Number||Sequence||Mutation||Description<br />
|-<br />
|102||G ACAAACACCATTGTCACACTCCA TCTAGA GC||none||perfect BS<br />
|-<br />
|134||G ACAAACACCAT_ACGG_ACACTCCAGAGACACAAACACCAT_GAAG_ACACTCCA GC ||none||2x perfect BS<br />
|-<br />
|140||G C*C*CCTG*A*TGGGG*G*CGACACTCCA TCTAGA GC ||point mutations outside seed||HCV5 BS<br />
|-<br />
|142||TCGA G *AC*T*AA*GGCTGCT*CCAT*CAacactcca TCTAGA GC||one mutation inside seed||Aldo<br />
|-<br />
|155||TCGA G ACAAACACCATTGTCA*G*A*T*TC*G*A TCTAGA GC ||3 mutations in seed||<br />
|-<br />
|201||G ACAAACACCAT_ACGA_ACACTCCA TCTAGA GC ||ACGA bulge||bulge region<br />
|-<br />
|203||TCGA G ACAAACACCAT_GCAG_ACACTCCA TCTAGA GC||GCAG bulge||bulge region<br />
|}<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (Jopling et al., 2005). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
[[Image:101010on system.jpg|thumb|center|500px|'''Figure 6: Activation of gene expression upon Tet Repressor knockdown by liver-specific miR122]]<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
<!--Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).--><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== <i>In Vitro</i> Regulation of a Therapeutic Gene, hAAT ===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, i. e. human alpha-1-antitrypsin (hAAT). Tight control of the genetic activity is fundamental, since deficiencies of hAAT can cause emphysema {{HDref|Lu et al., 2006}}. With our tuning kit we have a powerful mean at hand to mediate expression levels. In this approach, we tagged hAAT, that we used as our GOI, with binding sites (for miRsAg) that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand (data not shown). There is some evidence, that the principle works also with this therapeutic gene in HeLa cells (fig. 7). This is a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.<br />
[[Image:HAAT ELISA.png|thumb|center|400px|'''Figure 7: hAAT expression in relative units depending on binding site properties.''' SV40 driven hAAT was fused to binding sites for miRsAg that was expressed from a co-transfected plasmid in HeLa cells.]]<br />
It is obvious: different binding sites result in different knockdowns of gene expression. Some imperfect binding sites - e. g. single seed region - indicate even similar expression levels in accordance to the figures shown before. It can be stated, that the tuning idea seems to work for attempts varying in applied miRNAs, binding sites and reporter genes. <br />
The hAAT as a GOI is worth testing because it is mainly secreted in liver -our target tissue of choice. Efficient transduction can be accomplished by infection with [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based selected viruses]. Dealing with hAAt intertwines our two approaches of specific gene therapy, therefor being a relevant field for future research.<br />
<br />
===<i>In Vivo</i> Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
*Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23;116(2):281-97.<br><br />
*Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA-target recognition. PLoS Biol. 2005 Mar;3(3):e85.<br><br />
*Brown BD, Naldini L.: Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat Rev *Genet. 2009 Aug;10(8):578-8<br><br />
*Chekulaeva M, Filipowicz W.:Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr Opin Cell Biol. 2009 Jun;21(3):452-60.<br><br />
*Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
*Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br><br />
*Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P.: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005 Sep 2;309(5740):1577-81.<br><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/Capsid_ShufflingTeam:Heidelberg/Project/Capsid Shuffling2010-10-28T00:07:35Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|project_capsid_shuffling}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__NOTOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
<br />
=Capsid Shuffling=<br />
<br />
<h3>Limitations in tropism and transduction efficitency and widespread immunization of human targets are the drawbacks of current gene-therapeutic approaches based on wildtype adeno-associated viruses. We were able to overcome these problems by using two different methods to shuffle capsid genes and produce synthetic viruses that can be evolved to infect tissues of choice specifically. Homology based shuffling by DNaseI digestion and self-primed PCR were used to produce a library of randomized novel viruses. Additionally, we introduce ViroBytes, a random assembly protocol based on rationally design capsid parts.</h3><br />
<br />
== Introduction ==<br />
<br />
Adeno-associated viruses (AAVs) are a class of single stranded DNA viruses that are not able to replicate without a helper virus. This makes them a perfect tool for the iGEM community, as no special safety requirements have to be fulfilled to work with a non-replication virus, because it is non-pathogenic. Because of their wide range of tropism they are used for transgene delivery in a variety of gene therapeutic approaches.<br />
<br />
In the class of AAVs, there are several serotypes that have been isolated from humans or non-human primates, the first and most well-known of them being AAV2. AAV serotypes are defined as naturally evolved variants of AAV that do not react to the same antibodies. All serotypes show different tissue specificites when injected into mouse or humans, and this tissue tropism is thought to be mainly due to interactions between the virus capsid and receptors on the cell surface. <br />
<br />
Most AAVs exhibit a rather broad tropism, AAV2 and AAV9 for example have been shown to transduce liver, muscle, lung and nervous system. Other serotypes, for example AAV1 and AAV7, can infect very rapidly or more efficiently than others {{HDref|reviewed in Wu et al., 2006}}. Although diverse, not one of the AAVs would make a good gene delivery shuttle by itself. Various approaches have been undertaken to change or combine AAVs in order to alter their tropism or transduction efficiency. These approaches mostly target the capsid genes by rationally creating AAV hybrids with certain properties or fusing targeting ligands to the proteins {{HDref|reviewed in Gao et al., 2005}}.<br />
<br />
Another fundamental drawback of wild type AAVs for applicability in gene therapy is their high abundance in nature. It has been estimated that up to 80% of humans are immune against AAV2, which has a potentially fatal impact in clinical studies using AAV2 {{HDref|Moskalenko et al., 2000}}. This can be circumvented by introducing functionally relevant sequences from AAV serotypes that have been isolated from non-human species while engineering virus hybrids. <br />
<br />
The Heidelberg iGEM team 2010 uses two independent approaches to engineer synthetic AAVs based on capsid shuffling. In addition to [https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit miRNA-mediated On- and Off- Targeting] of specific cell types, we created viruses with more specific tropism for delivery of our transgenes. Even more importantly, we developed a new method for a simplified and efficient production of shuffled capsid AAV libraries that we call [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes ViroBytes].<br />
<br />
===[https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based Homology Based Capsid Shuffling]===<br />
<br />
===[https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes ViroBytes]===<br />
<br />
== References ==<br />
<br />
<br />
Wu Z, Asokan A, Samulski RJ. Adeno-associated virus serotypes: vector toolkit for human gene therapy. Mol Ther 2006;14(3):316–27 <br> Gao, G., Vandenberghe, L. H., and Wilson, J. M. (2005). New recombinant serotypes of AAV vectors. Curr. Gene Ther. 5: 285 – 297.<br>Moskalenko, M., Chen, L., van Roey, M., Donahue, B.A., Snyder, R.O., McArthur, J.G., and Patel, S.D. (2000) Epitope mapping of human antiadeno-associated virus type 2 neutralizing antibodies: implications for gene therapy and virus structure. J. Virol. 74: 1761-6.<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miMeasureTeam:Heidelberg/Project/miMeasure2010-10-27T23:49:42Z<p>Laura Nadine: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|pro_miMeasure}}<br />
__NOTOC__<br />
{{:Team:Heidelberg/Side_Top}}<br />
[[Image:MiMeasure.png|frameless|250px|miMeasure Plasmid]]<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
=miMeasure=<br />
<br />
<br />
<br />
<h3> The '''miMeasure''' standard plasmid has been engineered to enable the easy input of synthetic microRNA binding sites behind one of two fluorescent proteins while the second is used for normalization. Expression of regulated reporter and control from a bidirectional CMV promter guarantee faithful and reproducible measurements in any kind of cell. The fluorescence readout can be used to quantify the regulatory efficiency of the binding site in knockdown percentage. Once the properties of a synthetic binding site are elucidated, they can be used to manipulate and accurately fine-tune gene expression in vitro and in vivo. </h3><br />
<br />
==Introduction==<br />
Micro RNAs mainly regulate the translation of their target genes by interacting with regions in the 3' untranslated region (UTR) of their target mRNA. Base-pairing with the miRNA binding site (BS) causes formation of diverse miRNA-mRNA duplexes {{HDref|reviewed by Fabian et al., 2010}}. The BS consists of a seven nucleotide long seed region that is perfectly matched to the miRNA, and surrounding regions that matched partially. The seed region is defined as being the minimal required base-pairing that can regulate the mRNA. Apart from the seed region, binding can be unspecific, creating mismatches and bulges. The position and properties of the bulges seem to play a central role in miRNA binding and therefore knockdown efficiency {{HDref|reviewed by Bartel et al., 2009}}. Since we were going to use synthetic miRNA BS in our genetherapeutic approach, we had to find a way to study their effects in a standardized manner that would be comparable and reproducible. <br><br />
<br />
One goal of the iGEM Team Heidelberg 2010 was to test the effects of changes in BS sequences on expression control. Thereby miRNA BS should be characterized. To standardize our measurements of knockdown according to BS specificity, we had to come up with a new standard that is independent from the endogenous cell machinery. We decided to bring synthetic miRNAs into play, hence we engineered BS for them creating an artificial regulatory circuit<!--, simulating naturally occurring miRNAs and miRNA BS without having to worry about the effect of endogenous targets-->. Of course there are also differences that arise through the availability of the enzymes involved in the miRNA pathway that may differ slightly from cell to cell. Therefore, constructs containing changes in BS sequences has to be compared to construct containing no binding sites and containing perfect binding sites. Ideally, the miRNA would be stably expressed in the cell line, but a uniform co-transfection also leads to an even distribution of synthetic shRNA-like miRNAs (shRNA miRs). Additionally, miRNA levels can be adjusted by differing transfection ratios. <br><br />
<br />
The main purpose of our measurement standard, miMeasure, is to express two nearly identical but discernible proteins: one of them tagged with a BS, the other one unregulated (even though the possibility exists to clone in a reference binding site). The two reporters are expressed by a bidirectional CMV promoter to make sure their transcription rate is comparable. We used a destabilized version of GFP, dsEGFP and a dsEBFP2 that was derived from the same sequence ([https://2010.igem.org/Team:Heidelberg/Project/miMeasure#References Ai et al., 2007]). Thus, we could make sure that both proteins exhibit the same synthesis and degradation properties, making them directly comparable. Hereby, we can also neglect the difference between mRNA and protein knockdown and can take the fluorescence of the marker protein as a direct, linear output of mRNA down-regulation. We included a BBb standard site into our plasmid, which allows to clone BS behind the GFP. If co-transfected with the corresponding shRNA miR, GFP will be down-regulated, while BFP expression is maintained. The ratio of GFP to BFP expression can be used to conclude the knockdown efficiency of the BS. Having destabilized marker proteins with a turnover time of two hours enables us not only to avoid accumulation of marker proteins, which would make the knockdown harder to observe, but also to conduct time-lapse experiments. In the future, this could be for example a way to observe dynamic activity patterns of endogenous miRNAs.<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
<br />
<br />
===Analysis of Randomized Binding Sites Against Synthetic miRNA===<br />
<br />
====Confocal microscopy measurements====<br />
<br />
We used microscopy analysis to determine the EGFP expression in relation to EBFP2. EBFP2 serves as a normalization for transfection efficiency. Nine miMeasure constructs with different binding sites were designed. Those were cloned downstream of EGFP behind the miMeasure construct, whereas the EBFP2 expression stays unaffected. The GFP/BFP-ratio stand for the level of GFP-expression normalized to one copy per cell. We modified binding sites for the synthetic miRNA by introducing random basepairs surrounding the seed region as described above, thereby changing the knockdown efficiency. In figure 1 we plotted the knockdown percentage of our constructs. The miMeasure construct and negative control were [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection co-transfected] with either shRNA miRsAg expressed from a CMV promoter on pcDNA5 or an inert synthetic RNA as control in 1:4 ratio, respectively. <br />
<br />
[[Image:M12-M22_HeLa_daten.jpg|thumb|500px|center|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs M12-M22 including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Used Binding Sites and Their Features'''<br />
|sequence||binding site feature||Name<br />
|-<br />
|ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS<br />
|-<br />
|ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| 10-12 ACG<br />
|-<br />
|ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA<br />
|-<br />
|ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ACGG<br />
|-<br />
|ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ATGT<br />
|-<br />
|ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10 G<br />
|-<br />
|ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10 A<br />
|-<br />
|ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11 A<br />
|-<br />
|ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18 ATG<br />
|-<br />
|-||miMeasure without any binding site||NC (negative control)<br />
|-<br />
|}<br />
<br />
<br />
Comparing the GFP/BFP-ratio between the constructs, we can see a significant difference of GFP expression between the negative control and the construct containing the perfect binding site. Since the control is not downregulated due to lack of binding sites, we set it as 100% expression on this chart. It can be seen that the perfect binding sites causes the lowest GFP expression, approximately 50%, while other binding sites range in between 55% and 100% of expression. <br />
<br />
<!--discussion?The seed region is altered in M22. Since the seed region is considered the most important site for knock-down efficiency, its change diminishes the knock-down capability of the binding site completely. So the GFP expression in this case is as high as the negative control, where no binding site was inserted into the miMeasure plasmid. --><br />
<br />
<br />
<!--[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection Transfection] with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 4 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.<br />
<br />
Condition '''a''': cotransfection with stuffer (salmon sperm DNA) <br />
<br />
Condition '''b''': cotransfection with synthetic RNA miRsAg <br />
<br />
Condition '''c''': cotransfection with empty pcDNA5<br />
<br />
Condition '''d''': cotransfection with synthetic shRNA3<br />
<br />
A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d. The cells were used for measurements on day three.--><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
====Flow cytometry measurements====<br />
<br />
Hela cells transfected with the constructs (described above) are also taken for flow cytometry. Each measurement contains around 10000 cells. The cells are plotted on a logarithmic scale in relation to EGFP and EBFP2 intensity. Each dot intensity represents the count of fluorescent cells for each EGFP/EBFP2 intensity pair. The dots are colour coded, so that the orange dots represent cells cotransfected with different miMeasure constructs and the miRsAg and the blue one represent cells cotransfected with non-specific miRNA (miR-155), respectively. So the blue set of measurements represent the negative control. Before the real measurements, cells transfected with EGFP or EBFP2 alone were measured to establish the gain of the detectors and compensate for fluorescent bleedthrough, especially of EBFP2 into the EGFP channel . This ensured that EGFP and EBFP2 alone shows a perfectly horizontal and vertical distribution respectively (data not shown). For the miMeasure constructs, both population of dots make up a oblique line on the logarithmic scale, which shows the correlation of EGFP and EBFP2 very well. If the two different coloured dots overlap, they become white. Thus both lines overlap almost completely in the negative control containing no binding site, whereas the orange line shifts to the left for the miMeasure construct with the perfect binding site. All the other constructs are like the negative control.<br />
As the difference is subtle on the logarithmic scale, we also observed the cell distribution on a linear scale. All coloured distributions appeared more scattered on the linear scale, but the shifting of the orange dots was more visible for the construct containing the perfect binding site. again all the other constructs have the same range of scattering as the negative control. <br />
<br />
[[Image:Flow1.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a logarithmic scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]^<br />
<br />
[[Image:Flow-linear-result.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a linear scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
Flow cytometry offers an efficient way to estimate the efficiency of expression regulation. Here we could observe that while the perfect binding site generate a partial knockdown, all modified binding site constructs looked similar to the negative control. To characterize potential differences that cannot be identified by flow cytometry, we next imaged the same cells and precisely quantified their fluorescence intensity using laser scanning confocal microscopy at high resolution.<br />
<br />
===Analysis of miRaPCR Generated Binding Sites Against a Natural miRNA===<br />
<br />
<br />
<br />
The [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July miRaPCR] generates binding sites out of rationally designed fragments. These are aligned with each other by chance, whereby different spacer regions are inserted randomly in between. It has been suggested that having more than one binding site of for the same miRNA behind each other can lead to stronger down-regulation than a single one. If imperfect binding sites are aligned, it is also supposed to be stronger than a single one. This is what we tested using MiRaPCR for effortless assembly of binding site fragments.<br />
For our experiments, we took advantage of the high abundance of miRNA 122 in liver cells and tested different combinations of binding sites created by miRaPCR. We transfected HeLa and HuH7 cells with the constructs described in table 2. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells in 2:1 ratio. The result shows the ratio between GFP and BFP normalized to the negative control (miMeasure constructs without binding sites). The miMeasure constructs were also compared to the expression of miMeasure containing one perfect binding site for miRNA 122.<br />
<br />
The transfected HeLa are also imaged with the epifluorescent microscope. Large amount of cells in the negative control (miMeasure with perfect binding site cotransfected with miR-155, see a)are green, whereas most cells with the miMeasure construct containing the perfect binding sites (see b) are blue. <br />
<br />
[[Image:BLUE+green.jpg|thumb|600px|center|'''epifluorescent microscopy image (10x) of Hela cells transfected with miMeasure''' miMeasure with a perfect binding site is a) cotransfected with miR-155, which has no specificity to miR-122, b) cotransfected with miR-122, which is complementary to the perfect binding site. EGFP is regulated by miR-122, EBFP2 is unregulated and serves as transfection control.]]<br />
<br />
<br />
The image analysis of confocal microscopy gives the following results:<br />
<br />
[[Image:MiMeasure_miR122.jpg|thumb|500px|center|''' different binding sites for miR122, HeLa cotransfected with miR122 expression plasmid''']]<br />
<br />
<br />
The EGFP-expression normalized to the EGFB2 expression is set to 100% for the miMeasure construct transfected with the non-matching miRNA (in this case miR-155). The knock-down efficiency of one perfect binding site is around 30%, which also accounts for the three aligned perfect binding sites and the two aligned imperfect ones. The binding site with bulges from position 9-12 and 9-22 don't show any knock-down. <br />
<br />
<br />
[[Image:MiMeasure_miR122b.jpg|thumb|500px|left|''' different binding sites for miR122, Huh7 cells''']]<br />
<br />
<br />
<br />
<br />
<!--Discussion This experiment shows, that the binding site pattern with 3 aligned perfect binding sites miM-1.3-7 gives the strongest knock-down. Whereby the binding site pattern with two imperfect binding sites 1-8 is weaker, but still stronger than the negative control. If one binding site is randomized from nucleotide 9-12 or 9-22 miM-r12, miM-r22, it loses its capability of protein down-regulation.--><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, right"|'''Table2: miRaPCR Designed Binding Sites and Their Features<br />
|binding site feature'''||Name/number<br />
|-<br />
|miMeasure with 3 aligned perfect binding sites||miM-1.3-7<br />
|-<br />
|miMeasure with two imperfect binding sites||miM-3.1-8<br />
|-<br />
|miMeasure with randomised nucleotides 9-12||miM-r12<br />
|-<br />
|miMeasure with randomised nucleotides 9-22||miM-r22<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The Huh7 cells were also transfected with the 4 different constructs. Here a cotransfection with miR-122 is not necessary, since Huh7 cells express miR-122 themselves. The knock-down of the perfect binding sites are stronger than the knock-down in the Hela cells. Here the knock-down efficiency is 80% for the perfect binding site and the aligned constructs. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
====Flow cytometry====<br />
<br />
<br />
The same constructs in Hela cells were analyzed by flow cytometry, too. Here the orange dots also represent the miMeasure construct transfected with the specific miRNA and the blue dots make up the negative control. The orange dots from the construct containing the perfect and the aligned binding sites have lower EGFP expression compared to EBFP2 expression, since the EGFP trend doesn't correspond to the EBFP2 trend, but shifts to the laft. The orange dots rise with the fluorescence intensity and collapses to zero, when the EBFP2 intensity is high. For the other constructs the EGFP range fully corresponds with the EBFP2 range. <br />
The linear plot shows the orange and blue dots in more distinct lines. The orange dots from the construct containing the perfect and aligned binding sites assemble along the y-axis, where the EGFP fluorescence intensity is zero. For the other construct the EGFP line fully overlap with the EBFP2. <br />
<br />
<br />
[[Image:Flow_miR122.jpg|thumb|620px|center|'''EGFP2/EBFP correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
[[Image:Flow_miR122_linear.jpg|thumb|620px|center|'''EGFP/EBFP2 correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of endogenous miRNA===<br />
<br />
HepG2, another liver cell line, is also transfected with the constructs containing the perfect and the aligned constructs for miR-122. The cotransfection with miR-155 serves again as a negative control. For this cell line there was only a slight knock-down observed for all of the constructs, it is much less compared to the HuH7 cell line, where the knock-down ranges from 20-40%. <br />
<br />
[[Image:HepG2_mir122_microscopy-1.jpg|thumb|620px|center|'''relative EGFP expression of transfected HepG2 cells according to confocal microscopy analysis''' different binding sites for miR122 are cotransfected with miR-122. The negative control doesn't contain any binding sites.]]<br />
<br />
<br />
<br />
The EGFP/EBFP2 ratio from each transfected HuH7 cell is calculated for 52 cells. The cells were transfected with the construct carriying the three aligned perfect binding sites against miR-122. The EGFP/EBFP2 ratio in each cell is different and ranges from 0.1 to 6.<br />
<br />
[[Image:single cellmiRNA expression-1.jpg|thumb|620px|center|'''relative EGFP expression of transfected HuH7 cells according to confocal microscopy analysis''' the construct with the three aligned perfect binding sites for miR122 are cotransfected with miR-122.]]<br />
<br />
[[Image:Single_cellmiRNA_expression_cells.jpg|thumb|620px|center|]]<br />
<br />
==Discussion==<br />
<br />
==Methods==<br />
<br />
The fluorescence of GFP and BFP can be compared using different methods, for example automated fluorescence plate reader systems, [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Flow_cytometry flow cytometry] or manual and automated fluorescence [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==References==<br />
<br />
Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry. 2007 May 22;46(20):5904-10.<br />
<br />
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009 Jan 23;136(2):215-33.<br />
<br />
Coulouarn C, Factor VM, Andersen JB, Durkin ME, Thorgeirsson SS. Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic propertiesmiR-122 repression is a marker of tumor progression in HCC. Oncogene. 2009 Oct 8;28(40):3526-36.<br />
<br />
Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 2010;79:351-79.<br />
<br />
Girard M, Jacquemin E, Munnich A, Lyonnet S, Henrion-Caude A. miR-122, a paradigm for the role of microRNAs in the liver. J Hepatol. 2008 Apr;48(4):648-56.<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miMeasureTeam:Heidelberg/Project/miMeasure2010-10-27T23:48:48Z<p>Laura Nadine: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|pro_miMeasure}}<br />
__NOTOC__<br />
{{:Team:Heidelberg/Side_Top}}<br />
[[Image:MiMeasure.png|frameless|250px|miMeasure Plasmid]]<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
=miMeasure=<br />
<br />
<br />
<br />
<h3> The '''miMeasure''' standard plasmid has been engineered to enable the easy input of synthetic microRNA binding sites behind one of two fluorescent proteins while the second is used for normalization. Expression of regulated reporter and control from a bidirectional CMV promter guarantee faithful and reproducible measurements in any kind of cell. The fluorescence readout can be used to quantify the regulatory efficiency of the binding site in knockdown percentage. Once the properties of a synthetic binding site are elucidated, they can be used to manipulate and accurately fine-tune gene expression in vitro and in vivo. </h3><br />
<br />
==Introduction==<br />
Micro RNAs mainly regulate the translation of their target genes by interacting with regions in the 3' untranslated region (UTR) of their target mRNA. Base-pairing with the miRNA binding site (BS) causes formation of diverse miRNA-mRNA duplexes {{HDref|reviewed by Fabian et al., 2010}}. The BS consists of a seven nucleotide long seed region that is perfectly matched to the miRNA, and surrounding regions that matched partially. The seed region is defined as being the minimal required base-pairing that can regulate the mRNA. Apart from the seed region, binding can be unspecific, creating mismatches and bulges. The position and properties of the bulges seem to play a central role in miRNA binding and therefore knockdown efficiency {{HDref|reviewed by Bartel et al., 2009}}. Since we were going to use synthetic miRNA BS in our genetherapeutic approach, we had to find a way to study their effects in a standardized manner that would be comparable and reproducible. <br />
One goal of the iGEM Team Heidelberg 2010 was to test the effects of changes in BS sequences on expression control. Thereby miRNA BS should be characterized. To standardize our measurements of knockdown according to BS specificity, we had to come up with a new standard that is independent from the endogenous cell machinery. We decided to bring synthetic miRNAs into play, hence we engineered BS for them creating an artificial regulatory circuit<!--, simulating naturally occurring miRNAs and miRNA BS without having to worry about the effect of endogenous targets-->. Of course there are also differences that arise through the availability of the enzymes involved in the miRNA pathway that may differ slightly from cell to cell. Therefore, constructs containing changes in BS sequences has to be compared to construct containing no binding sites and containing perfect binding sites. Ideally, the miRNA would be stably expressed in the cell line, but a uniform co-transfection also leads to an even distribution of synthetic shRNA-like miRNAs (shRNA miRs). Additionally, miRNA levels can be adjusted by differing transfection ratios. <br />
The main purpose of our measurement standard, miMeasure, is to express two nearly identical but discernible proteins: one of them tagged with a BS, the other one unregulated (even though the possibility exists to clone in a reference binding site). The two reporters are expressed by a bidirectional CMV promoter to make sure their transcription rate is comparable. We used a destabilized version of GFP, dsEGFP and a dsEBFP2 that was derived from the same sequence ([https://2010.igem.org/Team:Heidelberg/Project/miMeasure#References Ai et al., 2007]). Thus, we could make sure that both proteins exhibit the same synthesis and degradation properties, making them directly comparable. Hereby, we can also neglect the difference between mRNA and protein knockdown and can take the fluorescence of the marker protein as a direct, linear output of mRNA down-regulation. We included a BBb standard site into our plasmid, which allows to clone BS behind the GFP. If co-transfected with the corresponding shRNA miR, GFP will be down-regulated, while BFP expression is maintained. The ratio of GFP to BFP expression can be used to conclude the knockdown efficiency of the BS. Having destabilized marker proteins with a turnover time of two hours enables us not only to avoid accumulation of marker proteins, which would make the knockdown harder to observe, but also to conduct time-lapse experiments. In the future, this could be for example a way to observe dynamic activity patterns of endogenous miRNAs.<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
<br />
<br />
===Analysis of Randomized Binding Sites Against Synthetic miRNA===<br />
<br />
====Confocal microscopy measurements====<br />
<br />
We used microscopy analysis to determine the EGFP expression in relation to EBFP2. EBFP2 serves as a normalization for transfection efficiency. Nine miMeasure constructs with different binding sites were designed. Those were cloned downstream of EGFP behind the miMeasure construct, whereas the EBFP2 expression stays unaffected. The GFP/BFP-ratio stand for the level of GFP-expression normalized to one copy per cell. We modified binding sites for the synthetic miRNA by introducing random basepairs surrounding the seed region as described above, thereby changing the knockdown efficiency. In figure 1 we plotted the knockdown percentage of our constructs. The miMeasure construct and negative control were [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection co-transfected] with either shRNA miRsAg expressed from a CMV promoter on pcDNA5 or an inert synthetic RNA as control in 1:4 ratio, respectively. <br />
<br />
[[Image:M12-M22_HeLa_daten.jpg|thumb|500px|center|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs M12-M22 including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Used Binding Sites and Their Features'''<br />
|sequence||binding site feature||Name<br />
|-<br />
|ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS<br />
|-<br />
|ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| 10-12 ACG<br />
|-<br />
|ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA<br />
|-<br />
|ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ACGG<br />
|-<br />
|ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ATGT<br />
|-<br />
|ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10 G<br />
|-<br />
|ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10 A<br />
|-<br />
|ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11 A<br />
|-<br />
|ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18 ATG<br />
|-<br />
|-||miMeasure without any binding site||NC (negative control)<br />
|-<br />
|}<br />
<br />
<br />
Comparing the GFP/BFP-ratio between the constructs, we can see a significant difference of GFP expression between the negative control and the construct containing the perfect binding site. Since the control is not downregulated due to lack of binding sites, we set it as 100% expression on this chart. It can be seen that the perfect binding sites causes the lowest GFP expression, approximately 50%, while other binding sites range in between 55% and 100% of expression. <br />
<br />
<!--discussion?The seed region is altered in M22. Since the seed region is considered the most important site for knock-down efficiency, its change diminishes the knock-down capability of the binding site completely. So the GFP expression in this case is as high as the negative control, where no binding site was inserted into the miMeasure plasmid. --><br />
<br />
<br />
<!--[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection Transfection] with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 4 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.<br />
<br />
Condition '''a''': cotransfection with stuffer (salmon sperm DNA) <br />
<br />
Condition '''b''': cotransfection with synthetic RNA miRsAg <br />
<br />
Condition '''c''': cotransfection with empty pcDNA5<br />
<br />
Condition '''d''': cotransfection with synthetic shRNA3<br />
<br />
A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d. The cells were used for measurements on day three.--><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
====Flow cytometry measurements====<br />
<br />
Hela cells transfected with the constructs (described above) are also taken for flow cytometry. Each measurement contains around 10000 cells. The cells are plotted on a logarithmic scale in relation to EGFP and EBFP2 intensity. Each dot intensity represents the count of fluorescent cells for each EGFP/EBFP2 intensity pair. The dots are colour coded, so that the orange dots represent cells cotransfected with different miMeasure constructs and the miRsAg and the blue one represent cells cotransfected with non-specific miRNA (miR-155), respectively. So the blue set of measurements represent the negative control. Before the real measurements, cells transfected with EGFP or EBFP2 alone were measured to establish the gain of the detectors and compensate for fluorescent bleedthrough, especially of EBFP2 into the EGFP channel . This ensured that EGFP and EBFP2 alone shows a perfectly horizontal and vertical distribution respectively (data not shown). For the miMeasure constructs, both population of dots make up a oblique line on the logarithmic scale, which shows the correlation of EGFP and EBFP2 very well. If the two different coloured dots overlap, they become white. Thus both lines overlap almost completely in the negative control containing no binding site, whereas the orange line shifts to the left for the miMeasure construct with the perfect binding site. All the other constructs are like the negative control.<br />
As the difference is subtle on the logarithmic scale, we also observed the cell distribution on a linear scale. All coloured distributions appeared more scattered on the linear scale, but the shifting of the orange dots was more visible for the construct containing the perfect binding site. again all the other constructs have the same range of scattering as the negative control. <br />
<br />
[[Image:Flow1.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a logarithmic scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]^<br />
<br />
[[Image:Flow-linear-result.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a linear scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
Flow cytometry offers an efficient way to estimate the efficiency of expression regulation. Here we could observe that while the perfect binding site generate a partial knockdown, all modified binding site constructs looked similar to the negative control. To characterize potential differences that cannot be identified by flow cytometry, we next imaged the same cells and precisely quantified their fluorescence intensity using laser scanning confocal microscopy at high resolution.<br />
<br />
===Analysis of miRaPCR Generated Binding Sites Against a Natural miRNA===<br />
<br />
<br />
<br />
The [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July miRaPCR] generates binding sites out of rationally designed fragments. These are aligned with each other by chance, whereby different spacer regions are inserted randomly in between. It has been suggested that having more than one binding site of for the same miRNA behind each other can lead to stronger down-regulation than a single one. If imperfect binding sites are aligned, it is also supposed to be stronger than a single one. This is what we tested using MiRaPCR for effortless assembly of binding site fragments.<br />
For our experiments, we took advantage of the high abundance of miRNA 122 in liver cells and tested different combinations of binding sites created by miRaPCR. We transfected HeLa and HuH7 cells with the constructs described in table 2. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells in 2:1 ratio. The result shows the ratio between GFP and BFP normalized to the negative control (miMeasure constructs without binding sites). The miMeasure constructs were also compared to the expression of miMeasure containing one perfect binding site for miRNA 122.<br />
<br />
The transfected HeLa are also imaged with the epifluorescent microscope. Large amount of cells in the negative control (miMeasure with perfect binding site cotransfected with miR-155, see a)are green, whereas most cells with the miMeasure construct containing the perfect binding sites (see b) are blue. <br />
<br />
[[Image:BLUE+green.jpg|thumb|600px|center|'''epifluorescent microscopy image (10x) of Hela cells transfected with miMeasure''' miMeasure with a perfect binding site is a) cotransfected with miR-155, which has no specificity to miR-122, b) cotransfected with miR-122, which is complementary to the perfect binding site. EGFP is regulated by miR-122, EBFP2 is unregulated and serves as transfection control.]]<br />
<br />
<br />
The image analysis of confocal microscopy gives the following results:<br />
<br />
[[Image:MiMeasure_miR122.jpg|thumb|500px|center|''' different binding sites for miR122, HeLa cotransfected with miR122 expression plasmid''']]<br />
<br />
<br />
The EGFP-expression normalized to the EGFB2 expression is set to 100% for the miMeasure construct transfected with the non-matching miRNA (in this case miR-155). The knock-down efficiency of one perfect binding site is around 30%, which also accounts for the three aligned perfect binding sites and the two aligned imperfect ones. The binding site with bulges from position 9-12 and 9-22 don't show any knock-down. <br />
<br />
<br />
[[Image:MiMeasure_miR122b.jpg|thumb|500px|left|''' different binding sites for miR122, Huh7 cells''']]<br />
<br />
<br />
<br />
<br />
<!--Discussion This experiment shows, that the binding site pattern with 3 aligned perfect binding sites miM-1.3-7 gives the strongest knock-down. Whereby the binding site pattern with two imperfect binding sites 1-8 is weaker, but still stronger than the negative control. If one binding site is randomized from nucleotide 9-12 or 9-22 miM-r12, miM-r22, it loses its capability of protein down-regulation.--><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, right"|'''Table2: miRaPCR Designed Binding Sites and Their Features<br />
|binding site feature'''||Name/number<br />
|-<br />
|miMeasure with 3 aligned perfect binding sites||miM-1.3-7<br />
|-<br />
|miMeasure with two imperfect binding sites||miM-3.1-8<br />
|-<br />
|miMeasure with randomised nucleotides 9-12||miM-r12<br />
|-<br />
|miMeasure with randomised nucleotides 9-22||miM-r22<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The Huh7 cells were also transfected with the 4 different constructs. Here a cotransfection with miR-122 is not necessary, since Huh7 cells express miR-122 themselves. The knock-down of the perfect binding sites are stronger than the knock-down in the Hela cells. Here the knock-down efficiency is 80% for the perfect binding site and the aligned constructs. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
====Flow cytometry====<br />
<br />
<br />
The same constructs in Hela cells were analyzed by flow cytometry, too. Here the orange dots also represent the miMeasure construct transfected with the specific miRNA and the blue dots make up the negative control. The orange dots from the construct containing the perfect and the aligned binding sites have lower EGFP expression compared to EBFP2 expression, since the EGFP trend doesn't correspond to the EBFP2 trend, but shifts to the laft. The orange dots rise with the fluorescence intensity and collapses to zero, when the EBFP2 intensity is high. For the other constructs the EGFP range fully corresponds with the EBFP2 range. <br />
The linear plot shows the orange and blue dots in more distinct lines. The orange dots from the construct containing the perfect and aligned binding sites assemble along the y-axis, where the EGFP fluorescence intensity is zero. For the other construct the EGFP line fully overlap with the EBFP2. <br />
<br />
<br />
[[Image:Flow_miR122.jpg|thumb|620px|center|'''EGFP2/EBFP correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
[[Image:Flow_miR122_linear.jpg|thumb|620px|center|'''EGFP/EBFP2 correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of endogenous miRNA===<br />
<br />
HepG2, another liver cell line, is also transfected with the constructs containing the perfect and the aligned constructs for miR-122. The cotransfection with miR-155 serves again as a negative control. For this cell line there was only a slight knock-down observed for all of the constructs, it is much less compared to the HuH7 cell line, where the knock-down ranges from 20-40%. <br />
<br />
[[Image:HepG2_mir122_microscopy-1.jpg|thumb|620px|center|'''relative EGFP expression of transfected HepG2 cells according to confocal microscopy analysis''' different binding sites for miR122 are cotransfected with miR-122. The negative control doesn't contain any binding sites.]]<br />
<br />
<br />
<br />
The EGFP/EBFP2 ratio from each transfected HuH7 cell is calculated for 52 cells. The cells were transfected with the construct carriying the three aligned perfect binding sites against miR-122. The EGFP/EBFP2 ratio in each cell is different and ranges from 0.1 to 6.<br />
<br />
[[Image:single cellmiRNA expression-1.jpg|thumb|620px|center|'''relative EGFP expression of transfected HuH7 cells according to confocal microscopy analysis''' the construct with the three aligned perfect binding sites for miR122 are cotransfected with miR-122.]]<br />
<br />
[[Image:Single_cellmiRNA_expression_cells.jpg|thumb|620px|center|]]<br />
<br />
==Discussion==<br />
<br />
==Methods==<br />
<br />
The fluorescence of GFP and BFP can be compared using different methods, for example automated fluorescence plate reader systems, [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Flow_cytometry flow cytometry] or manual and automated fluorescence [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==References==<br />
<br />
Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry. 2007 May 22;46(20):5904-10.<br />
<br />
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009 Jan 23;136(2):215-33.<br />
<br />
Coulouarn C, Factor VM, Andersen JB, Durkin ME, Thorgeirsson SS. Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic propertiesmiR-122 repression is a marker of tumor progression in HCC. Oncogene. 2009 Oct 8;28(40):3526-36.<br />
<br />
Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 2010;79:351-79.<br />
<br />
Girard M, Jacquemin E, Munnich A, Lyonnet S, Henrion-Caude A. miR-122, a paradigm for the role of microRNAs in the liver. J Hepatol. 2008 Apr;48(4):648-56.<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miMeasureTeam:Heidelberg/Project/miMeasure2010-10-27T23:47:24Z<p>Laura Nadine: /* miMeasure */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|pro_miMeasure}}<br />
__NOTOC__<br />
{{:Team:Heidelberg/Side_Top}}<br />
[[Image:MiMeasure.png|frameless|250px|miMeasure Plasmid]]<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
=miMeasure=<br />
<br />
<br />
<br />
<h3> The '''miMeasure''' standard plasmid has been engineered to enable the easy input of synthetic microRNA binding sites behind one of two fluorescent proteins while the second is used for normalization. Expression of regulated reporter and control from a bidirectional CMV promter guarantee faithful and reproducible measurements in any kind of cell. The fluorescence readout can be used to quantify the regulatory efficiency of the binding site in knockdown percentage. Once the properties of a synthetic binding site are elucidated, they can be used to manipulate and accurately fine-tune gene expression in vitro and in vivo. </h3><br />
<br />
==Introduction==<br />
Micro RNAs regulate mainly the translation of their target genes by preferably interacting with regions in the 3’ untranslated region (UTR) of their target mRNA. Base-pairing with the miRNA binding site (BS) causes formation of diverse miRNA-mRNA duplexes {{HDref|reviewed by Fabian et al., 2010}}. The BS consists of a seven nucleotide long seed region that is perfectly matched to the miRNA, and surrounding regions that matched partially. The seed region is defined as being the minimal required base-pairing that can regulate the mRNA. Apart from the seed region, binding can be unspecific, creating mismatches and bulges. The position and properties of the bulges seem to play a central role in miRNA binding and therefore knockdown efficiency {{HDref|reviewed by Bartel et al., 2009}}. Since we were going to use synthetic miRNA BS in our genetherapeutic approach, we had to find a way to study their effects in a standardized manner that would be comparable and reproducible. <br />
One goal of the iGEM Team Heidelberg 2010 was to test the effects of changes in BS sequences on expression control. Thereby miRNA BS should be characterized. To standardize our measurements of knockdown according to BS specificity, we had to come up with a new standard that is independent from the endogenous cell machinery. We decided to bring synthetic miRNAs into play, hence we engineered BS for them creating an artificial regulatory circuit<!--, simulating naturally occurring miRNAs and miRNA BS without having to worry about the effect of endogenous targets-->. Of course there are also differences that arise through the availability of the enzymes involved in the miRNA pathway that may differ slightly from cell to cell. Therefore, constructs containing changes in BS sequences has to be compared to construct containing no binding sites and containing perfect binding sites. Ideally, the miRNA would be stably expressed in the cell line, but a uniform co-transfection also leads to an even distribution of synthetic shRNA-like miRNAs (shRNA miRs). Additionally, miRNA levels can be adjusted by differing transfection ratios. <br />
The main purpose of our measurement standard, miMeasure, is to express two nearly identical but discernible proteins: one of them tagged with a BS, the other one unregulated (even though the possibility exists to clone in a reference binding site). The two reporters are expressed by a bidirectional CMV promoter to make sure their transcription rate is comparable. We used a destabilized version of GFP, dsEGFP and a dsEBFP2 that was derived from the same sequence ([https://2010.igem.org/Team:Heidelberg/Project/miMeasure#References Ai et al., 2007]). Thus, we could make sure that both proteins exhibit the same synthesis and degradation properties, making them directly comparable. Hereby, we can also neglect the difference between mRNA and protein knockdown and can take the fluorescence of the marker protein as a direct, linear output of mRNA down-regulation. We included a BBb standard site into our plasmid, which allows to clone BS behind the GFP. If co-transfected with the corresponding shRNA miR, GFP will be down-regulated, while BFP expression is maintained. The ratio of GFP to BFP expression can be used to conclude the knockdown efficiency of the BS. Having destabilized marker proteins with a turnover time of two hours enables us not only to avoid accumulation of marker proteins, which would make the knockdown harder to observe, but also to conduct time-lapse experiments. In the future, this could be for example a way to observe dynamic activity patterns of endogenous miRNAs.<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
<br />
<br />
===Analysis of Randomized Binding Sites Against Synthetic miRNA===<br />
<br />
====Confocal microscopy measurements====<br />
<br />
We used microscopy analysis to determine the EGFP expression in relation to EBFP2. EBFP2 serves as a normalization for transfection efficiency. Nine miMeasure constructs with different binding sites were designed. Those were cloned downstream of EGFP behind the miMeasure construct, whereas the EBFP2 expression stays unaffected. The GFP/BFP-ratio stand for the level of GFP-expression normalized to one copy per cell. We modified binding sites for the synthetic miRNA by introducing random basepairs surrounding the seed region as described above, thereby changing the knockdown efficiency. In figure 1 we plotted the knockdown percentage of our constructs. The miMeasure construct and negative control were [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection co-transfected] with either shRNA miRsAg expressed from a CMV promoter on pcDNA5 or an inert synthetic RNA as control in 1:4 ratio, respectively. <br />
<br />
[[Image:M12-M22_HeLa_daten.jpg|thumb|500px|center|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs M12-M22 including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Used Binding Sites and Their Features'''<br />
|sequence||binding site feature||Name<br />
|-<br />
|ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS<br />
|-<br />
|ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| 10-12 ACG<br />
|-<br />
|ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA<br />
|-<br />
|ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ACGG<br />
|-<br />
|ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ATGT<br />
|-<br />
|ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10 G<br />
|-<br />
|ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10 A<br />
|-<br />
|ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11 A<br />
|-<br />
|ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18 ATG<br />
|-<br />
|-||miMeasure without any binding site||NC (negative control)<br />
|-<br />
|}<br />
<br />
<br />
Comparing the GFP/BFP-ratio between the constructs, we can see a significant difference of GFP expression between the negative control and the construct containing the perfect binding site. Since the control is not downregulated due to lack of binding sites, we set it as 100% expression on this chart. It can be seen that the perfect binding sites causes the lowest GFP expression, approximately 50%, while other binding sites range in between 55% and 100% of expression. <br />
<br />
<!--discussion?The seed region is altered in M22. Since the seed region is considered the most important site for knock-down efficiency, its change diminishes the knock-down capability of the binding site completely. So the GFP expression in this case is as high as the negative control, where no binding site was inserted into the miMeasure plasmid. --><br />
<br />
<br />
<!--[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection Transfection] with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 4 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.<br />
<br />
Condition '''a''': cotransfection with stuffer (salmon sperm DNA) <br />
<br />
Condition '''b''': cotransfection with synthetic RNA miRsAg <br />
<br />
Condition '''c''': cotransfection with empty pcDNA5<br />
<br />
Condition '''d''': cotransfection with synthetic shRNA3<br />
<br />
A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d. The cells were used for measurements on day three.--><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
====Flow cytometry measurements====<br />
<br />
Hela cells transfected with the constructs (described above) are also taken for flow cytometry. Each measurement contains around 10000 cells. The cells are plotted on a logarithmic scale in relation to EGFP and EBFP2 intensity. Each dot intensity represents the count of fluorescent cells for each EGFP/EBFP2 intensity pair. The dots are colour coded, so that the orange dots represent cells cotransfected with different miMeasure constructs and the miRsAg and the blue one represent cells cotransfected with non-specific miRNA (miR-155), respectively. So the blue set of measurements represent the negative control. Before the real measurements, cells transfected with EGFP or EBFP2 alone were measured to establish the gain of the detectors and compensate for fluorescent bleedthrough, especially of EBFP2 into the EGFP channel . This ensured that EGFP and EBFP2 alone shows a perfectly horizontal and vertical distribution respectively (data not shown). For the miMeasure constructs, both population of dots make up a oblique line on the logarithmic scale, which shows the correlation of EGFP and EBFP2 very well. If the two different coloured dots overlap, they become white. Thus both lines overlap almost completely in the negative control containing no binding site, whereas the orange line shifts to the left for the miMeasure construct with the perfect binding site. All the other constructs are like the negative control.<br />
As the difference is subtle on the logarithmic scale, we also observed the cell distribution on a linear scale. All coloured distributions appeared more scattered on the linear scale, but the shifting of the orange dots was more visible for the construct containing the perfect binding site. again all the other constructs have the same range of scattering as the negative control. <br />
<br />
[[Image:Flow1.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a logarithmic scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]^<br />
<br />
[[Image:Flow-linear-result.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a linear scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
Flow cytometry offers an efficient way to estimate the efficiency of expression regulation. Here we could observe that while the perfect binding site generate a partial knockdown, all modified binding site constructs looked similar to the negative control. To characterize potential differences that cannot be identified by flow cytometry, we next imaged the same cells and precisely quantified their fluorescence intensity using laser scanning confocal microscopy at high resolution.<br />
<br />
===Analysis of miRaPCR Generated Binding Sites Against a Natural miRNA===<br />
<br />
<br />
<br />
The [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July miRaPCR] generates binding sites out of rationally designed fragments. These are aligned with each other by chance, whereby different spacer regions are inserted randomly in between. It has been suggested that having more than one binding site of for the same miRNA behind each other can lead to stronger down-regulation than a single one. If imperfect binding sites are aligned, it is also supposed to be stronger than a single one. This is what we tested using MiRaPCR for effortless assembly of binding site fragments.<br />
For our experiments, we took advantage of the high abundance of miRNA 122 in liver cells and tested different combinations of binding sites created by miRaPCR. We transfected HeLa and HuH7 cells with the constructs described in table 2. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells in 2:1 ratio. The result shows the ratio between GFP and BFP normalized to the negative control (miMeasure constructs without binding sites). The miMeasure constructs were also compared to the expression of miMeasure containing one perfect binding site for miRNA 122.<br />
<br />
The transfected HeLa are also imaged with the epifluorescent microscope. Large amount of cells in the negative control (miMeasure with perfect binding site cotransfected with miR-155, see a)are green, whereas most cells with the miMeasure construct containing the perfect binding sites (see b) are blue. <br />
<br />
[[Image:BLUE+green.jpg|thumb|600px|center|'''epifluorescent microscopy image (10x) of Hela cells transfected with miMeasure''' miMeasure with a perfect binding site is a) cotransfected with miR-155, which has no specificity to miR-122, b) cotransfected with miR-122, which is complementary to the perfect binding site. EGFP is regulated by miR-122, EBFP2 is unregulated and serves as transfection control.]]<br />
<br />
<br />
The image analysis of confocal microscopy gives the following results:<br />
<br />
[[Image:MiMeasure_miR122.jpg|thumb|500px|center|''' different binding sites for miR122, HeLa cotransfected with miR122 expression plasmid''']]<br />
<br />
<br />
The EGFP-expression normalized to the EGFB2 expression is set to 100% for the miMeasure construct transfected with the non-matching miRNA (in this case miR-155). The knock-down efficiency of one perfect binding site is around 30%, which also accounts for the three aligned perfect binding sites and the two aligned imperfect ones. The binding site with bulges from position 9-12 and 9-22 don't show any knock-down. <br />
<br />
<br />
[[Image:MiMeasure_miR122b.jpg|thumb|500px|left|''' different binding sites for miR122, Huh7 cells''']]<br />
<br />
<br />
<br />
<br />
<!--Discussion This experiment shows, that the binding site pattern with 3 aligned perfect binding sites miM-1.3-7 gives the strongest knock-down. Whereby the binding site pattern with two imperfect binding sites 1-8 is weaker, but still stronger than the negative control. If one binding site is randomized from nucleotide 9-12 or 9-22 miM-r12, miM-r22, it loses its capability of protein down-regulation.--><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, right"|'''Table2: miRaPCR Designed Binding Sites and Their Features<br />
|binding site feature'''||Name/number<br />
|-<br />
|miMeasure with 3 aligned perfect binding sites||miM-1.3-7<br />
|-<br />
|miMeasure with two imperfect binding sites||miM-3.1-8<br />
|-<br />
|miMeasure with randomised nucleotides 9-12||miM-r12<br />
|-<br />
|miMeasure with randomised nucleotides 9-22||miM-r22<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The Huh7 cells were also transfected with the 4 different constructs. Here a cotransfection with miR-122 is not necessary, since Huh7 cells express miR-122 themselves. The knock-down of the perfect binding sites are stronger than the knock-down in the Hela cells. Here the knock-down efficiency is 80% for the perfect binding site and the aligned constructs. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
====Flow cytometry====<br />
<br />
<br />
The same constructs in Hela cells were analyzed by flow cytometry, too. Here the orange dots also represent the miMeasure construct transfected with the specific miRNA and the blue dots make up the negative control. The orange dots from the construct containing the perfect and the aligned binding sites have lower EGFP expression compared to EBFP2 expression, since the EGFP trend doesn't correspond to the EBFP2 trend, but shifts to the laft. The orange dots rise with the fluorescence intensity and collapses to zero, when the EBFP2 intensity is high. For the other constructs the EGFP range fully corresponds with the EBFP2 range. <br />
The linear plot shows the orange and blue dots in more distinct lines. The orange dots from the construct containing the perfect and aligned binding sites assemble along the y-axis, where the EGFP fluorescence intensity is zero. For the other construct the EGFP line fully overlap with the EBFP2. <br />
<br />
<br />
[[Image:Flow_miR122.jpg|thumb|620px|center|'''EGFP2/EBFP correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
[[Image:Flow_miR122_linear.jpg|thumb|620px|center|'''EGFP/EBFP2 correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of endogenous miRNA===<br />
<br />
HepG2, another liver cell line, is also transfected with the constructs containing the perfect and the aligned constructs for miR-122. The cotransfection with miR-155 serves again as a negative control. For this cell line there was only a slight knock-down observed for all of the constructs, it is much less compared to the HuH7 cell line, where the knock-down ranges from 20-40%. <br />
<br />
[[Image:HepG2_mir122_microscopy-1.jpg|thumb|620px|center|'''relative EGFP expression of transfected HepG2 cells according to confocal microscopy analysis''' different binding sites for miR122 are cotransfected with miR-122. The negative control doesn't contain any binding sites.]]<br />
<br />
<br />
<br />
The EGFP/EBFP2 ratio from each transfected HuH7 cell is calculated for 52 cells. The cells were transfected with the construct carriying the three aligned perfect binding sites against miR-122. The EGFP/EBFP2 ratio in each cell is different and ranges from 0.1 to 6.<br />
<br />
[[Image:single cellmiRNA expression-1.jpg|thumb|620px|center|'''relative EGFP expression of transfected HuH7 cells according to confocal microscopy analysis''' the construct with the three aligned perfect binding sites for miR122 are cotransfected with miR-122.]]<br />
<br />
[[Image:Single_cellmiRNA_expression_cells.jpg|thumb|620px|center|]]<br />
<br />
==Discussion==<br />
<br />
==Methods==<br />
<br />
The fluorescence of GFP and BFP can be compared using different methods, for example automated fluorescence plate reader systems, [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Flow_cytometry flow cytometry] or manual and automated fluorescence [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==References==<br />
<br />
Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry. 2007 May 22;46(20):5904-10.<br />
<br />
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009 Jan 23;136(2):215-33.<br />
<br />
Coulouarn C, Factor VM, Andersen JB, Durkin ME, Thorgeirsson SS. Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic propertiesmiR-122 repression is a marker of tumor progression in HCC. Oncogene. 2009 Oct 8;28(40):3526-36.<br />
<br />
Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 2010;79:351-79.<br />
<br />
Girard M, Jacquemin E, Munnich A, Lyonnet S, Henrion-Caude A. miR-122, a paradigm for the role of microRNAs in the liver. J Hepatol. 2008 Apr;48(4):648-56.<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/Capsid_ShufflingTeam:Heidelberg/Project/Capsid Shuffling2010-10-27T23:46:23Z<p>Laura Nadine: /* Capsid Shuffling */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|project_capsid_shuffling}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__TOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
<br />
=Capsid Shuffling=<br />
<br />
<h3>Limitations in tropism and transduction efficitency and widespread immunization of human targets are the drawbacks of current gene-therapeutic approaches based on wildtype adeno-associated viruses. We were able to overcome these problems by using two different methods to shuffle capsid genes and produce synthetic viruses that can be evolved to infect tissues of choice specifically. Homology based shuffling by DNaseI digestion and self-primed PCR were used to produce a library of randomized novel viruses. Additionally, we introduce ViroBytes, a random assembly protocol based on rationally design capsid parts.</h3><br />
<br />
== Introduction ==<br />
<br />
Adeno-associated viruses (AAVs) are a class of single stranded DNA viruses that are not able to replicate without a helper virus. This makes them a perfect tool for the iGEM community, as no special safety requirements have to be fulfilled to work with a non-replication virus, because it is non-pathogenic. Because of their wide range of tropism they are used for transgene delivery in a variety of gene therapeutic approaches.<br />
<br />
In the class of AAVs, there are several serotypes that have been isolated from humans or non-human primates, the first and most well-known of them being AAV2. AAV serotypes are defined as naturally evolved variants of AAV that do not react to the same antibodies. All serotypes show different tissue specificites when injected into mouse or humans, and this tissue tropism is thought to be mainly due to interactions between the virus capsid and receptors on the cell surface. <br />
<br />
Most AAVs exhibit a rather broad tropism, AAV2 and AAV9 for example have been shown to transduce liver, muscle, lung and nervous system. Other serotypes, for example AAV1 and AAV7, can infect very rapidly or more efficiently than others {{HDref|reviewed in Wu et al., 2006}}. Although diverse, not one of the AAVs would make a good gene delivery shuttle by itself. Various approaches have been undertaken to change or combine AAVs in order to alter their tropism or transduction efficiency. These approaches mostly target the capsid genes by rationally creating AAV hybrids with certain properties or fusing targeting ligands to the proteins {{HDref|reviewed in Gao et al., 2005}}.<br />
<br />
Another fundamental drawback of wild type AAVs for applicability in gene therapy is their high abundance in nature. It has been estimated that up to 80% of humans are immune against AAV2, which has a potentially fatal impact in clinical studies using AAV2 {{HDref|Moskalenko et al., 2000}}. This can be circumvented by introducing functionally relevant sequences from AAV serotypes that have been isolated from non-human species while engineering virus hybrids. <br />
<br />
The Heidelberg iGEM team 2010 uses two independent approaches to engineer synthetic AAVs based on capsid shuffling. In addition to [https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit miRNA-mediated On- and Off- Targeting] of specific cell types, we created viruses with more specific tropism for delivery of our transgenes. Even more importantly, we developed a new method for a simplified and efficient production of shuffled capsid AAV libraries that we call [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes ViroBytes].<br />
<br />
===[https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based Homology Based Capsid Shuffling]===<br />
<br />
===[https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes ViroBytes]===<br />
<br />
== References ==<br />
<br />
<br />
Wu Z, Asokan A, Samulski RJ. Adeno-associated virus serotypes: vector toolkit for human gene therapy. Mol Ther 2006;14(3):316–27 <br> Gao, G., Vandenberghe, L. H., and Wilson, J. M. (2005). New recombinant serotypes of AAV vectors. Curr. Gene Ther. 5: 285 – 297.<br>Moskalenko, M., Chen, L., van Roey, M., Donahue, B.A., Snyder, R.O., McArthur, J.G., and Patel, S.D. (2000) Epitope mapping of human antiadeno-associated virus type 2 neutralizing antibodies: implications for gene therapy and virus structure. J. Virol. 74: 1761-6.<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/Capsid_ShufflingTeam:Heidelberg/Project/Capsid Shuffling2010-10-27T23:30:01Z<p>Laura Nadine: /* Capsid Shuffling */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|project_capsid_shuffling}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
__TOC__<br />
<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
<br />
=Capsid Shuffling=<br />
<br />
===Limitations in tropism and transduction efficitency and widespread immunization of human targets are the drawbacks of current gene-therapeutic approaches based on wildtype adeno-associated viruses. We were able to overcome these problems by using two different methods to shuffle capsid genes and produce synthetic viruses that can be evolved to infect tissues of choice specifically. Homology based shuffling by DNaseI digestion and self-primed PCR were used to produce a library of randomized novel viruses. Additionally, we introduce ViroBytes, a random assembly protocol based on rationally design capsid parts.===<br />
<br />
== Introduction ==<br />
<br />
Adeno-associated viruses (AAVs) are a class of single stranded DNA viruses that are not able to replicate without a helper virus. This makes them a perfect tool for the iGEM community, as no special safety requirements have to be fulfilled to work with a non-replication virus, because it is non-pathogenic. Because of their wide range of tropism they are used for transgene delivery in a variety of gene therapeutic approaches.<br />
<br />
In the class of AAVs, there are several serotypes that have been isolated from humans or non-human primates, the first and most well-known of them being AAV2. AAV serotypes are defined as naturally evolved variants of AAV that do not react to the same antibodies. All serotypes show different tissue specificites when injected into mouse or humans, and this tissue tropism is thought to be mainly due to interactions between the virus capsid and receptors on the cell surface. <br />
<br />
Most AAVs exhibit a rather broad tropism, AAV2 and AAV9 for example have been shown to transduce liver, muscle, lung and nervous system. Other serotypes, for example AAV1 and AAV7, can infect very rapidly or more efficiently than others {{HDref|reviewed in Wu et al., 2006}}. Although diverse, not one of the AAVs would make a good gene delivery shuttle by itself. Various approaches have been undertaken to change or combine AAVs in order to alter their tropism or transduction efficiency. These approaches mostly target the capsid genes by rationally creating AAV hybrids with certain properties or fusing targeting ligands to the proteins {{HDref|reviewed in Gao et al., 2005}}.<br />
<br />
Another fundamental drawback of wild type AAVs for applicability in gene therapy is their high abundance in nature. It has been estimated that up to 80% of humans are immune against AAV2, which has a potentially fatal impact in clinical studies using AAV2 {{HDref|Moskalenko et al., 2000}}. This can be circumvented by introducing functionally relevant sequences from AAV serotypes that have been isolated from non-human species while engineering virus hybrids. <br />
<br />
The Heidelberg iGEM team 2010 uses two independent approaches to engineer synthetic AAVs based on capsid shuffling. In addition to [https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit miRNA-mediated On- and Off- Targeting] of specific cell types, we created viruses with more specific tropism for delivery of our transgenes. Even more importantly, we developed a new method for a simplified and efficient production of shuffled capsid AAV libraries that we call [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes ViroBytes].<br />
<br />
===[https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based Homology Based Capsid Shuffling]===<br />
<br />
===[https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes ViroBytes]===<br />
<br />
== References ==<br />
<br />
<br />
Wu Z, Asokan A, Samulski RJ. Adeno-associated virus serotypes: vector toolkit for human gene therapy. Mol Ther 2006;14(3):316–27 <br> Gao, G., Vandenberghe, L. H., and Wilson, J. M. (2005). New recombinant serotypes of AAV vectors. Curr. Gene Ther. 5: 285 – 297.<br>Moskalenko, M., Chen, L., van Roey, M., Donahue, B.A., Snyder, R.O., McArthur, J.G., and Patel, S.D. (2000) Epitope mapping of human antiadeno-associated virus type 2 neutralizing antibodies: implications for gene therapy and virus structure. J. Virol. 74: 1761-6.<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miMeasureTeam:Heidelberg/Project/miMeasure2010-10-27T23:17:52Z<p>Laura Nadine: /* miMeasure */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|pro_miMeasure}}<br />
__NOTOC__<br />
{{:Team:Heidelberg/Side_Top}}<br />
[[Image:MiMeasure.png|frameless|250px|miMeasure Plasmid]]<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
=miMeasure=<br />
<br />
<br />
<br />
=== The '''miMeasure''' standard plasmid has been engineered to enable the easy input of synthetic microRNA binding sites behind one of two fluorescent proteins while the second is used for normalization. Expression of regulated reporter and control from a bidirectional CMV promter guarantee faithful and reproducible measurements in any kind of cell. The fluorescence readout can be used to quantify the regulatory efficiency of the binding site in knockdown percentage. Once the properties of a synthetic binding site are elucidated, they can be used to manipulate and accurately fine-tune gene expression in vitro and in vivo. ===<br />
<br />
==Introduction==<br />
Micro RNAs regulate mainly the translation of their target genes by preferably interacting with regions in the 3’ untranslated region (UTR) of their target mRNA. Base-pairing with the miRNA binding site (BS) causes formation of diverse miRNA-mRNA duplexes {{HDref|reviewed by Fabian et al., 2010}}. The BS consists of a seven nucleotide long seed region that is perfectly matched to the miRNA, and surrounding regions that matched partially. The seed region is defined as being the minimal required base-pairing that can regulate the mRNA. Apart from the seed region, binding can be unspecific, creating mismatches and bulges. The position and properties of the bulges seem to play a central role in miRNA binding and therefore knockdown efficiency {{HDref|reviewed by Bartel et al., 2009}}. Since we were going to use synthetic miRNA BS in our genetherapeutic approach, we had to find a way to study their effects in a standardized manner that would be comparable and reproducible. <br />
One goal of the iGEM Team Heidelberg 2010 was to test the effects of changes in BS sequences on expression control. Thereby miRNA BS should be characterized. To standardize our measurements of knockdown according to BS specificity, we had to come up with a new standard that is independent from the endogenous cell machinery. We decided to bring synthetic miRNAs into play, hence we engineered BS for them creating an artificial regulatory circuit<!--, simulating naturally occurring miRNAs and miRNA BS without having to worry about the effect of endogenous targets-->. Of course there are also differences that arise through the availability of the enzymes involved in the miRNA pathway that may differ slightly from cell to cell. Therefore, constructs containing changes in BS sequences has to be compared to construct containing no binding sites and containing perfect binding sites. Ideally, the miRNA would be stably expressed in the cell line, but a uniform co-transfection also leads to an even distribution of synthetic shRNA-like miRNAs (shRNA miRs). Additionally, miRNA levels can be adjusted by differing transfection ratios. <br />
The main purpose of our measurement standard, miMeasure, is to express two nearly identical but discernible proteins: one of them tagged with a BS, the other one unregulated (even though the possibility exists to clone in a reference binding site). The two reporters are expressed by a bidirectional CMV promoter to make sure their transcription rate is comparable. We used a destabilized version of GFP, dsEGFP and a dsEBFP2 that was derived from the same sequence ([https://2010.igem.org/Team:Heidelberg/Project/miMeasure#References Ai et al., 2007]). Thus, we could make sure that both proteins exhibit the same synthesis and degradation properties, making them directly comparable. Hereby, we can also neglect the difference between mRNA and protein knockdown and can take the fluorescence of the marker protein as a direct, linear output of mRNA down-regulation. We included a BBb standard site into our plasmid, which allows to clone BS behind the GFP. If co-transfected with the corresponding shRNA miR, GFP will be down-regulated, while BFP expression is maintained. The ratio of GFP to BFP expression can be used to conclude the knockdown efficiency of the BS. Having destabilized marker proteins with a turnover time of two hours enables us not only to avoid accumulation of marker proteins, which would make the knockdown harder to observe, but also to conduct time-lapse experiments. In the future, this could be for example a way to observe dynamic activity patterns of endogenous miRNAs.<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
<br />
<br />
===Analysis of Randomized Binding Sites Against Synthetic miRNA===<br />
<br />
====Confocal microscopy measurements====<br />
<br />
We used microscopy analysis to determine the EGFP expression in relation to EBFP2. EBFP2 serves as a normalization for transfection efficiency. Nine miMeasure constructs with different binding sites were designed. Those were cloned downstream of EGFP behind the miMeasure construct, whereas the EBFP2 expression stays unaffected. The GFP/BFP-ratio stand for the level of GFP-expression normalized to one copy per cell. We modified binding sites for the synthetic miRNA by introducing random basepairs surrounding the seed region as described above, thereby changing the knockdown efficiency. In figure 1 we plotted the knockdown percentage of our constructs. The miMeasure construct and negative control were [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection co-transfected] with either shRNA miRsAg expressed from a CMV promoter on pcDNA5 or an inert synthetic RNA as control in 1:4 ratio, respectively. <br />
<br />
[[Image:M12-M22_HeLa_daten.jpg|thumb|500px|center|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs M12-M22 including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Used Binding Sites and Their Features'''<br />
|sequence||binding site feature||Name<br />
|-<br />
|ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS<br />
|-<br />
|ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| 10-12 ACG<br />
|-<br />
|ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA<br />
|-<br />
|ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ACGG<br />
|-<br />
|ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ATGT<br />
|-<br />
|ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10 G<br />
|-<br />
|ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10 A<br />
|-<br />
|ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11 A<br />
|-<br />
|ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18 ATG<br />
|-<br />
|-||miMeasure without any binding site||NC (negative control)<br />
|-<br />
|}<br />
<br />
<br />
Comparing the GFP/BFP-ratio between the constructs, we can see a significant difference of GFP expression between the negative control and the construct containing the perfect binding site. Since the control is not downregulated due to lack of binding sites, we set it as 100% expression on this chart. It can be seen that the perfect binding sites causes the lowest GFP expression, approximately 50%, while other binding sites range in between 55% and 100% of expression. <br />
<br />
<!--discussion?The seed region is altered in M22. Since the seed region is considered the most important site for knock-down efficiency, its change diminishes the knock-down capability of the binding site completely. So the GFP expression in this case is as high as the negative control, where no binding site was inserted into the miMeasure plasmid. --><br />
<br />
<br />
<!--[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection Transfection] with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 4 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.<br />
<br />
Condition '''a''': cotransfection with stuffer (salmon sperm DNA) <br />
<br />
Condition '''b''': cotransfection with synthetic RNA miRsAg <br />
<br />
Condition '''c''': cotransfection with empty pcDNA5<br />
<br />
Condition '''d''': cotransfection with synthetic shRNA3<br />
<br />
A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d. The cells were used for measurements on day three.--><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
====Flow cytometry measurements====<br />
<br />
Hela cells transfected with the constructs (described above) are also taken for flow cytometry. Each measurement contains around 10000 cells. The cells are plotted on a logarithmic scale in relation to EGFP and EBFP2 intensity. Each dot intensity represents the count of fluorescent cells for each EGFP/EBFP2 intensity pair. The dots are colour coded, so that the orange dots represent cells cotransfected with different miMeasure constructs and the miRsAg and the blue one represent cells cotransfected with non-specific miRNA (miR-155), respectively. So the blue set of measurements represent the negative control. Before the real measurements, cells transfected with EGFP or EBFP2 alone were measured to establish the gain of the detectors and compensate for fluorescent bleedthrough, especially of EBFP2 into the EGFP channel . This ensured that EGFP and EBFP2 alone shows a perfectly horizontal and vertical distribution respectively (data not shown). For the miMeasure constructs, both population of dots make up a line on the logarithmic scale, which shows the correlation of EGFP and EBFP2 very well. If the two different coloured dots overlap, they become white. Thus both lines overlap almost completely in the negative control containing no binding site, whereas the orange line shifts to the left for the miMeasure construct with the perfect binding site. All the other constructs are like the negative control.<br />
As the difference is subtle on the logarithmic scale, we also observed the cell distribution on a linear scale. All coloured distributions appeared more scattered on the linear scale, but the shifting of the orange dots was more visible for the construct containing the perfect binding site. again all the other constructs have the same range of scattering as the negative control. <br />
<br />
[[Image:Flow1.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a logarithmic scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]^<br />
<br />
[[Image:Flow-linear-result.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a linear scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of miRaPCR Generated Binding Sites Against a Natural miRNA===<br />
<br />
<br />
<br />
The [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July miRaPCR] generates binding sites out of rationally designed fragments. These are aligned with each other by chance, whereby different spacer regions are inserted randomly in between. It has been suggested that having more than one binding site of for the same miRNA behind each other can lead to stronger down-regulation than a single one. If imperfect binding sites are aligned, it is also supposed to be stronger than a single one. This is what we tested using MiRaPCR for effortless assembly of binding site fragments.<br />
For our experiments, we took advantage of the high abundance of miRNA 122 in liver cells and tested different combinations of binding sites created by miRaPCR. We transfected HeLa and HuH7 cells with the constructs described in table 2. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells in 2:1 ratio. The result shows the ratio between GFP and BFP normalized to the negative control (miMeasure constructs without binding sites). The miMeasure constructs were also compared to the expression of miMeasure containing one perfect binding site for miRNA 122.<br />
<br />
The transfected HeLa are also imaged with the epifluorescent microscope. Large amount of cells in the negative control (miMeasure with perfect binding site cotransfected with miR-155, see a)are green, whereas most cells with the miMeasure construct containing the perfect binding sites (see b) are blue. <br />
<br />
[[Image:BLUE+green.jpg|thumb|600px|center|'''epifluorescent microscopy image (10x) of Hela cells transfected with miMeasure''' miMeasure with a perfect binding site is a) cotransfected with miR-155, which has no specificity to miR-122, b) cotransfected with miR-122, which is complementary to the perfect binding site. EGFP is regulated by miR-122, EBFP2 is unregulated and serves as transfection control.]]<br />
<br />
<br />
The image analysis of confocal microscopy gives the following results:<br />
<br />
[[Image:MiMeasure_miR122.jpg|thumb|500px|center|''' different binding sites for miR122, HeLa cotransfected with miR122 expression plasmid''']]<br />
<br />
<br />
The EGFP-expression normalized to the EGFB2 expression is set to 100% for the miMeasure construct transfected with the non-matching miRNA (in this case miR-155). The knock-down efficiency of one perfect binding site is around 30%, which also accounts for the three aligned perfect binding sites and the two aligned imperfect ones. The binding site with bulges from position 9-12 and 9-22 don't show any knock-down. <br />
<br />
<br />
[[Image:MiMeasure_miR122b.jpg|thumb|500px|left|''' different binding sites for miR122, Huh7 cells''']]<br />
<br />
<br />
<br />
<br />
<!--Discussion This experiment shows, that the binding site pattern with 3 aligned perfect binding sites miM-1.3-7 gives the strongest knock-down. Whereby the binding site pattern with two imperfect binding sites 1-8 is weaker, but still stronger than the negative control. If one binding site is randomized from nucleotide 9-12 or 9-22 miM-r12, miM-r22, it loses its capability of protein down-regulation.--><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, right"|'''Table2: miRaPCR Designed Binding Sites and Their Features<br />
|binding site feature'''||Name/number<br />
|-<br />
|miMeasure with 3 aligned perfect binding sites||miM-1.3-7<br />
|-<br />
|miMeasure with two imperfect binding sites||miM-3.1-8<br />
|-<br />
|miMeasure with randomised nucleotides 9-12||miM-r12<br />
|-<br />
|miMeasure with randomised nucleotides 9-22||miM-r22<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The Huh7 cells were also transfected with the 4 different constructs. Here a cotransfection with miR-122 is not necessary, since Huh7 cells express miR-122 themselves. The knock-down of the perfect binding sites are stronger than the knock-down in the Hela cells. Here the knock-down efficiency is 80% for the perfect binding site and the aligned constructs. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
====Flow cytometry====<br />
<br />
<br />
The same constructs in Hela cells were analyzed by flow cytometry, too. Here the orange dots also represent the miMeasure construct transfected with the specific miRNA and the blue dots make up the negative control. The orange dots from the construct containing the perfect and the aligned binding sites have lower EGFP expression compared to EBFP2 expression, since the EGFP trend doesn't correspond to the EBFP2 trend, but shifts to the laft. The orange dots rise with the fluorescence intensity and collapses to zero, when the EBFP2 intensity is high. For the other constructs the EGFP range fully corresponds with the EBFP2 range. <br />
The linear plot shows the orange and blue dots in more distinct lines. The orange dots from the construct containing the perfect and aligned binding sites assemble along the y-axis, where the EGFP fluorescence intensity is zero. For the other construct the EGFP line fully overlap with the EBFP2. <br />
<br />
<br />
[[Image:Flow_miR122.jpg|thumb|620px|center|'''EGFP2/EBFP correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
[[Image:Flow_miR122_linear.jpg|thumb|620px|center|'''EGFP/EBFP2 correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of endogenous miRNA===<br />
<br />
HepG2, another liver cell line, is also transfected with the constructs containing the perfect and the aligned constructs for miR-122. The cotransfection with miR-155 serves again as a negative control. For this cell line there was only a slight knock-down observed for all of the constructs, it is much less compared to the HuH7 cell line, where the knock-down ranges from 20-40%. <br />
<br />
[[Image:HepG2_mir122_microscopy-1.jpg|thumb|620px|center|'''relative EGFP expression of transfected HepG2 cells according to confocal microscopy analysis''' different binding sites for miR122 are cotransfected with miR-122. The negative control doesn't contain any binding sites.]]<br />
<br />
<br />
<br />
The EGFP/EBFP2 ratio from each transfected HuH7 cell is calculated for 52 cells. The cells were transfected with the construct carriying the three aligned perfect binding sites against miR-122. The EGFP/EBFP2 ratio in each cell is different and ranges from 0.1 to 6.<br />
<br />
[[Image:single cellmiRNA expression-1.jpg|thumb|620px|center|'''relative EGFP expression of transfected HuH7 cells according to confocal microscopy analysis''' the construct with the three aligned perfect binding sites for miR122 are cotransfected with miR-122.]]<br />
<br />
[[Image:Single_cellmiRNA_expression_cells.jpg|thumb|620px|center|]]<br />
<br />
==Discussion==<br />
<br />
==Methods==<br />
<br />
The fluorescence of GFP and BFP can be compared using different methods, for example automated fluorescence plate reader systems, [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Flow_cytometry flow cytometry] or manual and automated fluorescence [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==References==<br />
<br />
Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry. 2007 May 22;46(20):5904-10.<br />
<br />
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009 Jan 23;136(2):215-33.<br />
<br />
Coulouarn C, Factor VM, Andersen JB, Durkin ME, Thorgeirsson SS. Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic propertiesmiR-122 repression is a marker of tumor progression in HCC. Oncogene. 2009 Oct 8;28(40):3526-36.<br />
<br />
Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 2010;79:351-79.<br />
<br />
Girard M, Jacquemin E, Munnich A, Lyonnet S, Henrion-Caude A. miR-122, a paradigm for the role of microRNAs in the liver. J Hepatol. 2008 Apr;48(4):648-56.<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miMeasureTeam:Heidelberg/Project/miMeasure2010-10-27T23:16:44Z<p>Laura Nadine: /* Abstract */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|pro_miMeasure}}<br />
__NOTOC__<br />
{{:Team:Heidelberg/Side_Top}}<br />
[[Image:MiMeasure.png|frameless|250px|miMeasure Plasmid]]<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
=miMeasure=<br />
<br />
<br />
<br />
== The '''miMeasure''' standard plasmid has been engineered to enable the easy input of synthetic microRNA binding sites behind one of two fluorescent proteins while the second is used for normalization. Expression of regulated reporter and control from a bidirectional CMV promter guarantee faithful and reproducible measurements in any kind of cell. The fluorescence readout can be used to quantify the regulatory efficiency of the binding site in knockdown percentage. Once the properties of a synthetic binding site are elucidated, they can be used to manipulate and accurately fine-tune gene expression in vitro and in vivo. ==<br />
<br />
==Introduction==<br />
Micro RNAs regulate mainly the translation of their target genes by preferably interacting with regions in the 3’ untranslated region (UTR) of their target mRNA. Base-pairing with the miRNA binding site (BS) causes formation of diverse miRNA-mRNA duplexes {{HDref|reviewed by Fabian et al., 2010}}. The BS consists of a seven nucleotide long seed region that is perfectly matched to the miRNA, and surrounding regions that matched partially. The seed region is defined as being the minimal required base-pairing that can regulate the mRNA. Apart from the seed region, binding can be unspecific, creating mismatches and bulges. The position and properties of the bulges seem to play a central role in miRNA binding and therefore knockdown efficiency {{HDref|reviewed by Bartel et al., 2009}}. Since we were going to use synthetic miRNA BS in our genetherapeutic approach, we had to find a way to study their effects in a standardized manner that would be comparable and reproducible. <br />
One goal of the iGEM Team Heidelberg 2010 was to test the effects of changes in BS sequences on expression control. Thereby miRNA BS should be characterized. To standardize our measurements of knockdown according to BS specificity, we had to come up with a new standard that is independent from the endogenous cell machinery. We decided to bring synthetic miRNAs into play, hence we engineered BS for them creating an artificial regulatory circuit<!--, simulating naturally occurring miRNAs and miRNA BS without having to worry about the effect of endogenous targets-->. Of course there are also differences that arise through the availability of the enzymes involved in the miRNA pathway that may differ slightly from cell to cell. Therefore, constructs containing changes in BS sequences has to be compared to construct containing no binding sites and containing perfect binding sites. Ideally, the miRNA would be stably expressed in the cell line, but a uniform co-transfection also leads to an even distribution of synthetic shRNA-like miRNAs (shRNA miRs). Additionally, miRNA levels can be adjusted by differing transfection ratios. <br />
The main purpose of our measurement standard, miMeasure, is to express two nearly identical but discernible proteins: one of them tagged with a BS, the other one unregulated (even though the possibility exists to clone in a reference binding site). The two reporters are expressed by a bidirectional CMV promoter to make sure their transcription rate is comparable. We used a destabilized version of GFP, dsEGFP and a dsEBFP2 that was derived from the same sequence ([https://2010.igem.org/Team:Heidelberg/Project/miMeasure#References Ai et al., 2007]). Thus, we could make sure that both proteins exhibit the same synthesis and degradation properties, making them directly comparable. Hereby, we can also neglect the difference between mRNA and protein knockdown and can take the fluorescence of the marker protein as a direct, linear output of mRNA down-regulation. We included a BBb standard site into our plasmid, which allows to clone BS behind the GFP. If co-transfected with the corresponding shRNA miR, GFP will be down-regulated, while BFP expression is maintained. The ratio of GFP to BFP expression can be used to conclude the knockdown efficiency of the BS. Having destabilized marker proteins with a turnover time of two hours enables us not only to avoid accumulation of marker proteins, which would make the knockdown harder to observe, but also to conduct time-lapse experiments. In the future, this could be for example a way to observe dynamic activity patterns of endogenous miRNAs.<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
<br />
<br />
===Analysis of Randomized Binding Sites Against Synthetic miRNA===<br />
<br />
====Confocal microscopy measurements====<br />
<br />
We used microscopy analysis to determine the EGFP expression in relation to EBFP2. EBFP2 serves as a normalization for transfection efficiency. Nine miMeasure constructs with different binding sites were designed. Those were cloned downstream of EGFP behind the miMeasure construct, whereas the EBFP2 expression stays unaffected. The GFP/BFP-ratio stand for the level of GFP-expression normalized to one copy per cell. We modified binding sites for the synthetic miRNA by introducing random basepairs surrounding the seed region as described above, thereby changing the knockdown efficiency. In figure 1 we plotted the knockdown percentage of our constructs. The miMeasure construct and negative control were [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection co-transfected] with either shRNA miRsAg expressed from a CMV promoter on pcDNA5 or an inert synthetic RNA as control in 1:4 ratio, respectively. <br />
<br />
[[Image:M12-M22_HeLa_daten.jpg|thumb|500px|center|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs M12-M22 including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Used Binding Sites and Their Features'''<br />
|sequence||binding site feature||Name<br />
|-<br />
|ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS<br />
|-<br />
|ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| 10-12 ACG<br />
|-<br />
|ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA<br />
|-<br />
|ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ACGG<br />
|-<br />
|ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ATGT<br />
|-<br />
|ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10 G<br />
|-<br />
|ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10 A<br />
|-<br />
|ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11 A<br />
|-<br />
|ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18 ATG<br />
|-<br />
|-||miMeasure without any binding site||NC (negative control)<br />
|-<br />
|}<br />
<br />
<br />
Comparing the GFP/BFP-ratio between the constructs, we can see a significant difference of GFP expression between the negative control and the construct containing the perfect binding site. Since the control is not downregulated due to lack of binding sites, we set it as 100% expression on this chart. It can be seen that the perfect binding sites causes the lowest GFP expression, approximately 50%, while other binding sites range in between 55% and 100% of expression. <br />
<br />
<!--discussion?The seed region is altered in M22. Since the seed region is considered the most important site for knock-down efficiency, its change diminishes the knock-down capability of the binding site completely. So the GFP expression in this case is as high as the negative control, where no binding site was inserted into the miMeasure plasmid. --><br />
<br />
<br />
<!--[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection Transfection] with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 4 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.<br />
<br />
Condition '''a''': cotransfection with stuffer (salmon sperm DNA) <br />
<br />
Condition '''b''': cotransfection with synthetic RNA miRsAg <br />
<br />
Condition '''c''': cotransfection with empty pcDNA5<br />
<br />
Condition '''d''': cotransfection with synthetic shRNA3<br />
<br />
A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d. The cells were used for measurements on day three.--><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
====Flow cytometry measurements====<br />
<br />
Hela cells transfected with the constructs (described above) are also taken for flow cytometry. Each measurement contains around 10000 cells. The cells are plotted on a logarithmic scale in relation to EGFP and EBFP2 intensity. Each dot intensity represents the count of fluorescent cells for each EGFP/EBFP2 intensity pair. The dots are colour coded, so that the orange dots represent cells cotransfected with different miMeasure constructs and the miRsAg and the blue one represent cells cotransfected with non-specific miRNA (miR-155), respectively. So the blue set of measurements represent the negative control. Before the real measurements, cells transfected with EGFP or EBFP2 alone were measured to establish the gain of the detectors and compensate for fluorescent bleedthrough, especially of EBFP2 into the EGFP channel . This ensured that EGFP and EBFP2 alone shows a perfectly horizontal and vertical distribution respectively (data not shown). For the miMeasure constructs, both population of dots make up a line on the logarithmic scale, which shows the correlation of EGFP and EBFP2 very well. If the two different coloured dots overlap, they become white. Thus both lines overlap almost completely in the negative control containing no binding site, whereas the orange line shifts to the left for the miMeasure construct with the perfect binding site. All the other constructs are like the negative control.<br />
As the difference is subtle on the logarithmic scale, we also observed the cell distribution on a linear scale. All coloured distributions appeared more scattered on the linear scale, but the shifting of the orange dots was more visible for the construct containing the perfect binding site. again all the other constructs have the same range of scattering as the negative control. <br />
<br />
[[Image:Flow1.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a logarithmic scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]^<br />
<br />
[[Image:Flow-linear-result.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a linear scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of miRaPCR Generated Binding Sites Against a Natural miRNA===<br />
<br />
<br />
<br />
The [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July miRaPCR] generates binding sites out of rationally designed fragments. These are aligned with each other by chance, whereby different spacer regions are inserted randomly in between. It has been suggested that having more than one binding site of for the same miRNA behind each other can lead to stronger down-regulation than a single one. If imperfect binding sites are aligned, it is also supposed to be stronger than a single one. This is what we tested using MiRaPCR for effortless assembly of binding site fragments.<br />
For our experiments, we took advantage of the high abundance of miRNA 122 in liver cells and tested different combinations of binding sites created by miRaPCR. We transfected HeLa and HuH7 cells with the constructs described in table 2. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells in 2:1 ratio. The result shows the ratio between GFP and BFP normalized to the negative control (miMeasure constructs without binding sites). The miMeasure constructs were also compared to the expression of miMeasure containing one perfect binding site for miRNA 122.<br />
<br />
The transfected HeLa are also imaged with the epifluorescent microscope. Large amount of cells in the negative control (miMeasure with perfect binding site cotransfected with miR-155, see a)are green, whereas most cells with the miMeasure construct containing the perfect binding sites (see b) are blue. <br />
<br />
[[Image:BLUE+green.jpg|thumb|600px|center|'''epifluorescent microscopy image (10x) of Hela cells transfected with miMeasure''' miMeasure with a perfect binding site is a) cotransfected with miR-155, which has no specificity to miR-122, b) cotransfected with miR-122, which is complementary to the perfect binding site. EGFP is regulated by miR-122, EBFP2 is unregulated and serves as transfection control.]]<br />
<br />
<br />
The image analysis of confocal microscopy gives the following results:<br />
<br />
[[Image:MiMeasure_miR122.jpg|thumb|500px|center|''' different binding sites for miR122, HeLa cotransfected with miR122 expression plasmid''']]<br />
<br />
<br />
The EGFP-expression normalized to the EGFB2 expression is set to 100% for the miMeasure construct transfected with the non-matching miRNA (in this case miR-155). The knock-down efficiency of one perfect binding site is around 30%, which also accounts for the three aligned perfect binding sites and the two aligned imperfect ones. The binding site with bulges from position 9-12 and 9-22 don't show any knock-down. <br />
<br />
<br />
[[Image:MiMeasure_miR122b.jpg|thumb|500px|left|''' different binding sites for miR122, Huh7 cells''']]<br />
<br />
<br />
<br />
<br />
<!--Discussion This experiment shows, that the binding site pattern with 3 aligned perfect binding sites miM-1.3-7 gives the strongest knock-down. Whereby the binding site pattern with two imperfect binding sites 1-8 is weaker, but still stronger than the negative control. If one binding site is randomized from nucleotide 9-12 or 9-22 miM-r12, miM-r22, it loses its capability of protein down-regulation.--><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, right"|'''Table2: miRaPCR Designed Binding Sites and Their Features<br />
|binding site feature'''||Name/number<br />
|-<br />
|miMeasure with 3 aligned perfect binding sites||miM-1.3-7<br />
|-<br />
|miMeasure with two imperfect binding sites||miM-3.1-8<br />
|-<br />
|miMeasure with randomised nucleotides 9-12||miM-r12<br />
|-<br />
|miMeasure with randomised nucleotides 9-22||miM-r22<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The Huh7 cells were also transfected with the 4 different constructs. Here a cotransfection with miR-122 is not necessary, since Huh7 cells express miR-122 themselves. The knock-down of the perfect binding sites are stronger than the knock-down in the Hela cells. Here the knock-down efficiency is 80% for the perfect binding site and the aligned constructs. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
====Flow cytometry====<br />
<br />
<br />
The same constructs in Hela cells were analyzed by flow cytometry, too. Here the orange dots also represent the miMeasure construct transfected with the specific miRNA and the blue dots make up the negative control. The orange dots from the construct containing the perfect and the aligned binding sites have lower EGFP expression compared to EBFP2 expression, since the EGFP trend doesn't correspond to the EBFP2 trend, but shifts to the laft. The orange dots rise with the fluorescence intensity and collapses to zero, when the EBFP2 intensity is high. For the other constructs the EGFP range fully corresponds with the EBFP2 range. <br />
The linear plot shows the orange and blue dots in more distinct lines. The orange dots from the construct containing the perfect and aligned binding sites assemble along the y-axis, where the EGFP fluorescence intensity is zero. For the other construct the EGFP line fully overlap with the EBFP2. <br />
<br />
<br />
[[Image:Flow_miR122.jpg|thumb|620px|center|'''EGFP2/EBFP correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
[[Image:Flow_miR122_linear.jpg|thumb|620px|center|'''EGFP/EBFP2 correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of endogenous miRNA===<br />
<br />
HepG2, another liver cell line, is also transfected with the constructs containing the perfect and the aligned constructs for miR-122. The cotransfection with miR-155 serves again as a negative control. For this cell line there was only a slight knock-down observed for all of the constructs, it is much less compared to the HuH7 cell line, where the knock-down ranges from 20-40%. <br />
<br />
[[Image:HepG2_mir122_microscopy-1.jpg|thumb|620px|center|'''relative EGFP expression of transfected HepG2 cells according to confocal microscopy analysis''' different binding sites for miR122 are cotransfected with miR-122. The negative control doesn't contain any binding sites.]]<br />
<br />
<br />
<br />
The EGFP/EBFP2 ratio from each transfected HuH7 cell is calculated for 52 cells. The cells were transfected with the construct carriying the three aligned perfect binding sites against miR-122. The EGFP/EBFP2 ratio in each cell is different and ranges from 0.1 to 6.<br />
<br />
[[Image:single cellmiRNA expression-1.jpg|thumb|620px|center|'''relative EGFP expression of transfected HuH7 cells according to confocal microscopy analysis''' the construct with the three aligned perfect binding sites for miR122 are cotransfected with miR-122.]]<br />
<br />
==Discussion==<br />
<br />
==Methods==<br />
<br />
The fluorescence of GFP and BFP can be compared using different methods, for example automated fluorescence plate reader systems, [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Flow_cytometry flow cytometry] or manual and automated fluorescence [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==References==<br />
<br />
Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry. 2007 May 22;46(20):5904-10.<br />
<br />
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009 Jan 23;136(2):215-33.<br />
<br />
Coulouarn C, Factor VM, Andersen JB, Durkin ME, Thorgeirsson SS. Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic propertiesmiR-122 repression is a marker of tumor progression in HCC. Oncogene. 2009 Oct 8;28(40):3526-36.<br />
<br />
Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 2010;79:351-79.<br />
<br />
Girard M, Jacquemin E, Munnich A, Lyonnet S, Henrion-Caude A. miR-122, a paradigm for the role of microRNAs in the liver. J Hepatol. 2008 Apr;48(4):648-56.<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T21:28:57Z<p>Laura Nadine: /* Off-Targeting Using Endogenous miRNA */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Single_Pagetop|project_miRNA_Kit}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with [https://2010.igem.org/Team:Heidelberg/Parts miBricks] <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and in silico simulation'''.<br />
<br />
=== miTuner Kit components ===<br />
The miTuner Kit consists of three basic components: <br /><br />
:a) A kit of standardized synthetic microRNAs, corresponding binding sites, promoters and luciferase expression constructs as well as measurement constructs assembled in the BB-2 standard. As the miTuner kit was enabled <br /><br />
:b) Protocols for engineering synthetic microRNAs, synthetic single microRNA binding sites as well as microRNA binding site patterns <br />
Please find further information about the kit components and engineering of the kit [[2010.igem.org/wiki/index.php?title=Team:Heidelberg/Project/miRNA_Kit|here]].<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
In our experiment, we transfected Huh7 (human hepatoma) cells that endogenously overexpress miR122 with the miTuner construct after cloning different variations of binding sites for miR122 behind firefly luciferase. Figure 5 shows the results of the dual luciferase assay. Perfect binding sites result in almost complete inhibition of expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Mutated Binding Sites Against miR122'''<br />
|Number||Sequence||Mutation||Description<br />
|-<br />
|102||G ACAAACACCATTGTCACACTCCA TCTAGA GC||none||perfect BS<br />
|-<br />
|134||G ACAAACACCAT_ACGG_ACACTCCAGAGACACAAACACCAT_GAAG_ACACTCCA GC ||none||2x perfect BS<br />
|-<br />
|140||G C*C*CCTG*A*TGGGG*G*CGACACTCCA TCTAGA GC ||point mutations outside seed||HCV5 BS<br />
|-<br />
|142||TCGA G *AC*T*AA*GGCTGCT*CCAT*CAacactcca TCTAGA GC||one mutation inside seed||Aldo<br />
|-<br />
|155||TCGA G ACAAACACCATTGTCA*G*A*T*TC*G*A TCTAGA GC ||3 mutations in seed||<br />
|-<br />
|201||G ACAAACACCAT_ACGA_ACACTCCA TCTAGA GC ||ACGA bulge||bulge region<br />
|-<br />
|203||TCGA G ACAAACACCAT_GCAG_ACACTCCA TCTAGA GC||GCAG bulge||bulge region<br />
|}<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (Jopling et al., 2005). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
[[Image:101010on system.jpg|thumb|center|500px|'''Figure 6: Activation of gene expression upon Tet Repressor knockdown by liver-specific miR122]]<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== <i>In Vitro</i> Regulation of a Therapeutic Gene, hAAT ===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, i. e. human alpha-1-antitrypsin (hAAT). Tight control of the genetic activity is fundamental, since deficiencies of hAAT can cause emphysema {{HDref|Lu et al., 2006}}. With our tuning kit we have a powerful mean at hand to mediate expression levels. In this approach, we tagged hAAT, that we used as our GOI, with binding sites (for miRsAg) that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand (data not shown). There is some evidence, that the principle works also with this therapeutic gene in HeLa cells (fig. 6). This is a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.<br />
[[Image:HAAT ELISA.png|thumb|center|400px|'''Figure 6: hAAT expression in relative units depending of binding site properties.''' SV40 driven hAAT was fused to binding sites for miRsAg that was expressed from a co-transfected plasmid in HeLa cells.]]<br />
It is obvious: different binding sites result in different knockdowns of gene expression. Some imperfect binding sites - e. g. single seed region - indicate even similar expression levels in accordance to the figures shown before. It can be stated, that the tuning idea seems to work for attempts varying in applied miRNAs, binding sites and reporter genes. <br />
The hAAT as a GOI is worth testing because it is mainly secreted in liver -our target tissue of choice. Efficient transduction can be accomplished by infection with [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based selected viruses]. Dealing with hAAt intertwines our two approaches of specific gene therapy, therefor being a relevant field for future research.<br />
<br />
===<i>In Vivo</i> Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
*Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23;116(2):281-97.<br><br />
*Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA-target recognition. PLoS Biol. 2005 Mar;3(3):e85.<br><br />
*Brown BD, Naldini L.: Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat Rev *Genet. 2009 Aug;10(8):578-8<br><br />
*Chekulaeva M, Filipowicz W.:Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr Opin Cell Biol. 2009 Jun;21(3):452-60.<br><br />
*Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
*Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br><br />
*Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P.: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005 Sep 2;309(5740):1577-81.<br><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T20:58:09Z<p>Laura Nadine: /* On-Targeting Using Endogenous miRNA */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Single_Pagetop|project_miRNA_Kit}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with [https://2010.igem.org/Team:Heidelberg/Parts miBricks] <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and in silico simulation'''.<br />
<br />
== miTuner Kit components ==<br />
The miTuner Kit consists of three basic components: <br /><br />
a)A kit of standardized synthetic microRNAs, corresponding binding sites, promoters and luciferase expression constructs as well as measurement constructs assembled in the BB-2 standard. As the miTuner kit was enabled <br /><br />
b)Protocols for engineering synthetic microRNAs, synthetic single microRNA binding sites as well as microRNA binding site patterns<br />
<br /> <br />
Please find further information about the kit componenets and engineering of the kit [[2010.igem.org/wiki/index.php?title=Team:Heidelberg/Project/miRNA_Kit|here]].<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
In our experiment, we transfected Huh7 (human hepatoma) cells that endogenously overexpress miR122 with the miTuner construct after cloning different variations of binding sites for miR122 behind firefly luciferase. Figure 5 shows the results of the dual luciferase assay. Perfect binding sites result in almost complete inhibition of expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (Jopling et al., 2005). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
[[Image:101010on system.jpg|thumb|center|500px|'''Figure 6: Activation of gene expression upon Tet Repressor knockdown by liver-specific miR122]]<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== <i>In Vitro</i> Regulation of a Therapeutic Gene, hAAT ===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, i. e. human alpha-1-antitrypsin (hAAT). Tight control of the genetic activity is fundamental, since deficiencies of hAAT can cause emphysema {{HDref|Lu et al., 2006}}. With our tuning kit we have a powerful mean at hand to mediate expression levels. In this approach, we tagged hAAT, that we used as our GOI, with binding sites (for miRsAg) that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand (data not shown). There is some evidence, that the principle works also with this therapeutic gene in HeLa cells (fig. 6). This is a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.<br />
[[Image:HAAT ELISA.png|thumb|center|400px|'''Figure 6: hAAT expression in relative units depending of binding site properties.''' SV40 driven hAAT was fused to binding sites for miRsAg that was expressed from a co-transfected plasmid in HeLa cells.]]<br />
It is obvious: different binding sites result in different knockdowns of gene expression. Some imperfect binding sites - e. g. single seed region - indicate even similar expression levels in accordance to the figures shown before. It can be stated, that the tuning idea seems to work for attempts varying in applied miRNAs, binding sites and reporter genes. <br />
The hAAT as a GOI is worth testing because it is mainly secreted in liver -our target tissue of choice. Efficient transduction can be accomplished by infection with [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based selected viruses]. Dealing with hAAt intertwines our two approaches of specific gene therapy, therefor being a relevant field for future research.<br />
<br />
===<i>In Vivo</i> Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
*Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23;116(2):281-97.<br><br />
*Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA-target recognition. PLoS Biol. 2005 Mar;3(3):e85.<br><br />
*Brown BD, Naldini L.: Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat Rev *Genet. 2009 Aug;10(8):578-8<br><br />
*Chekulaeva M, Filipowicz W.:Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr Opin Cell Biol. 2009 Jun;21(3):452-60.<br><br />
*Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
*Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br><br />
*Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P.: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005 Sep 2;309(5740):1577-81.<br><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T20:56:33Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Single_Pagetop|project_miRNA_Kit}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with [https://2010.igem.org/Team:Heidelberg/Parts miBricks] <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and in silico simulation'''.<br />
<br/><br />
==miTuner Kit components== <br /><br />
The miTuner Kit consists of three basic components: <br /><br />
a)A kit of standardized synthetic microRNAs, corresponding binding sites, promoters and luciferase expression constructs as well as measurement constructs assembled in the BB-2 standard. As the miTuner kit was enabled <br /><br />
b)Protocols for engineering synthetic microRNAs, synthetic single microRNA binding sites as well as microRNA binding site patterns<br />
<br /> <br />
Please find further information about the kit componenets and engineering of the kit [[2010.igem.org/wiki/index.php?title=Team:Heidelberg/Project/miRNA_Kit|here]].<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
In our experiment, we transfected Huh7 (human hepatoma) cells that endogenously overexpress miR122 with the miTuner construct after cloning different variations of binding sites for miR122 behind firefly luciferase. Figure 5 shows the results of the dual luciferase assay. Perfect binding sites result in almost complete inhibition of expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (Jopling et al., 2005). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
[[Image:https://2010.igem.org/Image:101010on_system.jpg|thumb|center|500px|'''Figure 6: Activation of gene expression upon Tet Repressor knockdown by liver-specific miR122]]<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== <i>In Vitro</i> Regulation of a Therapeutic Gene, hAAT ===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, i. e. human alpha-1-antitrypsin (hAAT). Tight control of the genetic activity is fundamental, since deficiencies of hAAT can cause emphysema {{HDref|Lu et al., 2006}}. With our tuning kit we have a powerful mean at hand to mediate expression levels. In this approach, we tagged hAAT, that we used as our GOI, with binding sites (for miRsAg) that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand (data not shown). There is some evidence, that the principle works also with this therapeutic gene in HeLa cells (fig. 6). This is a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.<br />
[[Image:HAAT ELISA.png|thumb|center|400px|'''Figure 6: hAAT expression in relative units depending of binding site properties.''' SV40 driven hAAT was fused to binding sites for miRsAg that was expressed from a co-transfected plasmid in HeLa cells.]]<br />
It is obvious: different binding sites result in different knockdowns of gene expression. Some imperfect binding sites - e. g. single seed region - indicate even similar expression levels in accordance to the figures shown before. It can be stated, that the tuning idea seems to work for attempts varying in applied miRNAs, binding sites and reporter genes. <br />
The hAAT as a GOI is worth testing because it is mainly secreted in liver -our target tissue of choice. Efficient transduction can be accomplished by infection with [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based selected viruses]. Dealing with hAAt intertwines our two approaches of specific gene therapy, therefor being a relevant field for future research.<br />
<br />
===<i>In Vivo</i> Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
*Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23;116(2):281-97.<br><br />
*Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA-target recognition. PLoS Biol. 2005 Mar;3(3):e85.<br><br />
*Brown BD, Naldini L.: Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat Rev *Genet. 2009 Aug;10(8):578-8<br><br />
*Chekulaeva M, Filipowicz W.:Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr Opin Cell Biol. 2009 Jun;21(3):452-60.<br><br />
*Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
*Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br><br />
*Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P.: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005 Sep 2;309(5740):1577-81.<br><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Team/miThanksTeam:Heidelberg/Team/miThanks2010-10-27T19:25:59Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|mithanks}}<br />
<br />
=Guys, everyone write something about the advisors, please=<br />
<br />
=Acknowledgements=<br />
<br />
First and foremost, we would like to thank '''Professor Dr. Roland Eils''' for bringing together such a diverse team of students and share not only his vision, but also his resources with us. It is far from usual to put this much trust (and money) into a student research group, and it cannot be overstated how much we appreciate it.<br />
<br />
Our greatest thanks go, without any doubt, to '''Dr. Dirk Grimm'''. His total devotion and dedication, his patience and his ability to take our project to levels that we couldn't even have dreamt of have helped to bring out the best in each of our experiments.<br />
<br />
Without '''Jens Keienburg''' none of us would have been part of iGEM or would have ever found our inner dancing abilities (that for some of us, they were hidden quite deeply). But he believed in us, even after the first disastrous dancing lessons, and made us into the first iGEM team that would also be able to win any cheerleading competition. To offset the effects of our dancing workout, he fed us with pizza whenever possible. <br />
Of course we are also thankful for all the support and the management of the lab.<br />
<br />
We would like thank all of our advisors, who have been a pleasure to work with (although we are not sure they can say the same thing about us), and have been extremely patient with our questions and problems. They were always there for us and even in desperate and laborious times, they stayed with us even if that meant seeing the sunrise from the BioQuant balcony. <br />
<br />
'''PhD Christina Raupp''', for helping with the planning and conducting of virus production and in vivo experiments.<br />
<br />
'''Clarissa Liesche''', who brought us the joy of ELISA, helped us with the measurements and supplied us with everything from enyzmes to energy drinks. It was also a lot of fun exploring and manipulating the wiki with her. <br />
<br />
'''Subgroup leader Joel Beaudouin''', who alwys listened and helped us measuring at the flow cytometer, SP2, SP5, epifluorescence...just every measurement.<br />
<br />
'''Kathleen Börner''', <br />
<br />
'''Marina Bechtle'''<br />
<br />
'''Paula Gonzalez''', who spent hours and hours on the microscope with us and helped us analyzing the fluorescence of thousands of cells.<br />
<br />
'''Marlies Muernseer''', UniKlinikum Mannheim, for supplying us with Mouse Primary Hepatocytes every Monday and her incredible help (a truly nice person :) )<br />
<br />
<br />
<br />
Without your help, sacrifice and dedication, we wouldn't be anywhere close to here. <br />
<br />
We would also like to thank '''Eike Kienle''' for his great help with the constructs, '''Nina Schuermann''' for the introduction for the luminometer and advice on the contructs, '''Stefan Mockenhaupt''' for his constructs and all groups of the BioQuant who helped us to collect billions of HEK cells in three days. <br />
<br />
Thanks to Nao, Tim and Stephan, from the '''iGEM 2009 team''', whose efforts pointed us in the right direction and give us a nice ground to built on.<br />
<br />
Very much appreciated are also the '''companies, foundations and the academic sponsors''', who believed in our project and sponsored our work. <br />
<br />
We have to be thankful to '''our families, our partners and our friends''', who had to put up with our strange work timetables and our non availability during the last four months. Thank you all for understanding what science and iGEM meant to us during all this time and helping us to push through the harder times on our way.<br />
<br />
The website design team would like to thank especially '''[http://de.selfhtml.org/ SELFHTML]''' (in German). We wouldn't have been able to create such a wiki, both from the view of graphics and coding, without using this great tutorial glossary. Furthermore, it helped us avoiding many annoying forum trolls who impede any effective search for appropriate problem solutions.<br />
<br />
Also we are thanking Stephen Krämer, for his kind help with the RFCs and part submission<br />
<br />
On a strict personal level, and without ever revealing why, we also have to thank: <br />
Nespresso, Ritter Sport (and chocolate in general), Schokakola, the people from Burkina Faso, the dead balloon syndrome, big waterfalls, self-controlled trains, random bacteria who decide to grow up where they shouldn't and contaminate our cell culture, Polish mint-flavoured Vodka, green comfy chairs, table football, explicit hip-hop songs, our mystery coffee buddy, mojitos, tigers, easy-to-strip lab coats, emotional breakdowns in the lab, all of the Harry Potter characters, terrific Mensa food, whoever once forgot to lock the door to the great 7th floor balcony, Bellini... <br />
<br />
<br />
==all of these made iGEM experience... unique and unforgettable. Thank you ==<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Team/GalleryTeam:Heidelberg/Team/Gallery2010-10-27T18:39:02Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|gallery}}<br />
<br />
<html><body><br />
<style type="text/css"><br />
#news {height: 550px;}<br />
#HDgal {position:relative; width:550px; }<br />
<br />
#HDgal a.p1:visited, #HDgal a.p2:visited, #HDgal a.p3:visited, #HDgal a.p4:visited, #HDgal a.p5:visited, #HDgal a.p6:visited, #HDgal a.p7:visited, #HDgal a.p8:visited, #HDgal a.p9:visited, #HDgal a.p10:visited, #HDgal a.p11:visited, #HDgal a.p12:visited, #HDgal a.p13:visited, #HDgal a.p14:visited, #HDgal a.p15:visited, #HDgal a.p16:visited, #HDgal a.p17:visited, #HDgal a.p18:visited, #HDgal a.p19:visited, #HDgal a.p20:visited, #HDgal a.p21:visited, #HDgal a.p22:visited, #HDgal a.p23:visited, #HDgal a.p24:visited, #HDgal a.p25:visited, #HDgal a.p26:visited, #HDgal a.p27:visited, #HDgal a.p28:visited, #HDgal a.p29:visited, #HDgal a.p30:visited, #HDgal a.p31:visited, #HDgal a.p32:visited, #HDgal a.p33:visited, #HDgal a.p34:visited, #HDgal a.p35:visited, #HDgal a.p36:visited, #HDgal a.p37:visited, #HDgal a.p38:visited, #HDgal a.p39:visited {position:absolute; display:block; width:50px; height:50px; background-color:#949e7c; color:#fff; text-decoration:none;}<br />
<br />
#HDgal a.p1:visited {top:0px; left:0px;}<br />
#HDgal a.p2:visited {top:0px; left:55px;}<br />
#HDgal a.p3:visited {top:0px; left:110px;}<br />
#HDgal a.p4:visited {top:0px; left:165px;}<br />
#HDgal a.p5:visited {top:55px; left:0px;}<br />
#HDgal a.p6:visited {top:55px; left:55px;}<br />
#HDgal a.p7:visited {top:55px; left:110px;}<br />
#HDgal a.p8:visited {top:55px; left:165px;}<br />
#HDgal a.p9:visited {top:110px; left:0px;}<br />
#HDgal a.p10:visited {top:110px; left:55px;}<br />
#HDgal a.p11:visited {top:110px; left:110px;}<br />
#HDgal a.p12:visited {top:110px; left:165px;}<br />
#HDgal a.p13:visited {top:165px; left:0px;}<br />
#HDgal a.p14:visited {top:165px; left:55px;}<br />
#HDgal a.p15:visited {top:165px; left:110px;}<br />
#HDgal a.p16:visited {top:165px; left:165px;}<br />
#HDgal a.p17:visited {top:220px; left:0px;}<br />
#HDgal a.p18:visited {top:220px; left:55px;}<br />
#HDgal a.p19:visited {top:220px; left:110px;}<br />
#HDgal a.p20:visited {top:220px; left:165px;}<br />
#HDgal a.p21:visited {top:275px; left:0px;}<br />
#HDgal a.p22:visited {top:275px; left:55px;}<br />
#HDgal a.p23:visited {top:275px; left:110px;}<br />
#HDgal a.p24:visited {top:275px; left:165px;}<br />
#HDgal a.p25:visited {top:330px; left:0px;}<br />
#HDgal a.p26:visited {top:330px; left:55px;}<br />
#HDgal a.p27:visited {top:330px; left:110px;}<br />
#HDgal a.p28:visited {top:330px; left:165px;}<br />
#HDgal a.p29:visited {top:385px; left:0px;}<br />
#HDgal a.p30:visited {top:385px; left:55px;}<br />
#HDgal a.p31:visited {top:385px; left:110px;}<br />
#HDgal a.p32:visited {top:385px; left:165px;}<br />
#HDgal a.p33:visited {top:440px; left:0px;}<br />
#HDgal a.p34:visited {top:440px; left:55px;}<br />
#HDgal a.p35:visited {top:440px; left:110px;}<br />
#HDgal a.p36:visited {top:440px; left:165px;}<br />
#HDgal a.p37:visited {top:495px; left:0px;}<br />
#HDgal a.p38:visited {top:495px; left:55px;}<br />
#HDgal a.p39:visited {top:495px; left:110px;}<br />
<br />
#HDgal a.p1, #HDgal a.p2, #HDgal a.p3, #HDgal a.p4, #HDgal a.p5, #HDgal a.p6, #HDgal a.p7, #HDgal a.p8, #HDgal a.p9, #HDgal a.p10, #HDgal a.p11, #HDgal a.p12, #HDgal a.p13, #HDgal a.p14, #HDgal a.p15, #HDgal a.p16, #HDgal a.p17, #HDgal a.p18, #HDgal a.p19, #HDgal a.p20, #HDgal a.p21, #HDgal a.p22, #HDgal a.p23, #HDgal a.p24, #HDgal a.p25, #HDgal a.p26, #HDgal a.p27, #HDgal a.p28, #HDgal a.p29, #HDgal a.p30, #HDgal a.p31, #HDgal a.p32, #HDgal a.p33, #HDgal a.p34, #HDgal a.p35, #HDgal a.p36, #HDgal a.p37, #HDgal a.p38, #HDgal a.p39 {position:absolute; display:block; width:50px; height:50px; background-color:#949e7c; color:#fff; text-decoration:none;}<br />
<br />
#HDgal a.p1 {top:0px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/3/3f/All_bart.JPG");}<br />
#HDgal a.p2 {top:0px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/6/6e/Baccis.JPG");}<br />
#HDgal a.p3 {top:0px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/2/2e/Before_dance.JPG");}<br />
#HDgal a.p4 {top:0px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/4/44/Bufa.JPG");}<br />
#HDgal a.p5 {top:55px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/e/e2/Cuties.JPG");}<br />
#HDgal a.p6 {top:55px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/1/16/Domi.JPG");}<br />
#HDgal a.p7 {top:55px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/d/d5/Autmn.jpg");}<br />
#HDgal a.p8 {top:55px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/c/c1/Dance.JPG");}<br />
#HDgal a.p9 {top:110px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/b/b8/Cool.JPG");}<br />
#HDgal a.p10 {top:110px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/1/16/Becci.jpg");}<br />
#HDgal a.p11 {top:110px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/b/b1/Cippool.jpg");}<br />
#HDgal a.p12 {top:110px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/4/45/Domi_%282%29.jpg");}<br />
#HDgal a.p13 {top:165px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/a/ab/Elena.JPG");}<br />
#HDgal a.p14 {top:165px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/e/ea/Fake.JPG");}<br />
#HDgal a.p15 {top:165px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/8/8c/Food.jpg");}<br />
#HDgal a.p16 {top:165px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/8/8f/Fridge.JPG");}<br />
#HDgal a.p17 {top:220px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/f/fb/Graph.JPG");}<br />
#HDgal a.p18 {top:220px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/0/05/Isharp.JPG");}<br />
#HDgal a.p19 {top:220px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/7/7e/Jude_phil.jpg");}<br />
#HDgal a.p20 {top:220px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/f/f2/Milaura.JPG");}<br />
#HDgal a.p21 {top:275px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/d/d8/Minus.JPG");}<br />
#HDgal a.p22 {top:275px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/0/0d/IGEL.jpg");}<br />
#HDgal a.p23 {top:275px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/2/29/Leamarcus.jpg");}<br />
#HDgal a.p24 {top:275px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/e/ed/Light.JPG");}<br />
#HDgal a.p25 {top:330px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/1/1c/Lotinglea_bart.JPG");}<br />
#HDgal a.p26 {top:330px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/c/ca/Ola.JPG");}<br />
#HDgal a.p27 {top:330px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/3/32/Phil1.JPG");}<br />
#HDgal a.p28 {top:330px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/3/3e/Phil2.JPG");}<br />
#HDgal a.p29 {top:385px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/f/f1/Rudi.JPG");}<br />
#HDgal a.p30 {top:385px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/c/c3/Pipet.jpg");}<br />
#HDgal a.p31 {top:385px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/d/d8/Rudilab.jpg");}<br />
#HDgal a.p32 {top:385px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/5/57/Ting_lea.jpg");}<br />
#HDgal a.p33 {top:440px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/e/e6/Satellite.JPG");}<br />
#HDgal a.p34 {top:440px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/0/06/Stefan.jpg");}<br />
#HDgal a.p35 {top:440px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/a/a2/Thom.JPG");}<br />
#HDgal a.p36 {top:440px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/a/a4/Train.JPG");}<br />
#HDgal a.p37 {top:495px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/1/10/Weimar.JPG");}<br />
#HDgal a.p38 {top:495px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/f/f2/Thomas.jpg");}<br />
#HDgal a.p39 {top:495px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/5/52/Wine.jpg");}<br />
<br />
<br />
#HDgal a.p1:hover, #HDgal a.p2:hover, #HDgal a.p3:hover, #HDgal a.p4:hover, #HDgal a.p5:hover, #HDgal a.p6:hover, #HDgal a.p7:hover, #HDgal a.p8:hover, #HDgal a.p9:hover, #HDgal a.p10:hover, #HDgal a.p11:hover, #HDgal a.p12:hover, #HDgal a.p13:hover, #HDgal a.p14:hover, #HDgal a.p15:hover, #HDgal a.p16:hover, #HDgal a.p17:hover, #HDgal a.p18:hover, #HDgal a.p19:hover, #HDgal a.p20:hover, #HDgal a.p21:hover, #HDgal a.p22:hover, #HDgal a.p23:hover, #HDgal a.p24:hover, #HDgal a.p25:hover, #HDgal a.p26:hover, #HDgal a.p27:hover, #HDgal a.p28:hover, #HDgal a.p29:hover, #HDgal a.p30:hover, #HDgal a.p31:hover, #HDgal a.p32:hover, #HDgal a.p33:hover, #HDgal a.p34:hover, #HDgal a.p35:hover, #HDgal a.p36:hover, #HDgal a.p37:hover, #HDgal a.p38:hover, #HDgal a.p39:hover {text-decoration:none; background-color:#d4d8bd; color:#000;}<br />
<br />
#HDgal a img {display:block; position:absolute; width:1px; height:1px; border:0px; top:0px; left:0px;}<br />
<br />
#HDgal a.p1:hover img {display:block; position:absolute; top:0px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p2:hover img {display:block; position:absolute; top:0px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p3:hover img {display:block; position:absolute; top:0px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p4:hover img {display:block; position:absolute; top:0px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p5:hover img {display:block; position:absolute; top:-55px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p6:hover img {display:block; position:absolute; top:-55px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p7:hover img {display:block; position:absolute; top:-55px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p8:hover img {display:block; position:absolute; top:-55px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p9:hover img {display:block; position:absolute; top:-110px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p10:hover img {display:block; position:absolute; top:-110px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p11:hover img {display:block; position:absolute; top:-110px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p12:hover img {display:block; position:absolute; top:-110px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p13:hover img {display:block; position:absolute; top:-165px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p14:hover img {display:block; position:absolute; top:-165px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p15:hover img {display:block; position:absolute; top:-165px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p16:hover img {display:block; position:absolute; top:-165px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p17:hover img {display:block; position:absolute; top:-220px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p18:hover img {display:block; position:absolute; top:-220px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p19:hover img {display:block; position:absolute; top:-220px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p20:hover img {display:block; position:absolute; top:-220px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p21:hover img {display:block; position:absolute; top:-275px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p22:hover img {display:block; position:absolute; top:-275px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p23:hover img {display:block; position:absolute; top:-275px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p24:hover img {display:block; position:absolute; top:-275px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p25:hover img {display:block; position:absolute; top:-330px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p26:hover img {display:block; position:absolute; top:-330px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p27:hover img {display:block; position:absolute; top:-330px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p28:hover img {display:block; position:absolute; top:-330px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p29:hover img {display:block; position:absolute; top:-385px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p30:hover img {display:block; position:absolute; top:-385px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p31:hover img {display:block; position:absolute; top:-385px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p32:hover img {display:block; position:absolute; top:-385px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p33:hover img {display:block; position:absolute; top:-440px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p34:hover img {display:block; position:absolute; top:-440px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p35:hover img {display:block; position:absolute; top:-440px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p36:hover img {display:block; position:absolute; top:-440px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p37:hover img {display:block; position:absolute; top:-495px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p38:hover img {display:block; position:absolute; top:-495px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p39:hover img {display:block; position:absolute; top:-495px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p40:hover img {display:block; position:absolute; top:-495px; left:-665px; width:450px; height: auto; border:0px;}<br />
<br />
#mainimage {position:absolute; top:0px; left: -500px; top:0px; width:340px; border:0px;}<br />
<br />
<br />
</style><br />
<br />
<br />
<h3>The Heidelberg Team Gallery</h3><br />
<br />
<div id="news"> <br />
</div> <!-- end news --> <br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
<html><br />
<div id="HDgal"><br />
<!-- das zuerst angezeigte Bild --><br />
<img id="mainimage" src="https://static.igem.org/mediawiki/2010/a/a4/Igemhd2010_2s.png" /><br />
<br />
<!-- alle anderen Bilder --><br />
<a class="p1" href="#nogo">&nbsp;1<img src="https://static.igem.org/mediawiki/2010/3/3f/All_bart.JPG"/></a><br />
<a class="p2" href="#nogo">&nbsp;2<img src="https://static.igem.org/mediawiki/2010/6/6e/Baccis.JPG"/></a><br />
<a class="p3" href="#nogo">&nbsp;3<img src="https://static.igem.org/mediawiki/2010/2/2e/Before_dance.JPG"/></a><br />
<a class="p4" href="#nogo">&nbsp;4<img src="https://static.igem.org/mediawiki/2010/4/44/Bufa.JPG"/></a><br />
<a class="p5" href="#nogo">&nbsp;5<img src="https://static.igem.org/mediawiki/2010/e/e2/Cuties.JPG"/></a><br />
<a class="p6" href="#nogo">&nbsp;6<img src="https://static.igem.org/mediawiki/2010/1/16/Domi.JPG"/></a><br />
<a class="p7" href="#nogo">&nbsp;7<img src="https://static.igem.org/mediawiki/2010/d/d5/Autmn.jpg"/></a><br />
<a class="p8" href="#nogo">&nbsp;8<img src="https://static.igem.org/mediawiki/2010/c/c1/Dance.JPG"/></a><br />
<a class="p9" href="#nogo">&nbsp;9<img src="https://static.igem.org/mediawiki/2010/b/b8/Cool.JPG"/></a><br />
<a class="p10" href="#nogo">&nbsp;10<img src="https://static.igem.org/mediawiki/2010/1/16/Becci.jpg"/></a><br />
<a class="p11" href="#nogo">&nbsp;11<img src="https://static.igem.org/mediawiki/2010/b/b1/Cippool.jpg"/></a><br />
<a class="p12" href="#nogo">&nbsp;12<img src="https://static.igem.org/mediawiki/2010/4/45/Domi_%282%29.jpg"/></a><br />
<a class="p13" href="#nogo">&nbsp;13<img src="https://static.igem.org/mediawiki/2010/a/ab/Elena.JPG"/></a><br />
<a class="p14" href="#nogo">&nbsp;14<img src="https://static.igem.org/mediawiki/2010/e/ea/Fake.JPG"/></a><br />
<a class="p15" href="#nogo">&nbsp;15<img src="https://static.igem.org/mediawiki/2010/8/8c/Food.jpg"/></a><br />
<a class="p16" href="#nogo">&nbsp;16<img src="https://static.igem.org/mediawiki/2010/8/8f/Fridge.JPG"/></a><br />
<a class="p17" href="#nogo">&nbsp;17<img src="https://static.igem.org/mediawiki/2010/f/fb/Graph.JPG"/></a><br />
<a class="p18" href="#nogo">&nbsp;18<img src="https://static.igem.org/mediawiki/2010/0/05/Isharp.JPG"/></a><br />
<a class="p19" href="#nogo">&nbsp;19<img src="https://static.igem.org/mediawiki/2010/7/7e/Jude_phil.jpg"/></a><br />
<a class="p20" href="#nogo">&nbsp;20<img src="https://static.igem.org/mediawiki/2010/f/f2/Milaura.JPG"/></a><br />
<a class="p21" href="#nogo">&nbsp;21<img src="https://static.igem.org/mediawiki/2010/d/d8/Minus.JPG"/></a><br />
<a class="p22" href="#nogo">&nbsp;22<img src="https://static.igem.org/mediawiki/2010/0/0d/IGEL.jpg"/></a><br />
<a class="p23" href="#nogo">&nbsp;23<img src="https://static.igem.org/mediawiki/2010/2/29/Leamarcus.jpg"/></a><br />
<a class="p24" href="#nogo">&nbsp;24<img src="https://static.igem.org/mediawiki/2010/e/ed/Light.JPG"/></a><br />
<a class="p25" href="#nogo">&nbsp;25<img src="https://static.igem.org/mediawiki/2010/1/1c/Lotinglea_bart.JPG"/></a><br />
<a class="p26" href="#nogo">&nbsp;26<img src="https://static.igem.org/mediawiki/2010/c/ca/Ola.JPG"/></a><br />
<a class="p27" href="#nogo">&nbsp;27<img src="https://static.igem.org/mediawiki/2010/3/32/Phil1.JPG"/></a><br />
<a class="p28" href="#nogo">&nbsp;28<img src="https://static.igem.org/mediawiki/2010/3/3e/Phil2.JPG"/></a><br />
<a class="p29" href="#nogo">&nbsp;29<img src="https://static.igem.org/mediawiki/2010/f/f1/Rudi.JPG"/></a><br />
<a class="p30" href="#nogo">&nbsp;30<img src="https://static.igem.org/mediawiki/2010/c/c3/Pipet.jpg"/></a><br />
<a class="p31" href="#nogo">&nbsp;31<img src="https://static.igem.org/mediawiki/2010/d/d8/Rudilab.jpg"/></a><br />
<a class="p32" href="#nogo">&nbsp;32<img src="https://static.igem.org/mediawiki/2010/e/e6/Satellite.JPG"/></a><br />
<a class="p33" href="#nogo">&nbsp;33<img src="https://static.igem.org/mediawiki/2010/5/57/Ting_lea.jpg"/></a><br />
<a class="p34" href="#nogo">&nbsp;34<img src="https://static.igem.org/mediawiki/2010/0/06/Stefan.jpg"/></a><br />
<a class="p35" href="#nogo">&nbsp;35<img src="https://static.igem.org/mediawiki/2010/a/a2/Thom.JPG"/></a><br />
<a class="p36" href="#nogo">&nbsp;36<img src="https://static.igem.org/mediawiki/2010/a/a4/Train.JPG"/></a><br />
<a class="p37" href="#nogo">&nbsp;37<img src="https://static.igem.org/mediawiki/2010/1/10/Weimar.JPG"/></a><br />
<a class="p38" href="#nogo">&nbsp;38<img src="https://static.igem.org/mediawiki/2010/f/f2/Thomas.jpg"/></a><br />
<a class="p39" href="#nogo">&nbsp;39<img src="https://static.igem.org/mediawiki/2010/5/52/Wine.jpg"/></a><br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Team/GalleryTeam:Heidelberg/Team/Gallery2010-10-27T18:37:24Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|gallery}}<br />
<br />
<html><body><br />
<style type="text/css"><br />
#news {height: 550px;}<br />
#HDgal {position:relative; width:550px; }<br />
<br />
#HDgal a.p1:visited, #HDgal a.p2:visited, #HDgal a.p3:visited, #HDgal a.p4:visited, #HDgal a.p5:visited, #HDgal a.p6:visited, #HDgal a.p7:visited, #HDgal a.p8:visited, #HDgal a.p9:visited, #HDgal a.p10:visited, #HDgal a.p11:visited, #HDgal a.p12:visited, #HDgal a.p13:visited, #HDgal a.p14:visited, #HDgal a.p15:visited, #HDgal a.p16:visited, #HDgal a.p17:visited, #HDgal a.p18:visited, #HDgal a.p19:visited, #HDgal a.p20:visited, #HDgal a.p21:visited, #HDgal a.p22:visited, #HDgal a.p23:visited, #HDgal a.p24:visited, #HDgal a.p25:visited, #HDgal a.p26:visited, #HDgal a.p27:visited, #HDgal a.p28:visited, #HDgal a.p29:visited, #HDgal a.p30:visited, #HDgal a.p31:visited, #HDgal a.p32:visited, #HDgal a.p33:visited, #HDgal a.p34:visited, #HDgal a.p35:visited, #HDgal a.p36:visited, #HDgal a.p37:visited, #HDgal a.p38:visited, #HDgal a.p39:visited {position:absolute; display:block; width:50px; height:50px; background-color:#949e7c; color:#fff; text-decoration:none;}<br />
<br />
#HDgal a.p1:visited {top:0px; left:0px;}<br />
#HDgal a.p2:visited {top:0px; left:55px;}<br />
#HDgal a.p3:visited {top:0px; left:110px;}<br />
#HDgal a.p4:visited {top:0px; left:165px;}<br />
#HDgal a.p5:visited {top:55px; left:0px;}<br />
#HDgal a.p6:visited {top:55px; left:55px;}<br />
#HDgal a.p7:visited {top:55px; left:110px;}<br />
#HDgal a.p8:visited {top:55px; left:165px;}<br />
#HDgal a.p9:visited {top:110px; left:0px;}<br />
#HDgal a.p10:visited {top:110px; left:55px;}<br />
#HDgal a.p11:visited {top:110px; left:110px;}<br />
#HDgal a.p12:visited {top:110px; left:165px;}<br />
#HDgal a.p13:visited {top:165px; left:0px;}<br />
#HDgal a.p14:visited {top:165px; left:55px;}<br />
#HDgal a.p15:visited {top:165px; left:110px;}<br />
#HDgal a.p16:visited {top:165px; left:165px;}<br />
#HDgal a.p17:visited {top:220px; left:0px;}<br />
#HDgal a.p18:visited {top:220px; left:55px;}<br />
#HDgal a.p19:visited {top:220px; left:110px;}<br />
#HDgal a.p20:visited {top:220px; left:165px;}<br />
#HDgal a.p21:visited {top:275px; left:0px;}<br />
#HDgal a.p22:visited {top:275px; left:55px;}<br />
#HDgal a.p23:visited {top:275px; left:110px;}<br />
#HDgal a.p24:visited {top:275px; left:165px;}<br />
#HDgal a.p25:visited {top:330px; left:0px;}<br />
#HDgal a.p26:visited {top:330px; left:55px;}<br />
#HDgal a.p27:visited {top:330px; left:110px;}<br />
#HDgal a.p28:visited {top:330px; left:165px;}<br />
#HDgal a.p29:visited {top:385px; left:0px;}<br />
#HDgal a.p30:visited {top:385px; left:55px;}<br />
#HDgal a.p31:visited {top:385px; left:110px;}<br />
#HDgal a.p32:visited {top:385px; left:165px;}<br />
#HDgal a.p33:visited {top:440px; left:0px;}<br />
#HDgal a.p34:visited {top:440px; left:55px;}<br />
#HDgal a.p35:visited {top:440px; left:110px;}<br />
#HDgal a.p36:visited {top:440px; left:165px;}<br />
#HDgal a.p37:visited {top:495px; left:0px;}<br />
#HDgal a.p38:visited {top:495px; left:55px;}<br />
#HDgal a.p39:visited {top:495px; left:110px;}<br />
<br />
#HDgal a.p1, #HDgal a.p2, #HDgal a.p3, #HDgal a.p4, #HDgal a.p5, #HDgal a.p6, #HDgal a.p7, #HDgal a.p8, #HDgal a.p9, #HDgal a.p10, #HDgal a.p11, #HDgal a.p12, #HDgal a.p13, #HDgal a.p14, #HDgal a.p15, #HDgal a.p16, #HDgal a.p17, #HDgal a.p18, #HDgal a.p19, #HDgal a.p20, #HDgal a.p21, #HDgal a.p22, #HDgal a.p23, #HDgal a.p24, #HDgal a.p25, #HDgal a.p26, #HDgal a.p27, #HDgal a.p28, #HDgal a.p29, #HDgal a.p30, #HDgal a.p31, #HDgal a.p32, #HDgal a.p33, #HDgal a.p34, #HDgal a.p35, #HDgal a.p36, #HDgal a.p37, #HDgal a.p38, #HDgal a.p39 {position:absolute; display:block; width:50px; height:50px; background-color:#949e7c; color:#fff; text-decoration:none;}<br />
<br />
#HDgal a.p1 {top:0px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/3/3f/All_bart.JPG");}<br />
#HDgal a.p2 {top:0px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/6/6e/Baccis.JPG");}<br />
#HDgal a.p3 {top:0px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/2/2e/Before_dance.JPG");}<br />
#HDgal a.p4 {top:0px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/4/44/Bufa.JPG");}<br />
#HDgal a.p5 {top:55px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/e/e2/Cuties.JPG");}<br />
#HDgal a.p6 {top:55px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/1/16/Domi.JPG");}<br />
#HDgal a.p7 {top:55px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/d/d5/Autmn.jpg");}<br />
#HDgal a.p8 {top:55px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/c/c1/Dance.JPG");}<br />
#HDgal a.p9 {top:110px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/b/b8/Cool.JPG");}<br />
#HDgal a.p10 {top:110px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/1/16/Becci.jpg");}<br />
#HDgal a.p11 {top:110px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/b/b1/Cippool.jpg");}<br />
#HDgal a.p12 {top:110px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/4/45/Domi_%282%29.jpg");}<br />
#HDgal a.p13 {top:165px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/a/ab/Elena.JPG");}<br />
#HDgal a.p14 {top:165px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/e/ea/Fake.JPG");}<br />
#HDgal a.p15 {top:165px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/8/8c/Food.jpg");}<br />
#HDgal a.p16 {top:165px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/8/8f/Fridge.JPG");}<br />
#HDgal a.p17 {top:220px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/f/fb/Graph.JPG");}<br />
#HDgal a.p18 {top:220px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/0/05/Isharp.JPG");}<br />
#HDgal a.p19 {top:220px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/7/7e/Jude_phil.jpg");}<br />
#HDgal a.p20 {top:220px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/f/f2/Milaura.JPG");}<br />
#HDgal a.p21 {top:275px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/d/d8/Minus.JPG");}<br />
#HDgal a.p22 {top:275px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/0/0d/IGEL.jpg");}<br />
#HDgal a.p23 {top:275px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/2/29/Leamarcus.jpg");}<br />
#HDgal a.p24 {top:275px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/e/ed/Light.JPG");}<br />
#HDgal a.p25 {top:330px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/1/1c/Lotinglea_bart.JPG");}<br />
#HDgal a.p26 {top:330px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/c/ca/Ola.JPG");}<br />
#HDgal a.p27 {top:330px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/3/32/Phil1.JPG");}<br />
#HDgal a.p28 {top:330px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/3/3e/Phil2.JPG");}<br />
#HDgal a.p29 {top:385px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/f/f1/Rudi.JPG");}<br />
#HDgal a.p30 {top:385px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/c/c3/Pipet.jpg");}<br />
#HDgal a.p31 {top:385px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/d/d8/Rudilab.jpg");}<br />
#HDgal a.p32 {top:385px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/5/57/Ting_lea.jpg");}<br />
#HDgal a.p33 {top:440px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/e/e6/Satellite.JPG");}<br />
#HDgal a.p34 {top:440px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/0/06/Stefan.jpg");}<br />
#HDgal a.p35 {top:440px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/a/a2/Thom.JPG");}<br />
#HDgal a.p36 {top:440px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/a/a4/Train.JPG");}<br />
#HDgal a.p37 {top:495px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/1/10/Weimar.JPG");}<br />
#HDgal a.p38 {top:495px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/f/f2/Thomas.jpg");}<br />
#HDgal a.p39 {top:495px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/5/52/Wine.jpg");}<br />
<br />
<br />
#HDgal a.p1:hover, #HDgal a.p2:hover, #HDgal a.p3:hover, #HDgal a.p4:hover, #HDgal a.p5:hover, #HDgal a.p6:hover, #HDgal a.p7:hover, #HDgal a.p8:hover, #HDgal a.p9:hover, #HDgal a.p10:hover, #HDgal a.p11:hover, #HDgal a.p12:hover, #HDgal a.p13:hover, #HDgal a.p14:hover, #HDgal a.p15:hover, #HDgal a.p16:hover, #HDgal a.p17:hover, #HDgal a.p18:hover, #HDgal a.p19:hover, #HDgal a.p20:hover, #HDgal a.p21:hover, #HDgal a.p22:hover, #HDgal a.p23:hover, #HDgal a.p24:hover, #HDgal a.p25:hover, #HDgal a.p26:hover, #HDgal a.p27:hover, #HDgal a.p28:hover, #HDgal a.p29:hover, #HDgal a.p30:hover, #HDgal a.p31:hover, #HDgal a.p32:hover, #HDgal a.p33:hover, #HDgal a.p34:hover, #HDgal a.p35:hover, #HDgal a.p36:hover, #HDgal a.p37:hover, #HDgal a.p38:hover, #HDgal a.p39:hover {text-decoration:none; background-color:#d4d8bd; color:#000;}<br />
<br />
#HDgal a img {display:block; position:absolute; width:1px; height:1px; border:0px; top:0px; left:0px;}<br />
<br />
#HDgal a.p1:hover img {display:block; position:absolute; top:0px; left:-550px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p2:hover img {display:block; position:absolute; top:0px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p3:hover img {display:block; position:absolute; top:0px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p4:hover img {display:block; position:absolute; top:0px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p5:hover img {display:block; position:absolute; top:-55px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p6:hover img {display:block; position:absolute; top:-55px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p7:hover img {display:block; position:absolute; top:-55px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p8:hover img {display:block; position:absolute; top:-55px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p9:hover img {display:block; position:absolute; top:-110px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p10:hover img {display:block; position:absolute; top:-110px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p11:hover img {display:block; position:absolute; top:-110px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p12:hover img {display:block; position:absolute; top:-110px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p13:hover img {display:block; position:absolute; top:-165px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p14:hover img {display:block; position:absolute; top:-165px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p15:hover img {display:block; position:absolute; top:-165px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p16:hover img {display:block; position:absolute; top:-165px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p17:hover img {display:block; position:absolute; top:-220px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p18:hover img {display:block; position:absolute; top:-220px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p19:hover img {display:block; position:absolute; top:-220px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p20:hover img {display:block; position:absolute; top:-220px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p21:hover img {display:block; position:absolute; top:-275px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p22:hover img {display:block; position:absolute; top:-275px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p23:hover img {display:block; position:absolute; top:-275px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p24:hover img {display:block; position:absolute; top:-275px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p25:hover img {display:block; position:absolute; top:-330px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p26:hover img {display:block; position:absolute; top:-330px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p27:hover img {display:block; position:absolute; top:-330px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p28:hover img {display:block; position:absolute; top:-330px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p29:hover img {display:block; position:absolute; top:-385px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p30:hover img {display:block; position:absolute; top:-385px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p31:hover img {display:block; position:absolute; top:-385px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p32:hover img {display:block; position:absolute; top:-385px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p33:hover img {display:block; position:absolute; top:-440px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p34:hover img {display:block; position:absolute; top:-440px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p35:hover img {display:block; position:absolute; top:-440px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p36:hover img {display:block; position:absolute; top:-440px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p37:hover img {display:block; position:absolute; top:-495px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p38:hover img {display:block; position:absolute; top:-495px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p39:hover img {display:block; position:absolute; top:-495px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p40:hover img {display:block; position:absolute; top:-495px; left:-665px; width:450px; height: auto; border:0px;}<br />
<br />
#mainimage {position:absolute; top:0px; left: -500px; top:0px; width:340px; border:0px;}<br />
<br />
<br />
</style><br />
<br />
<br />
<h3>The Heidelberg Team Gallery</h3><br />
<br />
<div id="news"> <br />
</div> <!-- end news --> <br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
<html><br />
<div id="HDgal"><br />
<!-- das zuerst angezeigte Bild --><br />
<img id="mainimage" src="https://static.igem.org/mediawiki/2010/a/a4/Igemhd2010_2s.png" /><br />
<br />
<!-- alle anderen Bilder --><br />
<a class="p1" href="#nogo">&nbsp;1<img src="https://static.igem.org/mediawiki/2010/3/3f/All_bart.JPG"/></a><br />
<a class="p2" href="#nogo">&nbsp;2<img src="https://static.igem.org/mediawiki/2010/6/6e/Baccis.JPG"/></a><br />
<a class="p3" href="#nogo">&nbsp;3<img src="https://static.igem.org/mediawiki/2010/2/2e/Before_dance.JPG"/></a><br />
<a class="p4" href="#nogo">&nbsp;4<img src="https://static.igem.org/mediawiki/2010/4/44/Bufa.JPG"/></a><br />
<a class="p5" href="#nogo">&nbsp;5<img src="https://static.igem.org/mediawiki/2010/e/e2/Cuties.JPG"/></a><br />
<a class="p6" href="#nogo">&nbsp;6<img src="https://static.igem.org/mediawiki/2010/1/16/Domi.JPG"/></a><br />
<a class="p7" href="#nogo">&nbsp;7<img src="https://static.igem.org/mediawiki/2010/d/d5/Autmn.jpg"/></a><br />
<a class="p8" href="#nogo">&nbsp;8<img src="https://static.igem.org/mediawiki/2010/c/c1/Dance.JPG"/></a><br />
<a class="p9" href="#nogo">&nbsp;9<img src="https://static.igem.org/mediawiki/2010/b/b8/Cool.JPG"/></a><br />
<a class="p10" href="#nogo">&nbsp;10<img src="https://static.igem.org/mediawiki/2010/1/16/Becci.jpg"/></a><br />
<a class="p11" href="#nogo">&nbsp;11<img src="https://static.igem.org/mediawiki/2010/b/b1/Cippool.jpg"/></a><br />
<a class="p12" href="#nogo">&nbsp;12<img src="https://static.igem.org/mediawiki/2010/4/45/Domi_%282%29.jpg"/></a><br />
<a class="p13" href="#nogo">&nbsp;13<img src="https://static.igem.org/mediawiki/2010/a/ab/Elena.JPG"/></a><br />
<a class="p14" href="#nogo">&nbsp;14<img src="https://static.igem.org/mediawiki/2010/e/ea/Fake.JPG"/></a><br />
<a class="p15" href="#nogo">&nbsp;15<img src="https://static.igem.org/mediawiki/2010/8/8c/Food.jpg"/></a><br />
<a class="p16" href="#nogo">&nbsp;16<img src="https://static.igem.org/mediawiki/2010/8/8f/Fridge.JPG"/></a><br />
<a class="p17" href="#nogo">&nbsp;17<img src="https://static.igem.org/mediawiki/2010/f/fb/Graph.JPG"/></a><br />
<a class="p18" href="#nogo">&nbsp;18<img src="https://static.igem.org/mediawiki/2010/0/05/Isharp.JPG"/></a><br />
<a class="p19" href="#nogo">&nbsp;19<img src="https://static.igem.org/mediawiki/2010/7/7e/Jude_phil.jpg"/></a><br />
<a class="p20" href="#nogo">&nbsp;20<img src="https://static.igem.org/mediawiki/2010/f/f2/Milaura.JPG"/></a><br />
<a class="p21" href="#nogo">&nbsp;21<img src="https://static.igem.org/mediawiki/2010/d/d8/Minus.JPG"/></a><br />
<a class="p22" href="#nogo">&nbsp;22<img src="https://static.igem.org/mediawiki/2010/0/0d/IGEL.jpg"/></a><br />
<a class="p23" href="#nogo">&nbsp;23<img src="https://static.igem.org/mediawiki/2010/2/29/Leamarcus.jpg"/></a><br />
<a class="p24" href="#nogo">&nbsp;24<img src="https://static.igem.org/mediawiki/2010/e/ed/Light.JPG"/></a><br />
<a class="p25" href="#nogo">&nbsp;25<img src="https://static.igem.org/mediawiki/2010/1/1c/Lotinglea_bart.JPG"/></a><br />
<a class="p26" href="#nogo">&nbsp;26<img src="https://static.igem.org/mediawiki/2010/c/ca/Ola.JPG"/></a><br />
<a class="p27" href="#nogo">&nbsp;27<img src="https://static.igem.org/mediawiki/2010/3/32/Phil1.JPG"/></a><br />
<a class="p28" href="#nogo">&nbsp;28<img src="https://static.igem.org/mediawiki/2010/3/3e/Phil2.JPG"/></a><br />
<a class="p29" href="#nogo">&nbsp;29<img src="https://static.igem.org/mediawiki/2010/f/f1/Rudi.JPG"/></a><br />
<a class="p30" href="#nogo">&nbsp;30<img src="https://static.igem.org/mediawiki/2010/c/c3/Pipet.jpg"/></a><br />
<a class="p31" href="#nogo">&nbsp;31<img src="https://static.igem.org/mediawiki/2010/d/d8/Rudilab.jpg"/></a><br />
<a class="p32" href="#nogo">&nbsp;32<img src="https://static.igem.org/mediawiki/2010/e/e6/Satellite.JPG"/></a><br />
<a class="p33" href="#nogo">&nbsp;33<img src="https://static.igem.org/mediawiki/2010/5/57/Ting_lea.jpg"/></a><br />
<a class="p34" href="#nogo">&nbsp;34<img src="https://static.igem.org/mediawiki/2010/0/06/Stefan.jpg"/></a><br />
<a class="p35" href="#nogo">&nbsp;35<img src="https://static.igem.org/mediawiki/2010/a/a2/Thom.JPG"/></a><br />
<a class="p36" href="#nogo">&nbsp;36<img src="https://static.igem.org/mediawiki/2010/a/a4/Train.JPG"/></a><br />
<a class="p37" href="#nogo">&nbsp;37<img src="https://static.igem.org/mediawiki/2010/1/10/Weimar.JPG"/></a><br />
<a class="p38" href="#nogo">&nbsp;38<img src="https://static.igem.org/mediawiki/2010/f/f2/Thomas.jpg"/></a><br />
<a class="p39" href="#nogo">&nbsp;39<img src="https://static.igem.org/mediawiki/2010/5/52/Wine.jpg"/></a><br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Team/GalleryTeam:Heidelberg/Team/Gallery2010-10-27T18:35:23Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|gallery}}<br />
<br />
<html><body><br />
<style type="text/css"><br />
#news {height: 550px;}<br />
#HDgal {position:relative; width:550px; }<br />
<br />
#HDgal a.p1:visited, #HDgal a.p2:visited, #HDgal a.p3:visited, #HDgal a.p4:visited, #HDgal a.p5:visited, #HDgal a.p6:visited, #HDgal a.p7:visited, #HDgal a.p8:visited, #HDgal a.p9:visited, #HDgal a.p10:visited, #HDgal a.p11:visited, #HDgal a.p12:visited, #HDgal a.p13:visited, #HDgal a.p14:visited, #HDgal a.p15:visited, #HDgal a.p16:visited, #HDgal a.p17:visited, #HDgal a.p18:visited, #HDgal a.p19:visited, #HDgal a.p20:visited, #HDgal a.p21:visited, #HDgal a.p22:visited, #HDgal a.p23:visited, #HDgal a.p24:visited, #HDgal a.p25:visited, #HDgal a.p26:visited, #HDgal a.p27:visited, #HDgal a.p28:visited, #HDgal a.p29:visited, #HDgal a.p30:visited, #HDgal a.p31:visited, #HDgal a.p32:visited, #HDgal a.p33:visited, #HDgal a.p34:visited, #HDgal a.p35:visited, #HDgal a.p36:visited, #HDgal a.p37:visited, #HDgal a.p38:visited, #HDgal a.p39:visited {position:absolute; display:block; width:50px; height:50px; background-color:#949e7c; color:#fff; text-decoration:none;}<br />
<br />
#HDgal a.p1:visited {top:0px; left:0px;}<br />
#HDgal a.p2:visited {top:0px; left:55px;}<br />
#HDgal a.p3:visited {top:0px; left:110px;}<br />
#HDgal a.p4:visited {top:0px; left:165px;}<br />
#HDgal a.p5:visited {top:55px; left:0px;}<br />
#HDgal a.p6:visited {top:55px; left:55px;}<br />
#HDgal a.p7:visited {top:55px; left:110px;}<br />
#HDgal a.p8:visited {top:55px; left:165px;}<br />
#HDgal a.p9:visited {top:110px; left:0px;}<br />
#HDgal a.p10:visited {top:110px; left:55px;}<br />
#HDgal a.p11:visited {top:110px; left:110px;}<br />
#HDgal a.p12:visited {top:110px; left:165px;}<br />
#HDgal a.p13:visited {top:165px; left:0px;}<br />
#HDgal a.p14:visited {top:165px; left:55px;}<br />
#HDgal a.p15:visited {top:165px; left:110px;}<br />
#HDgal a.p16:visited {top:165px; left:165px;}<br />
#HDgal a.p17:visited {top:220px; left:0px;}<br />
#HDgal a.p18:visited {top:220px; left:55px;}<br />
#HDgal a.p19:visited {top:220px; left:110px;}<br />
#HDgal a.p20:visited {top:220px; left:165px;}<br />
#HDgal a.p21:visited {top:275px; left:0px;}<br />
#HDgal a.p22:visited {top:275px; left:55px;}<br />
#HDgal a.p23:visited {top:275px; left:110px;}<br />
#HDgal a.p24:visited {top:275px; left:165px;}<br />
#HDgal a.p25:visited {top:330px; left:0px;}<br />
#HDgal a.p26:visited {top:330px; left:55px;}<br />
#HDgal a.p27:visited {top:330px; left:110px;}<br />
#HDgal a.p28:visited {top:330px; left:165px;}<br />
#HDgal a.p29:visited {top:385px; left:0px;}<br />
#HDgal a.p30:visited {top:385px; left:55px;}<br />
#HDgal a.p31:visited {top:385px; left:110px;}<br />
#HDgal a.p32:visited {top:385px; left:165px;}<br />
#HDgal a.p33:visited {top:440px; left:0px;}<br />
#HDgal a.p34:visited {top:440px; left:55px;}<br />
#HDgal a.p35:visited {top:440px; left:110px;}<br />
#HDgal a.p36:visited {top:440px; left:165px;}<br />
#HDgal a.p37:visited {top:495px; left:0px;}<br />
#HDgal a.p38:visited {top:495px; left:55px;}<br />
#HDgal a.p39:visited {top:495px; left:110px;}<br />
<br />
#HDgal a.p1, #HDgal a.p2, #HDgal a.p3, #HDgal a.p4, #HDgal a.p5, #HDgal a.p6, #HDgal a.p7, #HDgal a.p8, #HDgal a.p9, #HDgal a.p10, #HDgal a.p11, #HDgal a.p12, #HDgal a.p13, #HDgal a.p14, #HDgal a.p15, #HDgal a.p16, #HDgal a.p17, #HDgal a.p18, #HDgal a.p19, #HDgal a.p20, #HDgal a.p21, #HDgal a.p22, #HDgal a.p23, #HDgal a.p24, #HDgal a.p25, #HDgal a.p26, #HDgal a.p27, #HDgal a.p28, #HDgal a.p29, #HDgal a.p30, #HDgal a.p31, #HDgal a.p32, #HDgal a.p33, #HDgal a.p34, #HDgal a.p35, #HDgal a.p36, #HDgal a.p37, #HDgal a.p38, #HDgal a.p39 {position:absolute; display:block; width:50px; height:50px; background-color:#949e7c; color:#fff; text-decoration:none;}<br />
<br />
#HDgal a.p1 {top:0px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/3/3f/All_bart.JPG");}<br />
#HDgal a.p2 {top:0px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/6/6e/Baccis.JPG");}<br />
#HDgal a.p3 {top:0px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/2/2e/Before_dance.JPG");}<br />
#HDgal a.p4 {top:0px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/4/44/Bufa.JPG");}<br />
#HDgal a.p5 {top:55px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/e/e2/Cuties.JPG");}<br />
#HDgal a.p6 {top:55px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/1/16/Domi.JPG");}<br />
#HDgal a.p7 {top:55px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/d/d5/Autmn.jpg");}<br />
#HDgal a.p8 {top:55px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/c/c1/Dance.JPG");}<br />
#HDgal a.p9 {top:110px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/b/b8/Cool.JPG");}<br />
#HDgal a.p10 {top:110px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/1/16/Becci.jpg");}<br />
#HDgal a.p11 {top:110px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/b/b1/Cippool.jpg");}<br />
#HDgal a.p12 {top:110px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/4/45/Domi_%282%29.jpg");}<br />
#HDgal a.p13 {top:165px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/a/ab/Elena.JPG");}<br />
#HDgal a.p14 {top:165px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/e/ea/Fake.JPG");}<br />
#HDgal a.p15 {top:165px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/8/8c/Food.jpg");}<br />
#HDgal a.p16 {top:165px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/8/8f/Fridge.JPG");}<br />
#HDgal a.p17 {top:220px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/f/fb/Graph.JPG");}<br />
#HDgal a.p18 {top:220px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/0/05/Isharp.JPG");}<br />
#HDgal a.p19 {top:220px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/7/7e/Jude_phil.jpg");}<br />
#HDgal a.p20 {top:220px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/f/f2/Milaura.JPG");}<br />
#HDgal a.p21 {top:275px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/d/d8/Minus.JPG");}<br />
#HDgal a.p22 {top:275px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/0/0d/IGEL.jpg");}<br />
#HDgal a.p23 {top:275px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/2/29/Leamarcus.jpg");}<br />
#HDgal a.p24 {top:275px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/e/ed/Light.JPG");}<br />
#HDgal a.p25 {top:330px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/1/1c/Lotinglea_bart.JPG");}<br />
#HDgal a.p26 {top:330px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/c/ca/Ola.JPG");}<br />
#HDgal a.p27 {top:330px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/3/32/Phil1.JPG");}<br />
#HDgal a.p28 {top:330px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/3/3e/Phil2.JPG");}<br />
#HDgal a.p29 {top:385px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/f/f1/Rudi.JPG");}<br />
#HDgal a.p30 {top:385px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/c/c3/Pipet.jpg");}<br />
#HDgal a.p31 {top:385px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/d/d8/Rudilab.jpg");}<br />
#HDgal a.p32 {top:385px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/5/57/Ting_lea.jpg");}<br />
#HDgal a.p33 {top:440px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/e/e6/Satellite.JPG");}<br />
#HDgal a.p34 {top:440px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/0/06/Stefan.jpg");}<br />
#HDgal a.p35 {top:440px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/a/a2/Thom.JPG");}<br />
#HDgal a.p36 {top:440px; left:165px; background-image: url("https://static.igem.org/mediawiki/2010/a/a4/Train.JPG");}<br />
#HDgal a.p37 {top:495px; left:0px; background-image: url("https://static.igem.org/mediawiki/2010/1/10/Weimar.JPG");}<br />
#HDgal a.p38 {top:495px; left:55px; background-image: url("https://static.igem.org/mediawiki/2010/f/f2/Thomas.jpg");}<br />
#HDgal a.p39 {top:495px; left:110px; background-image: url("https://static.igem.org/mediawiki/2010/5/52/Wine.jpg");}<br />
<br />
<br />
#HDgal a.p1:hover, #HDgal a.p2:hover, #HDgal a.p3:hover, #HDgal a.p4:hover, #HDgal a.p5:hover, #HDgal a.p6:hover, #HDgal a.p7:hover, #HDgal a.p8:hover, #HDgal a.p9:hover, #HDgal a.p10:hover, #HDgal a.p11:hover, #HDgal a.p12:hover, #HDgal a.p13:hover, #HDgal a.p14:hover, #HDgal a.p15:hover, #HDgal a.p16:hover, #HDgal a.p17:hover, #HDgal a.p18:hover, #HDgal a.p19:hover, #HDgal a.p20:hover, #HDgal a.p21:hover, #HDgal a.p22:hover, #HDgal a.p23:hover, #HDgal a.p24:hover, #HDgal a.p25:hover, #HDgal a.p26:hover, #HDgal a.p27:hover, #HDgal a.p28:hover, #HDgal a.p29:hover, #HDgal a.p30:hover, #HDgal a.p31:hover, #HDgal a.p32:hover, #HDgal a.p33:hover, #HDgal a.p34:hover, #HDgal a.p35:hover, #HDgal a.p36:hover, #HDgal a.p37:hover, #HDgal a.p38:hover, #HDgal a.p39:hover {text-decoration:none; background-color:#d4d8bd; color:#000;}<br />
<br />
#HDgal a img {display:block; position:absolute; width:1px; height:1px; border:0px; top:0px; left:0px;}<br />
<br />
#HDgal a.p1:hover img {display:block; position:absolute; top:0px; left:-650px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p2:hover img {display:block; position:absolute; top:0px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p3:hover img {display:block; position:absolute; top:0px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p4:hover img {display:block; position:absolute; top:0px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p5:hover img {display:block; position:absolute; top:-55px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p6:hover img {display:block; position:absolute; top:-55px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p7:hover img {display:block; position:absolute; top:-55px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p8:hover img {display:block; position:absolute; top:-55px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p9:hover img {display:block; position:absolute; top:-110px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p10:hover img {display:block; position:absolute; top:-110px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p11:hover img {display:block; position:absolute; top:-110px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p12:hover img {display:block; position:absolute; top:-110px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p13:hover img {display:block; position:absolute; top:-165px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p14:hover img {display:block; position:absolute; top:-165px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p15:hover img {display:block; position:absolute; top:-165px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p16:hover img {display:block; position:absolute; top:-165px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p17:hover img {display:block; position:absolute; top:-220px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p18:hover img {display:block; position:absolute; top:-220px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p19:hover img {display:block; position:absolute; top:-220px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p20:hover img {display:block; position:absolute; top:-220px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p21:hover img {display:block; position:absolute; top:-275px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p22:hover img {display:block; position:absolute; top:-275px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p23:hover img {display:block; position:absolute; top:-275px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p24:hover img {display:block; position:absolute; top:-275px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p25:hover img {display:block; position:absolute; top:-330px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p26:hover img {display:block; position:absolute; top:-330px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p27:hover img {display:block; position:absolute; top:-330px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p28:hover img {display:block; position:absolute; top:-330px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p29:hover img {display:block; position:absolute; top:-385px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p30:hover img {display:block; position:absolute; top:-385px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p31:hover img {display:block; position:absolute; top:-385px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p32:hover img {display:block; position:absolute; top:-385px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p33:hover img {display:block; position:absolute; top:-440px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p34:hover img {display:block; position:absolute; top:-440px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p35:hover img {display:block; position:absolute; top:-440px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p36:hover img {display:block; position:absolute; top:-440px; left:-665px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p37:hover img {display:block; position:absolute; top:-495px; left:-500px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p38:hover img {display:block; position:absolute; top:-495px; left:-555px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p39:hover img {display:block; position:absolute; top:-495px; left:-610px; width:450px; height: auto; border:0px;}<br />
#HDgal a.p40:hover img {display:block; position:absolute; top:-495px; left:-665px; width:450px; height: auto; border:0px;}<br />
<br />
#mainimage {position:absolute; top:0px; left: -500px; top:0px; width:340px; border:0px;}<br />
<br />
<br />
</style><br />
<br />
<br />
<h3>The Heidelberg Team Gallery</h3><br />
<br />
<div id="news"> <br />
</div> <!-- end news --> <br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
<html><br />
<div id="HDgal"><br />
<!-- das zuerst angezeigte Bild --><br />
<img id="mainimage" src="https://static.igem.org/mediawiki/2010/a/a4/Igemhd2010_2s.png" /><br />
<br />
<!-- alle anderen Bilder --><br />
<a class="p1" href="#nogo">&nbsp;1<img src="https://static.igem.org/mediawiki/2010/3/3f/All_bart.JPG"/></a><br />
<a class="p2" href="#nogo">&nbsp;2<img src="https://static.igem.org/mediawiki/2010/6/6e/Baccis.JPG"/></a><br />
<a class="p3" href="#nogo">&nbsp;3<img src="https://static.igem.org/mediawiki/2010/2/2e/Before_dance.JPG"/></a><br />
<a class="p4" href="#nogo">&nbsp;4<img src="https://static.igem.org/mediawiki/2010/4/44/Bufa.JPG"/></a><br />
<a class="p5" href="#nogo">&nbsp;5<img src="https://static.igem.org/mediawiki/2010/e/e2/Cuties.JPG"/></a><br />
<a class="p6" href="#nogo">&nbsp;6<img src="https://static.igem.org/mediawiki/2010/1/16/Domi.JPG"/></a><br />
<a class="p7" href="#nogo">&nbsp;7<img src="https://static.igem.org/mediawiki/2010/d/d5/Autmn.jpg"/></a><br />
<a class="p8" href="#nogo">&nbsp;8<img src="https://static.igem.org/mediawiki/2010/c/c1/Dance.JPG"/></a><br />
<a class="p9" href="#nogo">&nbsp;9<img src="https://static.igem.org/mediawiki/2010/b/b8/Cool.JPG"/></a><br />
<a class="p10" href="#nogo">&nbsp;10<img src="https://static.igem.org/mediawiki/2010/1/16/Becci.jpg"/></a><br />
<a class="p11" href="#nogo">&nbsp;11<img src="https://static.igem.org/mediawiki/2010/b/b1/Cippool.jpg"/></a><br />
<a class="p12" href="#nogo">&nbsp;12<img src="https://static.igem.org/mediawiki/2010/4/45/Domi_%282%29.jpg"/></a><br />
<a class="p13" href="#nogo">&nbsp;13<img src="https://static.igem.org/mediawiki/2010/a/ab/Elena.JPG"/></a><br />
<a class="p14" href="#nogo">&nbsp;14<img src="https://static.igem.org/mediawiki/2010/e/ea/Fake.JPG"/></a><br />
<a class="p15" href="#nogo">&nbsp;15<img src="https://static.igem.org/mediawiki/2010/8/8c/Food.jpg"/></a><br />
<a class="p16" href="#nogo">&nbsp;16<img src="https://static.igem.org/mediawiki/2010/8/8f/Fridge.JPG"/></a><br />
<a class="p17" href="#nogo">&nbsp;17<img src="https://static.igem.org/mediawiki/2010/f/fb/Graph.JPG"/></a><br />
<a class="p18" href="#nogo">&nbsp;18<img src="https://static.igem.org/mediawiki/2010/0/05/Isharp.JPG"/></a><br />
<a class="p19" href="#nogo">&nbsp;19<img src="https://static.igem.org/mediawiki/2010/7/7e/Jude_phil.jpg"/></a><br />
<a class="p20" href="#nogo">&nbsp;20<img src="https://static.igem.org/mediawiki/2010/f/f2/Milaura.JPG"/></a><br />
<a class="p21" href="#nogo">&nbsp;21<img src="https://static.igem.org/mediawiki/2010/d/d8/Minus.JPG"/></a><br />
<a class="p22" href="#nogo">&nbsp;22<img src="https://static.igem.org/mediawiki/2010/0/0d/IGEL.jpg"/></a><br />
<a class="p23" href="#nogo">&nbsp;23<img src="https://static.igem.org/mediawiki/2010/2/29/Leamarcus.jpg"/></a><br />
<a class="p24" href="#nogo">&nbsp;24<img src="https://static.igem.org/mediawiki/2010/e/ed/Light.JPG"/></a><br />
<a class="p25" href="#nogo">&nbsp;25<img src="https://static.igem.org/mediawiki/2010/1/1c/Lotinglea_bart.JPG"/></a><br />
<a class="p26" href="#nogo">&nbsp;26<img src="https://static.igem.org/mediawiki/2010/c/ca/Ola.JPG"/></a><br />
<a class="p27" href="#nogo">&nbsp;27<img src="https://static.igem.org/mediawiki/2010/3/32/Phil1.JPG"/></a><br />
<a class="p28" href="#nogo">&nbsp;28<img src="https://static.igem.org/mediawiki/2010/3/3e/Phil2.JPG"/></a><br />
<a class="p29" href="#nogo">&nbsp;29<img src="https://static.igem.org/mediawiki/2010/f/f1/Rudi.JPG"/></a><br />
<a class="p30" href="#nogo">&nbsp;30<img src="https://static.igem.org/mediawiki/2010/c/c3/Pipet.jpg"/></a><br />
<a class="p31" href="#nogo">&nbsp;31<img src="https://static.igem.org/mediawiki/2010/d/d8/Rudilab.jpg"/></a><br />
<a class="p32" href="#nogo">&nbsp;32<img src="https://static.igem.org/mediawiki/2010/e/e6/Satellite.JPG"/></a><br />
<a class="p33" href="#nogo">&nbsp;33<img src="https://static.igem.org/mediawiki/2010/5/57/Ting_lea.jpg"/></a><br />
<a class="p34" href="#nogo">&nbsp;34<img src="https://static.igem.org/mediawiki/2010/0/06/Stefan.jpg"/></a><br />
<a class="p35" href="#nogo">&nbsp;35<img src="https://static.igem.org/mediawiki/2010/a/a2/Thom.JPG"/></a><br />
<a class="p36" href="#nogo">&nbsp;36<img src="https://static.igem.org/mediawiki/2010/a/a4/Train.JPG"/></a><br />
<a class="p37" href="#nogo">&nbsp;37<img src="https://static.igem.org/mediawiki/2010/1/10/Weimar.JPG"/></a><br />
<a class="p38" href="#nogo">&nbsp;38<img src="https://static.igem.org/mediawiki/2010/f/f2/Thomas.jpg"/></a><br />
<a class="p39" href="#nogo">&nbsp;39<img src="https://static.igem.org/mediawiki/2010/5/52/Wine.jpg"/></a><br />
<br />
</div><br />
</body><br />
</html><br />
<br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T18:31:49Z<p>Laura Nadine: /* References */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with [https://2010.igem.org/Team:Heidelberg/Parts miBricks] <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (Jopling et al., 2005). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
*Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23;116(2):281-97.<br><br />
*Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA-target recognition. PLoS Biol. 2005 Mar;3(3):e85.<br><br />
*Brown BD, Naldini L.: Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat Rev *Genet. 2009 Aug;10(8):578-8<br><br />
*Chekulaeva M, Filipowicz W.:Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr Opin Cell Biol. 2009 Jun;21(3):452-60.<br><br />
*Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
*Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br><br />
*Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P.: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005 Sep 2;309(5740):1577-81.<br><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T18:30:08Z<p>Laura Nadine: /* References */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (Jopling et al., 2005). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23;116(2):281-97.<br><br />
Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA-target recognition. PLoS Biol. 2005 Mar;3(3):e85.<br><br />
Brown BD, Naldini L.: Exploiting and antagonizing microRNA regulation for therapeutic and experimental applications. Nat Rev Genet. 2009 Aug;10(8):578-8<br><br />
Chekulaeva M, Filipowicz W.:Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr Opin Cell Biol. 2009 Jun;21(3):452-60.<br><br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br><br />
Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P.: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005 Sep 2;309(5740):1577-81.<br><br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T18:22:22Z<p>Laura Nadine: /* References */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (Jopling et al., 2005). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br><br />
Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P.: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005 Sep 2;309(5740):1577-81.<br><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T18:21:22Z<p>Laura Nadine: /* On-Targeting Using Endogenous miRNA */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (Jopling et al., 2005). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T18:00:26Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 2, Fig. 3). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 3 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 4: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure 4. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 5: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T17:57:50Z<p>Laura Nadine: /* Results */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 1 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyzed binding sites derived from miR122 in the dual luciferase vector PsiCheck2 as can be seen in figure3. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T17:55:39Z<p>Laura Nadine: /* Results */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 1 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyized binding sites derived from miR122 in the dual luciferase vector PsiCheck2. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next. Mutated Binding sites 123, 133, 134, 135 and 158 contain 4bp-bulges (non-paired regions) that don not seem to diminish knockdown efficiency much. 107 contains one binding site, while 134 and 135 contain two binding sites for the same miRNA and show a stronger knockdown than 107.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T17:33:03Z<p>Laura Nadine: /* Results */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''proof of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 1 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
We further analyized binding sites derived from miR122 in the dual luciferase vector PsiCheck2. Here we tested sixteen mutated binding sites in order to observe minute fine-tuning between one binding site and the next.<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T17:15:37Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 1 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
===Off-Targeting Using Endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting Using Endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== Working Modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== Simple Tuning Procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== Advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== Tuning Raw Data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T17:13:16Z<p>Laura Nadine: /* miTuner: Expression Fine-Tuning by Synthetic miRNAs */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 1 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the same assay using binding sites against shhAAT within the pBS U6 vector. The results are overall similar, with changes in or directly adjacent to the seed region having the highest impact on knockdown efficiency. The measurement uses the same binding sites as the one conducted in pBS U6, just having a H1 promoter instead of U6 promoter.<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
===Off-Targeting using endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting using endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Notebook/MaterialTeam:Heidelberg/Notebook/Material2010-10-27T17:06:02Z<p>Laura Nadine: /* Plasmids */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_material}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
__TOC__<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
==Materials==<br />
=== Kits ===<br />
<center><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''table 1''': Used kits.<br />
| Kits||Supplier||Catalog Number<br />
|-<br />
|HiSpeed® Plasmid Maxi Kit (25)||QIAGEN||12663<br />
|-<br />
|CompactPrep Plasmid Maxi Kit (25)||QIAGEN||12763<br />
|-<br />
|RNeasy® Mini Kit (25)||QIAGEN||74106<br />
|-<br />
|QIAquick® Miniprep Kit (250)||QIAGEN||27106<br />
|-<br />
|QIAquick® Gel Extraction Kit (250)||QIAGEN||28706<br />
|-<br />
|QIAquick® Nucleotid Removal Kit (250)||QIAGEN||28306<br />
|-<br />
|QIAquick® PCR Purification Kit (250)||QIAGEN||28106<br />
|-<br />
|GeneMorph® II EZC Clone Domain Mutagenesis Kit||Stratagene||200552-5<br />
|-<br />
|}<br />
</center><br />
<br />
=== Marker ===<br />
<center><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''table 2''': Used DNA ladders for gel electrophoresis.<br />
| Name||Supplier||Range<br />
|-<br />
|GeneRuler™ High Range DNA Ladder||Fermentas||10,171-48,502 bp<br />
|-<br />
|GeneRuler™ 1 kb Plus DNA Ladder||Fermentas||75-20,000 bp<br />
|-<br />
|}<br />
</center><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
=== Enzymes ===<br />
<center><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''table 3''': Used NEB restriction enzymes.<br />
| Name||Number/ID||NEB buffer1||NEB buffer2||NEB buffer3||NEB buffer4||BSA<br />
|-<br />
|AflII||27||50%||100%||25%||100%||x<br />
|-<br />
|AgeI||1||100%||50%||10%||75% <br />
|-<br />
|ApaI||-||25%||50%||0%||100%||x<br />
|-<br />
|AseI||not||75%||100%||not|| <br />
|-<br />
|AvrII||-||100%||100%||50%||100%||<br />
|-<br />
|BamHI||2||75%||100%||100%||100%||x<br />
|-<br />
|BamHI||-||75%||100%||100%||100%||x<br />
|-<br />
|BclI||-||50%||100%||100%||75%|| <br />
|-<br />
|BglI||-||50%||75%||100%||50%|| <br />
|-<br />
|BglII||13|| 10%|| 75%|| 100%|| 10%||<br />
|-<br />
|BsrGI||-|| 25%|| 100%|| 10%|| 100%||x<br />
|-<br />
|DpnI ||6|| 100%|| 100%|| 75%|| 100%|| <br />
|-<br />
|DpnI ||-|| 100%|| 100%|| 75%|| 100%|| <br />
|-<br />
|EcoRI ||-|| 100%|| 100%|| 100%|| 100%|| <br />
|-<br />
|EcoRV ||-|| 50%|| 75%|| 100%|| 50%|| x<br />
|-<br />
|FseI ||-|| 100%|| 75%|| 0%|| 100%|| <br />
|-<br />
|HindIII||-|| 10 50%|| 100%|| 10%|| 50%|| <br />
|-<br />
|HindIII||-||50%|| 100%|| 10%|| 50%|| <br />
|-<br />
|KpnI ||11|| 100%|| 75%|| 0%|| 50%|| x<br />
|-<br />
|MfeI-HF™||-|| 75%|| 50%|| 10%|| 100%|| <br />
|-<br />
|NarI ||26|| 100%|| 75%|| 75%|| 100%|| <br />
|-<br />
|NcoI ||12|| 100%|| 100%|| 100%|| 100%|| <br />
|-<br />
|NdeI ||-|| 75%|| 100%|| 75%|| 100%|| <br />
|-<br />
|NheI ||-|| 100%|| 100%|| 10%|| 100%|| x<br />
|-<br />
|NotI ||14|| 0%|| 50%|| 100%|| 25%|| <br />
|-<br />
|NsiI ||-|| 10%|| 75%|| 100%|| 25%|| <br />
|-<br />
|PciI ||-|| 50%|| 75%|| 100%|| 50%|| x<br />
|-<br />
|PstI ||15|| 75%|| 75%|| 100%|| 50%|| <br />
|-<br />
|SacI ||16|| 100%|| 50%|| 10%|| 100%|| <br />
|-<br />
|ScaI ||18|| not||not||100%||not||<br />
|-<br />
|SfcI ||19|| 75%|| 50%|| 10%|| 100%|| x<br />
|-<br />
|SfcI||-||75%|| 50%|| 10%|| 100%|| x<br />
|-<br />
|SpeI ||-|| 75%|| 100%|| 25%|| 100%|| x<br />
|-<br />
|SphI ||-|| 100%|| 100%|| 50%|| 100%|| <br />
|-<br />
|SspI ||-|| 50%|| 100%|| 50%|| 50%|| <br />
|-<br />
|XbaI ||23 ||0%|| 100%|| 75%|| 100%|| x<br />
|-<br />
|XbaI ||56|| 0%|| 100%|| 75%|| 100%|| x<br />
|-<br />
|XhoI||24|| 75%|| 100%|| 100%|| 100%|| x<br />
|-<br />
|XmaI||25|| 25%|| 50%|| 0%|| 100%|| x<br />
|-<br />
|}<br />
</center><br />
NEBuffers are color-coded (NEBuffer 1-yellow, NEBuffer 2-blue, <br />
NEBuffer 3-red, NEBuffer 4-green) and supplied as 10X<br />
<br />
=== Bacteria ===<br />
<center><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''table 4''': Used <i>E. coli</i> strains.<br />
| Name||Purpose||Reference<br />
|-<br />
|DH5α||Amplification of Plasmids||Invitrogen<br />
|-<br />
|SCS110||Amplification of unmethylated Plasmids||Stratagene<br />
|-<br />
|Top10||Amplification of Plasmids||Invitrogen<br />
|-<br />
|}<br />
</center><br />
=== Media and Antibiotics ===<br />
* '''LB''' (10 g tryptone, 5 g yeast extract, 10 g sodium chloride, ad 1 L ddH<sub>2</sub>O)<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''table 5''': Used antibiotics.<br />
! Antibiotic||Final Concentration|| Solvent<br />
|-<br />
|Ampicillin||100 µg/ml||ddH<sub>2</sub>O<br />
|-<br />
|Chloramphenicol||25 µg/ml||100% Ethanol<br />
|-<br />
|Kanamycin||50 µg/ml||ddH<sub>2</sub>O<br />
|-<br />
|}<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
=== Primers & Oligos ===<br />
<br />
Please find our Primers & Oligos on an [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer extra subpage].<br />
<br />
=== Instruments ===<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''table 6''': Used instruments.<br />
! Description || Name || Firm <br />
|-<br />
| Table Centrifuge || Microfuge'''®''' 18 Centrifuge || Beckman Coulter<sup>TM</sup><br />
|-<br />
| Table Centrifuge || MicrofugeR 22'''®''' Centrifuge || Beckman Coulter<sup>TM</sup><br />
|-<br />
| Centrifuge || Allegra X-12 || Beckman Coulter<sup>TM</sup><br />
|-<br />
| Shaker || VORTEXGENIER 2 || Scientific Industries, SI<sup>TM</sup><br />
|-<br />
| Heating plate (magnet stirrer) || MR Hei-Standard || Heidolph<br />
|-<br />
| Heatblock || QBD4 || Grant<br />
|-<br />
| Heatblock (shakeing function) || Thermomixer comfort || Eppendorf<br />
|-<br />
| PCR-machine || MyCycler<sup>TM</sup> thermo cycler || BioRad<br />
|-<br />
| UV-chamber || Transluminator || Vilber Lourmat<br />
|-<br />
| Scale (fine) || Pioneer<sup>TM</sup> PA114C || OHAUS<br />
|-<br />
| Scale || Pioneer<sup>TM</sup> PA4101C || OHAUS<br />
|-<br />
| Fridge || KTP 1750 Premium || Liebherr<br />
|-<br />
| Freezer || GP 1366 Premium || Liebherr<br />
|-<br />
| -86 Freezer || -86°C Ultralow Freezer || NUAIRE<sup>TM</sup><br />
|-<br />
| Hood || Tischabzug || Wesemann'''®''' Laboreinrichtung<br />
|-<br />
| Draw-off pump || Vacuhand control || Vacubrand<br />
|-<br />
| Incubator || HT Multitron Version 2 || INFORS<br />
|-<br />
| Incubator (cell culture) || HERAcell 150 || Thermo electron coorperation<br />
|-<br />
| Hood (cell culture) || HERAsafe || Thermo electron coorperation<br />
|-<br />
| Plate reader || Infinite M200 || TECAN<br />
|-<br />
| FACS || Cytomics FC 500 MPL || Beckman Coulter<sup>TM</sup><br />
|-<br />
| Microscope || CKX41 || Olympus<br />
|-<br />
| Computer || || Sun Microsystems<br />
|-<br />
| UV/Visivle Spectrometer || Ultrospec 3300 pro || Amersham Biosciences<br />
|-<br />
| Photometer || NanoDrop'''®''' ND-1000 Spectrophotometer || peQLab Biotechnologie GmbH<br />
|-<br />
| Photometer || NanoVue<sup>TM</sup> || General Electric<br />
|-<br />
| Ice Machine || MF22 || SCOTSMAN'''®'''<br />
|-<br />
| Gel electrophoresis chamber || Mupid'''®'''-One || Advance<br />
|-<br />
| Pipetting robot || QIAcube<sup>TM</sup> || QIAGEN<br />
|-<br />
| Wide field microscope || Nikon Eclipse 90i || Nikon<br />
|-<br />
| PCR machine || MyCycler thermal cycler || BIO-RAD<br />
|-<br />
| Real-time PCR machine || StepOnePlus<sup>TM</sup> Real-time PCR System || Applied Biosystems<sup>TM</sup><br />
|-<br />
|}<br />
<br />
===Cell lines===<br />
<br />
<center><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''table 7''': Used Cell Lines.<br />
| Cell line||Tissue of origin||Transfection<br />
|-<br />
| HeLa P4 || epithelial cervical cancer, human || easy || <br />
|-<br />
| HEK 293T || embryonic kidney cells, human || easy || <br />
|-<br />
| Flp-In™ T-REx™ 293 || embryonic kidney cells, human || easy || <br />
|-<br />
| Hep G2 || hepatocellular carcinoma, human || medium || <br />
|-<br />
| Hepa 1-6 || liver hepatoma, mouse || medium || <br />
|-<br />
|Huh7 || hepatocarcinoma, mouse || medium || <br />
|-<br />
| primary hepatocytes || liver, mouse|| hard || <br />
|}<br />
</center><br />
<br />
===Plasmids===<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''table 7''': Used Plasmids.<br />
| Name||Use|| Sequence Information||Reference<br />
|-<br />
|align="right"| pcDNA5 || expression of shRNAs ||CMV_shRNA_polyA || [http://tools.invitrogen.com/content/sfs/manuals/pcdna5frtto_man.pdf Invitrogen] || <br />
|-<br />
|align="right"| pcDNA6/TR || amplification of Tet Repressor || CMV_TetR_polyA || [http://tools.invitrogen.com/content/sfs/vectors/pcdna6tr_map.pdf Invitrogen] || <br />
|-<br />
|align="right"| PsiCheck2 || cloning of tuning construct || HSV_hRluc/SV40_hFluc || [http://www.promega.com/catalog/catalogproducts.aspx?categoryname=productleaf_1602 Promega] || <br />
|-<br />
|align="right"| pBSU6 || virus packaging (ssDNA) || ITR (AAV2) || Addgene || <br />
|-<br />
|align="right"| pTRUF3 || virus packaging (dsDNA) || ITR (AAV2) || || <br />
|-<br />
|align="right"| pBSH1 || virus packaging (ssDNA) || ITR (AAV2) || || <br />
|-<br />
|align="right"| pSB1A3 || 3A assembly cloning || Ampicillin Resistance || [http://partsregistry.org/Part:pSB1A3 Parts Registry] || <br />
|-<br />
|align="right"| pSB1K3 || 3A assembly cloning || Kanamycin Resistance || [http://partsregistry.org/Part:pSB1K3 Parts Registry] || <br />
|-<br />
|align="right"| pSB1C3 || 3A assembly cloning || Chloramphenicol Resistance || [http://partsregistry.org/Part:pSB1C3 Parts Registry] || <br />
|}<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T16:44:45Z<p>Laura Nadine: /* Results */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 1 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 2 shows the same assay using binding sites against shhAAT within the pBS U6 vector. <br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
===Off-Targeting using endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting using endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T16:38:48Z<p>Laura Nadine: /* miTuner: Expression Fine-Tuning by Synthetic miRNAs */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
Figure 1 shows the results of Dual-Luciferase measurements of the miTuner plasmid with binding sites against shhAAT behind firefly luciferase. The highest knockdown can be achieved by using a perfect binding site. Single mutations outside the seed region at position 11, 12 or 10-12 lead to knockdown between 10% and 60% compared to unregulated expression. Bulges close to the seed region or changes in the seed region itself lead to very low downregulation. Having only the seed region as a target for the miRNA also leads to a less efficient knockdown compared with binding sites containing flanking regions.<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
===Off-Targeting using endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting using endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T16:22:48Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<center><h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4></center><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression Fine-Tuning by Synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. Expression from a construct without binding sites is set as 100% (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). This reference shows that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
===Off-Targeting using endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting using endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T16:13:40Z<p>Laura Nadine: /* Discussion */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. 100% means ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
===Off-Targeting using endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting using endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Application of miTuner==<br />
<br />
=== In Vitro Regulation of a Therapeutic Gene, HAAT===<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (HAAT). In this approach, we tagged HAAT, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T16:11:42Z<p>Laura Nadine: /* On-Targeting using endogenous miRNA */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. 100% means ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
===Off-Targeting using endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting using endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T16:10:40Z<p>Laura Nadine: /* Discussion */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. 100% means ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
===Off-Targeting using endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting using endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (haat) (ref, description). In this approach, we tagged haat, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
===Modeling===<br />
<br />
After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T16:09:39Z<p>Laura Nadine: /* Off- and On-Targeting */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. 100% means ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
===Off-Targeting using endogenous miRNA===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for either Off- or On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
===On-Targeting using endogenous miRNA===<br />
<br />
In line with the Off-targeting approach, In the case of On-targeting the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (haat) (ref, description). In this approach, we tagged haat, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T16:06:08Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The data shows a precisely tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. 100% means ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
<br />
===Off- and On-Targeting===<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for Off- and On-Targeting. <br />
To enable Off-Targeting, the GOI expressed on miTuner can be tagged with a miRNA binding site specific for one or a combination of endogenous miRNA of the tissue that is to be excluded from gene expression.<br />
On targeting in this case would mean that the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
<br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
<!--After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (haat) (ref, description). In this approach, we tagged haat, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
===In Vivo Validation===<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
<br />
==Methods==<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br><br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
===On- and Off-Targeting===<br />
<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T15:41:12Z<p>Laura Nadine: /* Results */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
All gene regulatory constructs for tuning, Off- or On-targeting can easily be assembled using '''BBB standard cloning''' from our miRNA Kit [https://2010.igem.org/Team:Heidelberg/Parts parts]. After successful cloning, the constructs can be transfected onto a cell line of choice or transferred into a virus backbone for [https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection ''in vivo''] experiments. For our '''prove of principle''', we used firefly luciferase normalized to ''Renilla'' luciferase on miTuner to characterize knockdown efficiencies of different binding sites and show Off- and On-targeting by mouse infection carried by an AAV virus.<br />
<br />
===miTuner: Expression fine-tuning by synthetic miRNAs===<br />
<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interactions <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI which is driven by the very strong CMV promoter. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. hFluc and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. <br />
<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
The data preciously shows a tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. 100% means ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. <br />
<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
<br />
The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
<!--After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for On and Off-Targeting. On targeting in this case would mean that the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
(YOUC AN CHANGE THIS INTO PAST TENSE IF IT WORKED. AND ADD THE OFF SWITCHE; I AM NOT CERTAIN OF WHAT WE DID THERE, AND FIGURES!)<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (haat) (ref, description). In this approach, we tagged haat, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==Methods==<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br />
<br />
Since the miTuner was constructed initially for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] assay, this was the method of choice for tuning quantification.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T15:27:00Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our '''miRNA-based expression tuning kit miTuner'''. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|370px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interaction <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. Luc2 and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. The data preciously shows a tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. 100% means ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
<!--After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for On and Off-Targeting. On targeting in this case would mean that the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
(YOUC AN CHANGE THIS INTO PAST TENSE IF IT WORKED. AND ADD THE OFF SWITCHE; I AM NOT CERTAIN OF WHAT WE DID THERE, AND FIGURES!)<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (haat) (ref, description). In this approach, we tagged haat, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==Methods==<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br />
<br />
Since the miTuner was constructed initially for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] assay, this was the method of choice for tuning quantification.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadinehttp://2010.igem.org/Team:Heidelberg/Project/miRNA_KitTeam:Heidelberg/Project/miRNA Kit2010-10-27T15:23:58Z<p>Laura Nadine: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
<html><br />
<a name="top"></a><br />
<style type="text/css"><br />
.tocnumber {display:none;}<br />
#toc ul ul, .toc ul ul {<br />
margin:0 0 0 0em;<br />
}<br />
#toctitle {display:none;}<br />
</style><br />
</html><br />
{{:Team:Heidelberg/Pagetop|project_miRNA_Kit}}<br />
<div class="t1">Synthetic miRNA Kit</div><br />
<br />
<h4>miTuner - a kit for microRNA based gene expression tuning in mammalian cells</h4><br />
<br/><br />
<center><i>With the synthetic miRNA kit, we provide a comprehensive mean <br />
to plan, conduct and evaluate experiments dealing with miBricks <br />
(i. e. microRNA related Biobricks) as key regulators in mammalian cells.</i></center><br />
<br />
==Abstract==<br />
<br />
Regulation of any gene of interest has never been as easy as with our miRNA-base expression tuning kit, miTuner. Rational design of synthetic miRNA binding sites according to our recommendations enables fine-tuning of gene expression in a range between 5% and 100%. Additionally, we offer Off- and On-targeting switches which effect GOI expression in only one or all but one tissue depending on endogenously occurring miRNAs.<br />
[[Image:Mitunerabstract.png|thumb|360px|left|'''Figure 1''': Three modes of gene regulation accomplished by miTuner. '''a)'''fine-tuning of gene expression. '''b) and c)''' Off- and On-targeting for tissue specific expression of a therapeutic gene]]<br />
The '''tuning application''' is based on a dual promoter construct that expresses a GOI controlled by a synthetic miRNA which is expressed from the same construct ('''figure 1a'''). Differing miRNA-binding site interaction efficiencies caused by binding sites of different sequence properties are used to distinctly adjust expression strength of the GOI.<br />
<br />
For '''Off-targeting''', the GOI is under control of miRNAs that are found in tissue where gene expression is thereupon silenced while the GOI can still be expressed in other tissues as visualized in '''figure 1b'''.<br />
<br />
'''On-targeting''' is based on the expression of the GOI from a promoter containing a Tet Operon that negatively regulates gene expression in the presence of a Tet Repressor ('''figure 1c'''). If the Tet Repressor is under control of perfect binding sites for endogenous miRNAs , it will be downregulated in the target tissue, releasing the promoter and enabling specific GOI expression.<br />
<br />
<br />
==Introduction==<br />
MicroRNAs (miRNAs) are short endogenous, non-coding RNAs that mediate gene expression in a diversity of organisms {{HDref|Bartel, 2004}}. Although the understanding of their biological functions is progressing remarkably, the exact mechanisms of regulation are still not unambiguously defined. However, it is commonly believed that miRNAs '''trigger target mRNA regulation''' by binding to 3’ untranslated region (UTR) of its target {{HDref|Chekulaeva and Filipowicz, 2009}}. <!--The discovery of the first miRNA (lin-4) revealed sequence complementarity to multiple conserved sites in the 3’UTR of the lin-14 mRNA {{HDref|Lee et al., 1993; Wightman et al., 1993}}. --> Exact principles of expression knockdown mediated by miRNA are still in debate {{HDref|Eulalio et al., 2008}}.<br/>However, sequence depending '''binding site properties''' have an essential impact on miRNA-mRNA interaction. <!--[figure, short explanations on seed regions, flanking regions, spacers, mismatches and resulting bulges]. Some functionally important sections of miRNAs have been described in literature, such as the seed region {{HDref|Grimson et al., 2007; Bartel, 2009}}. It is defined as a miRNA region of seven nucleotides length that shows perfect pairing the mRNA target sequence. --><!--The seed usually consists of the nucleotides on position 2-8 of a miRNA binding sites in the 5'UTR of the mRNA. Based on this simple principle, we randomized our miRNA binding sites between nucleotide 9 - 12 or 9 - 22 in the so called flanking region. Alternatively, we tried rational exchanges of nucleotides to see how they effect binding of the miRNA to its target mRNA. --> Depending on pairing specificity translational repression is mediated through the imperfect miRNA-mRNA hybrids. The potential for stringent regulation of transgene expression makes the miRNA world a promising area of gene therapy {{HDref|Brown et al.,2009}}. There is a need for tight control of gene expression, since cellular processes are sensitive to expression profiles. Non-mediated gene expression can lead to fatal dysfunction of molecular networks. It is widely known, that miRNAs can adjust such fluctuations {{HDref|Brenecke et al., 2005}}. A combination of random and rational '''design''' of binding sites could become a '''powerful tool''' to achieve a narrow range of resulting gene expression knockdown. To ease <i>in silico</i> construction of miRNA binding sites with appropriate characteristics for its target, we wrote a program - the [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner miBS designer]. Using all of our [https://2010.igem.org/Team:Heidelberg/Modeling theoretical models] gives the user the opportunity to calculate knockdown percentages caused by the designed miRNA in the target cell.<!--The experimental applicability is still limited by redundant target sites and various miRNA expression patterns within the cells. This hampers distinct expression levels of the gene of interest (GOI) fused to the miRNA binding site.--> <br />
Our '''synthetic miRNA Kit''' guarantees at least for individually modifiable but still ready-to-use constructs to interfere genetic circuits with synthetic or endogenous miRNAs. We preciously show, that gene expression can thereby by adjusted - tuned - to an arbitrary level. The '''miTuner''' (see sidebar) allows on the simultaneous expression of a synthetic miRNA and a gene of interest that is fused with a designed binding site for this specific miRNA. Our modular kit comes with different parts that can be combined by choice, e. g. different mammalian promoters and characterized binding sites of specific properties. By choosing a certain binding site to tag the GOI, one can tune the expression of this gene. Depending on the GOI, different means for read out of gene expression come into play. At first, we applied [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay dual-luciferase assay], since we used Luciferase as a reporter for a proof-of-principle approach. Later on, semi-quantitative immunoblots were prepared for testing of therapeutic genes. However, all the received information fed our models, thereby creating an '''integrative feedback loop between experiments and simulation'''.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
Regulation of gene expression can be achieved by fusing miRNA binding sites right behind a GOI. In case a referring shRNA miR is expressed, the GOI is knocked down. Strength of regulation thereby depends on binding site properties. We are able to tune gene expression linearly over a broad range. This is a first proof of principle for various miRNA-mRNA interaction <i>in vitro</i>. Therefore, we transfected [https://2010.igem.org/Team:Heidelberg/Notebook/Material#Cell_lines HeLa cells] in principle with our [http://partsregistry.org/Part:BBa_K337036 pSMB_miTuner Plasmid HD3]. It turned out, that there was no obvious effect of different binding sites on reporter gene expression (data not shown). We assume that the RSV driving the shRNA miR is too weak for tight regulation of the referring binding site behind the GOI. Only if a sufficient amount of shRNA miR binds to its target, translation is significantly repressed. Thus, we expressed the shRNA miR from a separate plasmid which was always co-transfected with the original tuning construct. The reporter genes - i. e. Luc2 and hRluc - were also expressed from separate plasmids to get a reference as well as a transfection control. Then, we conducted a [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] for quantification of gene expression. The data preciously shows a tuned expression from almost 0% to 100% (Fig. 1, Fig. 2). Lowest expression refers to complete knockdown through fusion of perfect binding sites (always green bar on the left hand side of the figures) to the reporter gene. 100% means ordinary expression from a construct without binding sites (always orange column on the right hand side of the figures). In presence of the specific shRNA miR, gene expression was mediated to various levels through interactions with the different imperfect binding sites. Whereas, when an unspecific shRNA miR was expressed, gene expression remained unaffected (see raw data below). The latter aspect reveals, that the binding sites were correctly designed, since they seem to interact specifically with a referring shRNA miR. The constructs were tested in two different backbones: pBS_U6 and pBS_H1. Both are in viral context, meaning that they contain inverted terminal repeats (ITRs). The constructs can be packed into the capsid of an adeno-associated virus (AAV). Those constructs we also chose for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production] to infect cells even more efficiently as compared to transfections. Because of the significant data, we decided to inject the viruses into mice to see the tuning effect also <i>[https://2010.igem.org/Team:Heidelberg/Project/Mouse_Infection in vivo]</i>. The pBS_H1 construct should be preferred for mice injections since the expressed synthetic shRNA miR against human alpha-1-antitrypsine (shhAAT) is cytotoxic in higher concentrations. The pBS_H1 backbone leads to moderate expression ranges, still obviously showing the tuning effect.<br />
[[Image:Haat_H1HD2010.jpg|thumb|center|600px|'''Figure 1: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_H1.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
[[Image:Haat_U6HD2010.jpg|thumb|center|600px|'''Figure 2: Tuning of gene expression through different imperfect shRNA miR binding sites in pBS_U6.''' Gene expression quantified via dual luciferase assay for constructs containing different imperfect binding sites for shhAAT.]]<br />
Strikingly, the order of constructs in terms of knockdown for the imperfect binding sites is similar. M4, M5 and M6 always show strong knockdown, whereas M9, M10 and M11 show only loose down-regulation. Consulting the binding site sequences, the weak knockdown can be addressed to bulges in the supplementary region or to complete lack of the 3' region of the binding site. Still high strength could be maintained due to only single nucleotide exchanges in the central region of the binding site.<br />
The principle of smooth regulation was also demonstrated for miR122, a microRNA that is exclusively upregulated in hepatic cells. Referring binding sites were cloned into psiCHECK-2 backbone (Promega) and due to sequence mutations different Luciferase levels were detected again (Fig. 3).<br />
[[Image:PsiCheck.png|thumb|center|600px|'''Figure 3: Tuning of gene expression through different imperfect miR122 binding sites in psiCHECK-2.''' Construct was transfected into HeLa cells together with an plasmid expressing miR122. Control without binding site was used for normalization.]]<br />
Measurements were done in HeLa cells overexpressing miR122 from plasmid. Besides that, even endogenous miR122 levels were sufficient for off-targeting HuH cells (Fig. 4). A single perfect binding site leads to 95% knockdown, which seems to be maximum, since even a perfect binding site duplicate results in the same reporter gene expression. <br />
[[Image:HuH Offpng.png|thumb|center|500px|'''Figure 4: Knockdown of reporter gene expression due to endogenous miR122 that interferes with binding sites.''' Construct transfected to HuH cells to off-target those.]]<br />
<br />
<!--After creating a binding site library and testing the miRNA-binding site interaction <i>in vitro</i>, we were able to compute an [https://2010.igem.org/Team:Heidelberg/Modeling/miGUI <i>in silico</i> model] based on a machine learning approach to predict knockdown efficiencies. A more detailed description of the different binding sites, we characterized can be found in our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure measurements] page.<br />
<br />
Another application of our synthetic miRNA Kit profits of tissue specific endogenous miRNAs expression. These can be exploited for On and Off-Targeting. On targeting in this case would mean that the presence of a certain miRNA in a cell switches on expression of the GOI. This can be accomplished by using a repressor that is targeted by an endogenously expressed miRNA. We exemplified this scenario by using a Tet Repressor fused with a perfect binding site for miRNA 122, a liver-specific miRNA (REF!). At the same time, the promoter expressing the GOI would be under control of a Tet Operator. Upon presence of the miRNA 122, the Tet Repressor would be knocked down, release the promoter and expression of the GOI could be established. <br />
(YOUC AN CHANGE THIS INTO PAST TENSE IF IT WORKED. AND ADD THE OFF SWITCHE; I AM NOT CERTAIN OF WHAT WE DID THERE, AND FIGURES!)<br />
<br />
We further tested our kit using a gene that is an interesting candidate for gene therapy, human alpha-1-antitrypsin (haat) (ref, description). In this approach, we tagged haat, that we used as our GOI, with binding sites that we measured and characterized with our [https://2010.igem.org/Team:Heidelberg/Project/miMeasure miMeasure] construct beforehand. This was a first potential therapeutic approach applying [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#ELISA ELISA] for measurements.--><br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Discussion==<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==Methods==<br />
The miTuner was [https://2010.igem.org/3A_Assembly assembled] out of different [https://2010.igem.org/Team:Heidelberg/Parts parts]. Cloning was done following [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning standard protocols].<br />
<br />
Since the miTuner was constructed initially for [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Dual_Luciferase_Assay Dual Luciferase Assay] assay, this was the method of choice for tuning quantification.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
==References==<br />
<br />
Eulalio, A., Huntzinger, E., and Izaurralde, E. (2008). Getting to the root of miRNA-mediated gene silencing. Cell 132, 9-14.<br />
Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-297.<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__NOTOC__<br />
<br />
<br/><br />
<center><br />
[[Image:MiTuner p.png|250px| miTuner plasmid]]<br />
</center><br />
<br/><br />
<br/><br />
<br/><br />
=== working modes ===<br />
<br />
The synthetic miR Kit can be applied in three different ways:<br />
:I) '''Tuning''': adjusting the expression <br/>of the GOI by expressing a synthetic microRNA in the target cell/tissue<br />
<br/><br />
:II) '''Off-Targeting''': switching OFF the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
:III) '''On-Targeting''': switching ON the expression <br/>of the GOI in case a certain endogenous microRNA is present in the target cell/tissue<br />
<br/><br />
<br />
<br />
=== simple tuning procedure ===<br />
* choose an [[Team:Heidelberg/Project/Introduction | interesting microRNA]]<br />
* [https://2010.igem.org/Team:Heidelberg/Modeling/miBSdesigner create] referring binding sites<br />
* order your binding site oligos<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Cloning clone] them into your [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miTuner construct]<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection transfect] your cells<br />
* measure the [[Team:Heidelberg/Project/miRNA Kit#Results | tuned]] expression!<br />
<br />
<br /><br />
<br />
=== advancement ===<br />
* digestion of miR Kit construct with BamHI<br />
* cloning into viral backbone (e. g. [[Team:Heidelberg/Project/Materials/Plasmids | pBS_U6]])<br />
* [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Virus_Production virus production]<br />
* infection of cells<br />
* achievement of specific target cell [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling tropism]<br />
→ further improvement of gene expression tuning<br />
<br/><br />
<br/><br />
<br/><br />
=== tuning raw data ===<br />
For our <i>in vitro</i> tuning, you can have a look even at our unprocessed data with specific [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#nomenclature nomenclature]:<br />
* [[Media:Plate1 process H1.xls]], <br/><br />
* [[Media:Plate2 process H1.xls]], <br/><br />
* [[Media:Plate3 process H1.xls]], <br/><br />
* [[Media:Haat 20101022 M1-M4 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M5-M8 ctrl H1.xls]], <br/><br />
* [[Media:Haat 20101026 M9M22 ctrl H1.xls]], <br/><br />
* [[Media:HAAT H1 final.xls]]. <br/><br />
*[[Media:Plate1 process U6 haat.xls]],<br/><br />
*[[Media:Plate2 process U6 haat.xls]],<br/><br />
*[[Media:Plate3 process U6 haat.xls]],<br/><br />
*[[Media:Haat 20101026 plate2 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate1 U6.xls]],<br/><br />
*[[Media:Haat 20101026 plate3 U6.xls]],<br/><br />
*[[Media:HAAT U6 final.xls]].<br/><br />
{{:Team:Heidelberg/Bottom}}</div>Laura Nadine