http://2010.igem.org/wiki/index.php?title=Special:Contributions/Georgerosenberger&feed=atom&limit=50&target=Georgerosenberger&year=&month=2010.igem.org - User contributions [en]2024-03-28T20:42:33ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:ETHZ_Basel/InternalTeam:ETHZ Basel/Internal2010-12-25T11:22:31Z<p>Georgerosenberger: Removing all content from page</p>
<hr />
<div></div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Internal/TeaserAnimationsTeam:ETHZ Basel/Internal/TeaserAnimations2010-12-25T11:22:08Z<p>Georgerosenberger: Removing all content from page</p>
<hr />
<div></div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Introduction/MediaTeam:ETHZ Basel/Introduction/Media2010-12-12T17:19:42Z<p>Georgerosenberger: /* Media coverage */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Introduction}}<br />
<br />
= Media =<br />
<br />
<br />
== Media coverage ==<br />
In October, Biotechniques contacted us for an interview about our project E. lemming. They showed particular interest in our motivation to participate in the iGEM competition as well as in project development and team collaborations. <br />
<br />
Read more about our experiences during the iGEM 2010 period on:<br />
* [http://biotechniques.com/news/iGEM-competitors-gear-up-for-2010-challenge/biotechniques-304538.html BioTechniques - iGEM competitors gear up for 2010 challenge]<br />
* [http://www.ethlife.ethz.ch/archive_articles/101206_bakterien_roboter_fw/ ETH Life - Der kleinste lebende Roboter (German)]<br />
<br />
== Media resources ==<br />
<br />
We provide you here with a selection of our animations and real-time movies:<br />
<br />
*[http://www.youtube.com/watch?v=JQZZ7gT8Tjk E. lemming - The Movie on YouTube]<br />
*[http://www.youtube.com/watch?v=mulRvAVExSc&hd=1 E. lemming - (The Lemming) on YouTube]<br />
*[http://www.youtube.com/watch?v=1o4RzI-vwAw&hd=1 E. lemming - (The Lemming's Brother) on YouTube]<br />
<br />
= Contact =<br />
You can contact us by email at: [[Image:ETHZ_Basel_mail.png|157px|]] or using the following details:<br />
<br />
ETH Zürich<br />
Prof. Dr. Sven Panke<br />
Bioprocess Laboratory D-BSSE<br />
1058 7.40<br />
Mattenstrasse 26<br />
4058 Basel<br />
Phone: +41 61 387 32 09</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/InformationProcessing/ControllerTeam:ETHZ Basel/InformationProcessing/Controller2010-11-16T01:35:08Z<p>Georgerosenberger: /* Four Zones of Preference Controller */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_InformationProcessing}}<br />
<br />
= Controller =<br />
[[Image:D1.png|thumb|400px|Block representation of the controller.]]<br />
<br />
<html><div class="thumb tright"><div class="thumbinner" style="width:402px;"><br />
<iframe title="YouTube video player" class="youtube-player" type="text/html" width="400" height="325" src="http://www.youtube.com/embed/z76qikmUKlo?rel=0&hd=1" frameborder="0"></iframe><br />
<div class="thumbcaption"><div class="magnify"><a href="http://www.youtube.com/watch?v=z76qikmUKlo&hd=1" class="external" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div><b>Simulation of the movement of the E. lemming under the supervision of the controller</b>. <br><i>Yellow dot</i>: the currently selected E. lemming. <i>Yellow cone</i>: the current swimming direction of E. lemming. <i>Red arrow</i>: the reference direction set by the controller. <i>Bright red background</i>: far-red light (inducing tumbling). <i>Dark red environment</i>: red light (inducing directed movement). <i>Gray environment</i>: both red and far-red light absent. <br> Note the small rectangle in the upper right corner of the image, along whose edges the E. lemming is forced to swim. As observed by the end of the simulation, the controller algorithm efficiently guides the E. lemming on the desired route.</br></br> </div></div></div></html><br />
<br />
== Introduction ==<br />
In order to safely guide E. lemming towards any desired target, a controller algorithm had to be developed. The inputs were defined to be as the current direction followed by the E. lemming, the reference direction, set by the user and the time point of the simulation. The outputs were Boolean values for red and far-red light pulses, to be applied at every time point of the simulation. The controller function was executed with the same frequency as images are made in the microscope.<br />
<br />
The following properties of our network, consisting of both ''in silico'' and ''in vivo'' sub-parts, are making our task intractable for most theoretical controller design strategies:<br />
* The chemotaxis network is highly nonlinear;<br />
* Tumbling occurs stochastically;<br />
* The angular change during tumbling is not predictable, neither the direction nor its absolute value;<br />
* During directed movement periods, the angle is also changing stochastically (although not as much as during tumbling);<br />
* Microscope, cell detection and tracking, and the approximation of the current angle of the E. lemming sum up to a time delay of approximately one second.<br />
* The approximated angle is highly noisy.<br />
<br />
As far as we are aware of, no theoretical controller design algorithm exists that can tackle all these challenges. To nevertheless develop several implementations which afterward can be compared in terms of performance, we decided to start a controller design competition between the team members.<br />
<br />
In the following we first present the rules for the competition, which also include a measure for the performance of a controller, and afterward the different approaches developed by our team members together with their evaluation.<br />
<br />
== Controller Design Competition ==<br />
The goal of the competition was to develop an implementation of a controller which performs best in forcing the E. lemming in swimming to a desired direction. Our instructor J&ouml;rg Stelling agreed, more or less voluntarily, to donate a bottle of highly expensive wine as a prize for the winner of the competition.<br />
<br />
[[Image:controllerCompetition.png|thumb|400px|Sketch of the idea of the competition.]]For the competition every participant had to force his or her E. lemming model to swim clockwise around a 1083&times;825&mu;m large rectangle (approximately the size of 10 microscope images stringed together in each direction). Therefore, the reference direction send to the controller was set parallel to the axis of the coordinate system, and towards the next corner of the rectangle. Always when the Euclidean distance between the virtual E. lemming and the active corner was falling below 90&mu;m (approximately the size of one microscope image), the next corner was activated.<br />
The current direction of the E. lemming obtained from the model was delayed for 0.9s and white noise was added, in order to simulate the conditions mentioned above. The controller algorithm was called every 0.3s and could either activate or deactivate the red and the far-red light. All other details for the construction of the controllers were left open.<br />
<br />
For the evaluation of the controllers we defined the cost function &Gamma; as following:<br />
[[Image:CostFunction.png|left|300px]]<br clear="all" /><br />
with T the evaluation time, &phi;<sub>is</sub> the direction of the E. lemming, &phi;<sub>sh</sub> the reference direction. The value of the cost function is always &isin;[0,2] and can be interpreted as following: <br />
* If &Gamma;=0, the E. lemming would always swim exactly in the reference direction.<br />
* If &Gamma;=2, the E. lemming would always swim exactly opposite to the reference direction.<br />
* A controller which would set the red light and far-red light outputs independent of the current direction of the E. lemming will reach &Gamma;&asymp;1 for T&gt;&gt;1.<br />
<br />
The controllers of all participants of the competition were run until the cost function &Gamma; reached approximately a steady state. The participant with the lowest long-time value of his/her cost function obtained the prize from J&ouml;rg. The results are summarized in the following section.<br />
<br />
== Implemented Controllers ==<br />
In the following we will list all controllers we implemented ordered increasing by the long-time value of the cost function they achieved. All controllers are nevertheless available in the Lemming Toolbox.<br />
<br />
=== Threshold Optimized Controller (Winner of the Control Design Competition) ===<br />
'''Cost function value of &Gamma;=0.7703. Implemented by Simona Constantinescu.'''<br><br />
[[Image:SimonaWinner.png|thumb|400px|Sketch of the idea of the competition, '''after the competition''']]<br />
[[Image:ETH_igem_controller_threshold.png|thumb|400px|'''Sample path under the Threshold Optimized Controller'''. The black lines represent the reference rectangle around which the E. lemming was forced to travel. The blue thick curve represents the actual path of the E. lemming.]]<br />
In approaching the controller competition challenge and obtaining the bottle of highly expensive wine promised by J&ouml;rg, my strategy was the following:<br />
* develop a simple and efficient control algorithm, based on the intuitive idea of keeping the current direction if the difference between it and the reference direction is within well - chosen error bounds (''i.e.'' apply red light) and change the current direction otherwise (''i.e'' apply far-red light).<br />
* use the previously described simple algorithm as a reference and compare the implementation of the other, more complicated ideas, with this benchmark.<br />
<br />
The particular features of our system under study made it very difficult to theoretically address all the challenges of nonlinearity, delay and, most important, stochasticity. A basic probability principle says that the efficiency of any deterministic strategy in handling a random process increases with the sample size. Asymptotically, nice theories can be used to defend against randomness and even reduce it to single point estimates. On the contrary, when analyzing very small sample sizes, stochasticity plays a crucial role and, most often, complex deterministic strategies have little or no effect in controlling the random process. In our case, the sample size was always 1, as we had to decide, at every time point, what Boolean values red light and far red light should take. <br />
<br />
As a first test, The Threshold Optimized Controller is checking whether the actual direction of the E. lemming is between 0 and 2&pi;. Since Gaussian white noise is added to the received angle at every time point of the simulation, in some of the cases, the value of the angle might become negative or might exceed 2&pi;. If this happens, the controller sets the negative values back to 0 and the large ones back to 2&pi;, as a noise - suppressing measure. <br />
<br />
Next, two error bounds are defined, one for the case in which both angles are on the same side of the zero axis of the unit trigonometric circle (threshold1 = 1.5 rad) and another one for the case in which the angles are on different sides (threshold2 = 4.7 rad). This corresponds to an approximately &pi; acceptance region or to approximately 50% of the 2&pi; possible angles values on the unit circle. If the difference between the reference and the current direction, modulo 2&pi;, is within these error bounds, the current direction is kept. Otherwise, a new direction is sampled.<br />
<br />
The other algorithms I implemented were:<br />
* Storing the angle values and taking more complex decisions given the current and the previous directions. This strategy came at the cost of being inefficient before the sample size was large enough. Furthermore, the reference direction of the E. lemming was also changing, so the sample size had to be reset at 0, maybe too soon after reaching a large - enough size. Before testing the algorithm, it was debatable whether the benefit of reaching a large - enough size and acting in accordance to the defined strategy could exceed the cost of losing the objectivity of treating each sample independently. <br />
<br />
* Fighting the microscope/image processing delay, by keeping the angle fixed and changing it only once every 0.9 seconds. This strategy came at the cost of keeping the same angle (maybe wrong) for 0.9 seconds, which is equivalent to 3 pulses. Before testing, it was also unclear whether the benefit of obtaining the real angle, without delay, would exceed the cost of not changing the angle every time the chance was given.<br />
<br />
As the system was subject to strong stochasticity, the benefits of none of the above strategies exceeded their costs, as compared to the Threshold Optimized Controller. Therefore, among all my tries, the minimal objective function value was obtained for the Threshold Optimized Controller.<br />
<br clear="all" /><br />
<br />
=== Hysteresis based Sliding Mode Controller ===<br />
'''Cost function value of &Gamma;=0.7727. Implemented by Moritz Lang.'''<br />
<br />
[[Image:pathHysteresis.jpg|thumb|400px|Typical path of the simulated E. lemming around the rectangle when using the hysteresis based sliding mode controller. Black solid: Path the E. lemming took when surrounding the rectangle once. Blue dotted: The reference rectangle. Please remark that the controller is supposed to rapidly reach the corners of the rectangle and not to stay in the proximity of the edges.]]It is easy to calculate that the distance between the E. lemming and its destination decreases iff <code>|&phi;<sub>is</sub>-&phi;<sub>sh</sub>|mod 2&pi;<&pi;/2</code>. However, this decrease can be small for larger differences in this set and especially near the destination a direction of the E. lemming only narrowly fulfilling this condition will soon get invalid due to the movement of the E. lemming nearly tangential to the reference direction. Furthermore, due to the slight changes in direction during swimming and the measurement error when determining the direction of the E. lemming, it can happen that, when the angle between the reference direction and the actual direction is near to &pi;, the direction of the E. lemming "enters" and "leaves" this set very rapidly. A simple algorithm like "red light when the difference of the directions is smaller than &pi;, otherwise far-red light" could then lead to rapid switching between the diodes, an effect not desirable in an experimental setup.<br />
<br />
I thus decided to define two sets, <code>S<sub>on</sub>={&phi;<sub>is</sub>&isin;[0,2&pi;):|&phi;<sub>is</sub>-&phi;<sub>sh</sub>|mod 2&pi;<&pi;/2}</code> and <code>S<sub>off</sub>={&phi;<sub>is</sub>&isin;[0,2&pi;):|&phi;<sub>is</sub>-&phi;<sub>sh</sub>|mod 2&pi;<&pi;/3}</code>. Furthermore the controller has two states, <code>&zeta;<sub>on</sub></code> and <code>&zeta;<sub>off</sub></code>, and the state of the controller is maintained between evaluations of the controller algorithm. <br />
<br />
When the controller is in state <code>&zeta;<sub>off</sub></code>, it tests whether <code>&phi;<sub>is</sub></code> is in <code>S<sub>off</sub></code> or not. If the condition is fulfilled, a 2.4s (&asymp;4 evaluations) red light pulse is send and the state is set to <code>S<sub>on</sub></code>.<br />
<br />
When the controller is in state <code>&zeta;<sub>on</sub></code>, it tests whether <code>&phi;<sub>is</sub></code> is in <code>S<sub>on</sub></code> or not. If the condition is not fulfilled, a 2.1s (&asymp;3 evaluations) far-red light pulse is send and the state is set to <code>S<sub>off</sub></code>.<br />
<br />
Our evaluations showed that this controller forces the E. lemming successful around the rectangle (see Figure on the right), while minimizing both light pulses.<br />
<br clear="all" /><br />
<br />
=== Noise Refusing Subspace of Trust Controller ===<br />
'''Cost function value of &Gamma;=0.8089. Implemented by Christoph Hold.'''<br />
<br />
The controller is a graduated response to the derivation of angles <code>&phi;<sub>der</sub>=|&phi;<sub>set</sub> - &phi;<sub>is</sub>|</code> that takes advantage of an additional input signal. As there is two input binary signals this gives 4 possible input combinations:<br />
{| border="1" style="text-align:center"<br />
|-<br />
|colspan="2" | Input <br />
| Output<br />
|-<br />
| '''red light'''<br />
| '''far red light'''<br />
| '''bias'''<br />
|-<br />
| 0<br />
| 0<br />
| as before<br />
|-<br />
| 1<br />
| 0<br />
| high<br />
|-<br />
| 0<br />
| 1<br />
| low<br />
|-<br />
| 1<br />
| 1<br />
| medium<br />
|-<br />
|}<br />
<br />
<br />
Additionally it is coupled with a noise suppression.<br />
<br />
1. If the derivation of angle <code>&phi;<sub>der</sub>&lt; &alpha;<sub>narrow</sub></code> is small then by red light emission the bias is shifted as high as possible in order to keep the bacterium on the right track.<br />
<br />
2. If the derivation of angle <code>&phi;<sub>der</sub>&lt; &alpha;<sub>wide</sub></code> is acceptable, a compromise between going further that direction and tumbling is achieved by the usage of both red and far red light.<br />
<br />
3. If the derivation of angle <code>&phi;<sub>der</sub>&gt; &alpha;<sub>wide</sub></code> tumbling is initiated by far red light.<br />
<br />
The angles of rules 1 and 2 are so chosen that the mean change in angle through tumbling will result in the optimal direction. A further element of the controller tries to distinguish between angle derivation due to the noisy angle signal and real tumbles and applies the last decision of rules 1 and 2 in order to prevent a wrong way induced by error.<br />
<br />
=== Four Zones of Preference Controller ===<br />
[[Image:ETHZ_Basel_controller_fourzones.png|thumb|400px|'''Schematics of the four zones controller.''' Area 1 and 4 send a red or far-red light pulse of 1 time unit, whereas Area 2 is dark and Area 3 has a range from 3 to 1 time units.]]<br />
'''Cost function value of &Gamma;=0.8196. Implemented by George Rosenberger.'''<br />
<br />
A core problem of the very simple "red light when the difference of the directions is smaller than π, otherwise far-red light" algorithm is, that the edge between red and far-red light is very sharp. Therefore, the controller often changes between these two states and because of the time delay of the microscope and image processing, prediction of best light pulse tends to be inaccurate at this threshold.<br />
<br />
The core concept of this controller is to extend the very basic algorithm in a way, that the edge between red and far-red light is avoided, e.g. it should be leaped. This is achieved by creating a dark area of 2 * 15° between red and far-red thresholds, in which no light pulse is being sent at all. Next to the far-red light zone, the repeating times are increased in an order to possibly leap the dark area and go to a different angle, better (or worse) than the dark area.<br />
<br />
=== Majority Vote Proportional - Second Derivative Threshold Controller===<br />
'''Cost function value of &Gamma;=0.8379. Implemented by Thanuja Ambegoda.'''<br />
[[Image:ETHZ_controller_schema_mv.png|thumb|400px|'''Majority Vote and Derivative based Controller.''' On the left, the challenges posed by the controlled model are posed. On the right, the tools implemented by the algorithm to overcome these obstacles are shown. The arrows indicate which tool handles which obstacle]]<br />
<br />
What the controller needs to do boils down to the following:<br />
When the cell is going in the wrong direction, make it tumble until each heads towards the right direction. When it is heading towards the right direction, try to keep it in the swimming mode. <br />
But, the task is slightly complicated by the presence of the following 'obstacles':<br />
<br />
*Randomness of the motion – the direction changes slightly (randomly) when swimming and it changes rapidly with larger angles when tumbling.<br />
*Noise in measurement: the error we measure is not the exact error<br />
*Time delay of measurement – the measurement of error is not the current error. It's around 1 second before now.<br />
<br />
In the absence of the above three, the controller would have been trivial. This particular controller tries to minimize the effects of these by deploying an algorithm that incorporates the following features:<br />
<br />
*Majority voting based on historical error - This is a way of fighting noise. When deciding if error correction needs to be deployed (force tumbling), the controller not only looks at the current error. But also, it tries to deduce if there is a real error by looking at the reported error of a few previous samples. Majority voting is also used with differential error prediction (described later) at different levels of control inside the algorithm.<br />
*Rapid Checks - A slight variation to the above majority voting, used to detect larger errors, quickly. A slightly higher margin of error is allowed with a lower number of previous samples, when there is a need to detect a larger error quickly. A similar setting can be used with a lower threshold to detect quick returns to the correct direction<br />
*Error prediction based on differential control - This is used to minimize the effects of the time delay of measurements. Differential error is considered in conjunction with the reported error evaluated using the majority voting scheme.</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/InformationProcessing/ControllerTeam:ETHZ Basel/InformationProcessing/Controller2010-11-16T01:34:58Z<p>Georgerosenberger: /* Four Zones of Preference Controller */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_InformationProcessing}}<br />
<br />
= Controller =<br />
[[Image:D1.png|thumb|400px|Block representation of the controller.]]<br />
<br />
<html><div class="thumb tright"><div class="thumbinner" style="width:402px;"><br />
<iframe title="YouTube video player" class="youtube-player" type="text/html" width="400" height="325" src="http://www.youtube.com/embed/z76qikmUKlo?rel=0&hd=1" frameborder="0"></iframe><br />
<div class="thumbcaption"><div class="magnify"><a href="http://www.youtube.com/watch?v=z76qikmUKlo&hd=1" class="external" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div><b>Simulation of the movement of the E. lemming under the supervision of the controller</b>. <br><i>Yellow dot</i>: the currently selected E. lemming. <i>Yellow cone</i>: the current swimming direction of E. lemming. <i>Red arrow</i>: the reference direction set by the controller. <i>Bright red background</i>: far-red light (inducing tumbling). <i>Dark red environment</i>: red light (inducing directed movement). <i>Gray environment</i>: both red and far-red light absent. <br> Note the small rectangle in the upper right corner of the image, along whose edges the E. lemming is forced to swim. As observed by the end of the simulation, the controller algorithm efficiently guides the E. lemming on the desired route.</br></br> </div></div></div></html><br />
<br />
== Introduction ==<br />
In order to safely guide E. lemming towards any desired target, a controller algorithm had to be developed. The inputs were defined to be as the current direction followed by the E. lemming, the reference direction, set by the user and the time point of the simulation. The outputs were Boolean values for red and far-red light pulses, to be applied at every time point of the simulation. The controller function was executed with the same frequency as images are made in the microscope.<br />
<br />
The following properties of our network, consisting of both ''in silico'' and ''in vivo'' sub-parts, are making our task intractable for most theoretical controller design strategies:<br />
* The chemotaxis network is highly nonlinear;<br />
* Tumbling occurs stochastically;<br />
* The angular change during tumbling is not predictable, neither the direction nor its absolute value;<br />
* During directed movement periods, the angle is also changing stochastically (although not as much as during tumbling);<br />
* Microscope, cell detection and tracking, and the approximation of the current angle of the E. lemming sum up to a time delay of approximately one second.<br />
* The approximated angle is highly noisy.<br />
<br />
As far as we are aware of, no theoretical controller design algorithm exists that can tackle all these challenges. To nevertheless develop several implementations which afterward can be compared in terms of performance, we decided to start a controller design competition between the team members.<br />
<br />
In the following we first present the rules for the competition, which also include a measure for the performance of a controller, and afterward the different approaches developed by our team members together with their evaluation.<br />
<br />
== Controller Design Competition ==<br />
The goal of the competition was to develop an implementation of a controller which performs best in forcing the E. lemming in swimming to a desired direction. Our instructor J&ouml;rg Stelling agreed, more or less voluntarily, to donate a bottle of highly expensive wine as a prize for the winner of the competition.<br />
<br />
[[Image:controllerCompetition.png|thumb|400px|Sketch of the idea of the competition.]]For the competition every participant had to force his or her E. lemming model to swim clockwise around a 1083&times;825&mu;m large rectangle (approximately the size of 10 microscope images stringed together in each direction). Therefore, the reference direction send to the controller was set parallel to the axis of the coordinate system, and towards the next corner of the rectangle. Always when the Euclidean distance between the virtual E. lemming and the active corner was falling below 90&mu;m (approximately the size of one microscope image), the next corner was activated.<br />
The current direction of the E. lemming obtained from the model was delayed for 0.9s and white noise was added, in order to simulate the conditions mentioned above. The controller algorithm was called every 0.3s and could either activate or deactivate the red and the far-red light. All other details for the construction of the controllers were left open.<br />
<br />
For the evaluation of the controllers we defined the cost function &Gamma; as following:<br />
[[Image:CostFunction.png|left|300px]]<br clear="all" /><br />
with T the evaluation time, &phi;<sub>is</sub> the direction of the E. lemming, &phi;<sub>sh</sub> the reference direction. The value of the cost function is always &isin;[0,2] and can be interpreted as following: <br />
* If &Gamma;=0, the E. lemming would always swim exactly in the reference direction.<br />
* If &Gamma;=2, the E. lemming would always swim exactly opposite to the reference direction.<br />
* A controller which would set the red light and far-red light outputs independent of the current direction of the E. lemming will reach &Gamma;&asymp;1 for T&gt;&gt;1.<br />
<br />
The controllers of all participants of the competition were run until the cost function &Gamma; reached approximately a steady state. The participant with the lowest long-time value of his/her cost function obtained the prize from J&ouml;rg. The results are summarized in the following section.<br />
<br />
== Implemented Controllers ==<br />
In the following we will list all controllers we implemented ordered increasing by the long-time value of the cost function they achieved. All controllers are nevertheless available in the Lemming Toolbox.<br />
<br />
=== Threshold Optimized Controller (Winner of the Control Design Competition) ===<br />
'''Cost function value of &Gamma;=0.7703. Implemented by Simona Constantinescu.'''<br><br />
[[Image:SimonaWinner.png|thumb|400px|Sketch of the idea of the competition, '''after the competition''']]<br />
[[Image:ETH_igem_controller_threshold.png|thumb|400px|'''Sample path under the Threshold Optimized Controller'''. The black lines represent the reference rectangle around which the E. lemming was forced to travel. The blue thick curve represents the actual path of the E. lemming.]]<br />
In approaching the controller competition challenge and obtaining the bottle of highly expensive wine promised by J&ouml;rg, my strategy was the following:<br />
* develop a simple and efficient control algorithm, based on the intuitive idea of keeping the current direction if the difference between it and the reference direction is within well - chosen error bounds (''i.e.'' apply red light) and change the current direction otherwise (''i.e'' apply far-red light).<br />
* use the previously described simple algorithm as a reference and compare the implementation of the other, more complicated ideas, with this benchmark.<br />
<br />
The particular features of our system under study made it very difficult to theoretically address all the challenges of nonlinearity, delay and, most important, stochasticity. A basic probability principle says that the efficiency of any deterministic strategy in handling a random process increases with the sample size. Asymptotically, nice theories can be used to defend against randomness and even reduce it to single point estimates. On the contrary, when analyzing very small sample sizes, stochasticity plays a crucial role and, most often, complex deterministic strategies have little or no effect in controlling the random process. In our case, the sample size was always 1, as we had to decide, at every time point, what Boolean values red light and far red light should take. <br />
<br />
As a first test, The Threshold Optimized Controller is checking whether the actual direction of the E. lemming is between 0 and 2&pi;. Since Gaussian white noise is added to the received angle at every time point of the simulation, in some of the cases, the value of the angle might become negative or might exceed 2&pi;. If this happens, the controller sets the negative values back to 0 and the large ones back to 2&pi;, as a noise - suppressing measure. <br />
<br />
Next, two error bounds are defined, one for the case in which both angles are on the same side of the zero axis of the unit trigonometric circle (threshold1 = 1.5 rad) and another one for the case in which the angles are on different sides (threshold2 = 4.7 rad). This corresponds to an approximately &pi; acceptance region or to approximately 50% of the 2&pi; possible angles values on the unit circle. If the difference between the reference and the current direction, modulo 2&pi;, is within these error bounds, the current direction is kept. Otherwise, a new direction is sampled.<br />
<br />
The other algorithms I implemented were:<br />
* Storing the angle values and taking more complex decisions given the current and the previous directions. This strategy came at the cost of being inefficient before the sample size was large enough. Furthermore, the reference direction of the E. lemming was also changing, so the sample size had to be reset at 0, maybe too soon after reaching a large - enough size. Before testing the algorithm, it was debatable whether the benefit of reaching a large - enough size and acting in accordance to the defined strategy could exceed the cost of losing the objectivity of treating each sample independently. <br />
<br />
* Fighting the microscope/image processing delay, by keeping the angle fixed and changing it only once every 0.9 seconds. This strategy came at the cost of keeping the same angle (maybe wrong) for 0.9 seconds, which is equivalent to 3 pulses. Before testing, it was also unclear whether the benefit of obtaining the real angle, without delay, would exceed the cost of not changing the angle every time the chance was given.<br />
<br />
As the system was subject to strong stochasticity, the benefits of none of the above strategies exceeded their costs, as compared to the Threshold Optimized Controller. Therefore, among all my tries, the minimal objective function value was obtained for the Threshold Optimized Controller.<br />
<br clear="all" /><br />
<br />
=== Hysteresis based Sliding Mode Controller ===<br />
'''Cost function value of &Gamma;=0.7727. Implemented by Moritz Lang.'''<br />
<br />
[[Image:pathHysteresis.jpg|thumb|400px|Typical path of the simulated E. lemming around the rectangle when using the hysteresis based sliding mode controller. Black solid: Path the E. lemming took when surrounding the rectangle once. Blue dotted: The reference rectangle. Please remark that the controller is supposed to rapidly reach the corners of the rectangle and not to stay in the proximity of the edges.]]It is easy to calculate that the distance between the E. lemming and its destination decreases iff <code>|&phi;<sub>is</sub>-&phi;<sub>sh</sub>|mod 2&pi;<&pi;/2</code>. However, this decrease can be small for larger differences in this set and especially near the destination a direction of the E. lemming only narrowly fulfilling this condition will soon get invalid due to the movement of the E. lemming nearly tangential to the reference direction. Furthermore, due to the slight changes in direction during swimming and the measurement error when determining the direction of the E. lemming, it can happen that, when the angle between the reference direction and the actual direction is near to &pi;, the direction of the E. lemming "enters" and "leaves" this set very rapidly. A simple algorithm like "red light when the difference of the directions is smaller than &pi;, otherwise far-red light" could then lead to rapid switching between the diodes, an effect not desirable in an experimental setup.<br />
<br />
I thus decided to define two sets, <code>S<sub>on</sub>={&phi;<sub>is</sub>&isin;[0,2&pi;):|&phi;<sub>is</sub>-&phi;<sub>sh</sub>|mod 2&pi;<&pi;/2}</code> and <code>S<sub>off</sub>={&phi;<sub>is</sub>&isin;[0,2&pi;):|&phi;<sub>is</sub>-&phi;<sub>sh</sub>|mod 2&pi;<&pi;/3}</code>. Furthermore the controller has two states, <code>&zeta;<sub>on</sub></code> and <code>&zeta;<sub>off</sub></code>, and the state of the controller is maintained between evaluations of the controller algorithm. <br />
<br />
When the controller is in state <code>&zeta;<sub>off</sub></code>, it tests whether <code>&phi;<sub>is</sub></code> is in <code>S<sub>off</sub></code> or not. If the condition is fulfilled, a 2.4s (&asymp;4 evaluations) red light pulse is send and the state is set to <code>S<sub>on</sub></code>.<br />
<br />
When the controller is in state <code>&zeta;<sub>on</sub></code>, it tests whether <code>&phi;<sub>is</sub></code> is in <code>S<sub>on</sub></code> or not. If the condition is not fulfilled, a 2.1s (&asymp;3 evaluations) far-red light pulse is send and the state is set to <code>S<sub>off</sub></code>.<br />
<br />
Our evaluations showed that this controller forces the E. lemming successful around the rectangle (see Figure on the right), while minimizing both light pulses.<br />
<br clear="all" /><br />
<br />
=== Noise Refusing Subspace of Trust Controller ===<br />
'''Cost function value of &Gamma;=0.8089. Implemented by Christoph Hold.'''<br />
<br />
The controller is a graduated response to the derivation of angles <code>&phi;<sub>der</sub>=|&phi;<sub>set</sub> - &phi;<sub>is</sub>|</code> that takes advantage of an additional input signal. As there is two input binary signals this gives 4 possible input combinations:<br />
{| border="1" style="text-align:center"<br />
|-<br />
|colspan="2" | Input <br />
| Output<br />
|-<br />
| '''red light'''<br />
| '''far red light'''<br />
| '''bias'''<br />
|-<br />
| 0<br />
| 0<br />
| as before<br />
|-<br />
| 1<br />
| 0<br />
| high<br />
|-<br />
| 0<br />
| 1<br />
| low<br />
|-<br />
| 1<br />
| 1<br />
| medium<br />
|-<br />
|}<br />
<br />
<br />
Additionally it is coupled with a noise suppression.<br />
<br />
1. If the derivation of angle <code>&phi;<sub>der</sub>&lt; &alpha;<sub>narrow</sub></code> is small then by red light emission the bias is shifted as high as possible in order to keep the bacterium on the right track.<br />
<br />
2. If the derivation of angle <code>&phi;<sub>der</sub>&lt; &alpha;<sub>wide</sub></code> is acceptable, a compromise between going further that direction and tumbling is achieved by the usage of both red and far red light.<br />
<br />
3. If the derivation of angle <code>&phi;<sub>der</sub>&gt; &alpha;<sub>wide</sub></code> tumbling is initiated by far red light.<br />
<br />
The angles of rules 1 and 2 are so chosen that the mean change in angle through tumbling will result in the optimal direction. A further element of the controller tries to distinguish between angle derivation due to the noisy angle signal and real tumbles and applies the last decision of rules 1 and 2 in order to prevent a wrong way induced by error.<br />
<br />
=== Four Zones of Preference Controller ===<br />
[[Image:ETHZ_Basel_controller_fourzones.png|thumb|400px|'''Schematics of the four zones controller.''' Area 1 and 4 send a red or far-red light pulse of 1 time unit, whereas Area 2 is dark and Area 3 has a range from 3 to 1 time units.]]<br />
'''Cost function value of &Gamma;=0.8196. Implemented by George Rosenberger'''<br />
<br />
A core problem of the very simple "red light when the difference of the directions is smaller than π, otherwise far-red light" algorithm is, that the edge between red and far-red light is very sharp. Therefore, the controller often changes between these two states and because of the time delay of the microscope and image processing, prediction of best light pulse tends to be inaccurate at this threshold.<br />
<br />
The core concept of this controller is to extend the very basic algorithm in a way, that the edge between red and far-red light is avoided, e.g. it should be leaped. This is achieved by creating a dark area of 2 * 15° between red and far-red thresholds, in which no light pulse is being sent at all. Next to the far-red light zone, the repeating times are increased in an order to possibly leap the dark area and go to a different angle, better (or worse) than the dark area.<br />
<br />
=== Majority Vote Proportional - Second Derivative Threshold Controller===<br />
'''Cost function value of &Gamma;=0.8379. Implemented by Thanuja Ambegoda.'''<br />
[[Image:ETHZ_controller_schema_mv.png|thumb|400px|'''Majority Vote and Derivative based Controller.''' On the left, the challenges posed by the controlled model are posed. On the right, the tools implemented by the algorithm to overcome these obstacles are shown. The arrows indicate which tool handles which obstacle]]<br />
<br />
What the controller needs to do boils down to the following:<br />
When the cell is going in the wrong direction, make it tumble until each heads towards the right direction. When it is heading towards the right direction, try to keep it in the swimming mode. <br />
But, the task is slightly complicated by the presence of the following 'obstacles':<br />
<br />
*Randomness of the motion – the direction changes slightly (randomly) when swimming and it changes rapidly with larger angles when tumbling.<br />
*Noise in measurement: the error we measure is not the exact error<br />
*Time delay of measurement – the measurement of error is not the current error. It's around 1 second before now.<br />
<br />
In the absence of the above three, the controller would have been trivial. This particular controller tries to minimize the effects of these by deploying an algorithm that incorporates the following features:<br />
<br />
*Majority voting based on historical error - This is a way of fighting noise. When deciding if error correction needs to be deployed (force tumbling), the controller not only looks at the current error. But also, it tries to deduce if there is a real error by looking at the reported error of a few previous samples. Majority voting is also used with differential error prediction (described later) at different levels of control inside the algorithm.<br />
*Rapid Checks - A slight variation to the above majority voting, used to detect larger errors, quickly. A slightly higher margin of error is allowed with a lower number of previous samples, when there is a need to detect a larger error quickly. A similar setting can be used with a lower threshold to detect quick returns to the correct direction<br />
*Error prediction based on differential control - This is used to minimize the effects of the time delay of measurements. Differential error is considered in conjunction with the reported error evaluated using the majority voting scheme.</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_BaselTeam:ETHZ Basel2010-11-16T01:34:16Z<p>Georgerosenberger: </p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Introduction}}<br />
= E. lemming - a remotely controlled living robot by ETH Zurich =<br />
{{ETHZ_Basel10_Teaser}}<br />
<br />
== Sponsors ==<br />
{| border="0" align="center"<br />
|<html><img src="https://static.igem.org/mediawiki/2010/6/65/ETHZ_Basel_sponsors.jpg"></html><br />
|}</div>Georgerosenbergerhttp://2010.igem.org/File:ETHZ_Basel_sponsors.jpgFile:ETHZ Basel sponsors.jpg2010-11-16T01:33:57Z<p>Georgerosenberger: uploaded a new version of "Image:ETHZ Basel sponsors.jpg"</p>
<hr />
<div></div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_BaselTeam:ETHZ Basel2010-11-16T01:33:37Z<p>Georgerosenberger: Undo revision 208715 by Georgerosenberger (Talk)</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Introduction}}<br />
= E. lemming - a remotely controlled living robot by ETH Zurich =<br />
{{ETHZ_Basel10_Teaser}}<br />
<br />
== Sponsors ==<br />
{| border="0" align="center"<br />
|<html><img src="http://n.ethz.ch/student/georger/ETHZ_Basel_sponsors.jpg"></html><br />
|}</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_BaselTeam:ETHZ Basel2010-11-16T01:33:00Z<p>Georgerosenberger: </p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Introduction}}<br />
= E. lemming - a remotely controlled living robot by ETH Zurich =<br />
{{ETHZ_Basel10_Teaser}}<br />
<br />
== Sponsors ==<br />
{| border="0" align="center"<br />
|[[Image:ETHZ_Basel_sponsors.jpg|none|center|800px|]]<br />
|}</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T19:49:51Z<p>Georgerosenberger: /* Safety considerations in Switzerland and at ETH Zurich */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Safety =<br />
[[Image:ETHZ_Basel_savetyFirst.jpg|thumb|400px|'''Safety first! ''']]<br />
''What does safety mean to us?''<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety] guideline and its key questions for our documentation:<br />
<br clear="all" /><br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strains. Furthermore, we have special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project.<br />
<br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
The safety, health and environmental group at ETH (SGU) is one of the most relevant sources when it comes to biosafety and safety in the lab. The group organizes safety training courses for students and staff on a regular basis, which are compulsory to attend for every student, before beginning to work in the lab. During these courses, they are taught which measures must be taken in case of emergency, how to extinct fires (everyone has then to do this!) and what to do and who to call for various incidences. The group hands out a guideline book, in which the course is summarized and all important questions can be quickly looked up. It as well provides emergency numbers.<br />
The SGU furthermore hosts various seminars on safety issues, which are free and open for everyone to attend.<br />
<br />
All members of the wet laboratory subteam have attended those courses. We are more experienced now than we were before the courses, which is why we appreciate and respect those guidelines even more. When it comes to an emergency, seconds are decisive!<br />
<br />
= References =<br />
[1] [https://2010.igem.org/Safety iGEM Safety Page]<br />
<br />
[2] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en Swiss Legal Bases Biotechnology]<br />
<br />
[3] [http://www.sicherheit.ethz.ch/ Safety at ETH (german)]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/Archeal_Light_ReceptorTeam:ETHZ Basel/Biology/Archeal Light Receptor2010-10-27T19:45:13Z<p>Georgerosenberger: /* Archeal Light Receptor */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Archeal Light Receptor =<br />
[[Image:ETHZ_Basel_archean_chemotactical_network.png|thumb|400px|'''Schematical overview of the chimeric chemotaxis pathway. '''ALR refers to the archeal light receptor, MCPs to the membrane receptor proteins and Che to the intracellular chemotaxis proteins.]]<br />
<br />
Besides the light-sensitive Pif3/PhyB-system, another implementation strategy caught our attention: The generation of our E. lemming by the fusion of an '''archeal photoreceptor''' to a bacterial chemotactic transducer. This was successfully demonstrated by Jung ''et al.'' in 2001 [[Team:ETHZ_Basel/Biology/Archeal_Light_Receptor#References|[1]]], who fused the ''Natronobacterium pharaonis'' NpSRII (Np seven-transmembrane retinylidene photoreceptor sensory rhodopsins II) and their cognate transducer HtrII to the cytoplasmic domain of the chemotaxis transducer EcTsr of ''Escherichia coli''. <br />
<br />
Rhodopsins are photoreactive, membrane-embedded proteins, which are found not only in archaea, but in eubacteria and microbes as well. In ''Natronobacterium pharaonis'', the NpSRII contains a domain of seven membrane-spanning helices, which carry out two distinct functions: Firstly, they serve as photo-inducible ion-pumps and secondly, as actors in the chemotaxis signaling network [[Team:ETHZ_Basel/Biology/Archeal_Light_Receptor#References|[1]]].<br />
<br />
=Construct= <br />
[[Image:ETH Basel pACT3.png|thumb|400px|'''Overview of the fusion modules''' Archaeal modules are combined with an eubacterial light-sensitive module to generate a fully functional synthetic module.]]<br />
<br />
We purchased the codon optimized version of the archeal photoreceptor NpSRII EcTsr-fusion from Geneart and cloned the sequence as biobrick into the standardized vector pSB1C3 ([http://partsregistry.org/Part:BBa_K422001 BBa_K422001]). <br />
<br />
As membrane proteins are difficult to express at the appropriate concentrations, we decided to subclone the receptor into the '''IPTG-inducible plasmid pACT3''' allowing us to adapt the expression level.<br />
The archeal receptor fusion was cloned into pACT3 via <font color=#ba0000>BamHI</font> and <font color=#ba0000>HindIII</font>. In addition to the BamHI site, the forward primer encodes for a ribosome binding site to ensure the optimal spacing to the start codon.<br />
<br />
Forward (5'-3'): GT<font color=#ba0000>GGATCC</font>A<font color=#ba0000>AGGAGA</font>TATACATATGGTTGGTCTGACCACCCTG<br />
<br />
Reverse (5'-3'): GC<font color=#ba0000>AAGCTT</font>TTAACCGCTATAAATTG<br />
<br />
=Chemotactic analysis=<br />
To observe chemotactic behaviour, cells were grown at 30 °C in Lysogeny Broth to on OD of 1.0. '''All-''trans'' retinal''' has to be added to the media for NpSRII to change it's conformation into an active light absorbing pigment. Different levels of IPTG can influence the protein expression level.<br />
<br />
Phototactic stimuli were delivered through a light pulse at 500 nm and cells tracked. You can find out more about [[Team:ETHZ_Basel/InformationProcessing|'''microscopy and information processing''']] here.<br />
<br />
And don't forget, check out our results, the [[Team:ETHZ_Basel/Achievements/The_Lemming|'''actual E. lemming''']].<br />
<br />
=Receptor analysis=<br />
Add: SDS Gel of expressed protein, membrane insertion?<br />
<br />
= References =<br />
[1] [http://jb.asm.org/cgi/content/full/183/21/6365?maxtoshow=&hits=10&RESULTFORMAT=1&andorexacttitle=and&andorexacttitleabs=and&fulltext=An+archaeal+photosignal-transducing+module+mediates+phototaxis+in+%27%27Escherichia+&andorexactfulltext=and&searchid=1&FIRSTINDEX=0&sortspec=relevance&resourcetype=HWCIT: Jung, Spudich, Trivedi and Spudich: An archaeal photosignal-transducing module mediates phototaxis in ''Escherichia coli''. Journal of bacteriology. 2001; 21].</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/BiologyTeam:ETHZ Basel/Biology2010-10-27T19:12:16Z<p>Georgerosenberger: /* Biology & Wet Laboratory: Overview */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Biology & Wet Laboratory: Overview =<br />
<br />
<br />
<html><br />
<div class="thumb tright"><div class="thumbinner" style="width:402px;"><br />
<iframe title="YouTube video player" class="youtube-player" type="text/html" width="400" height="325" src="http://www.youtube.com/embed/yQdX8o8i_uc?hd=1" frameborder="0"></iframe><br />
<div class="thumbcaption"><div class="magnify"><a href="http://www.youtube.com/watch?v=yQdX8o8i_uc?hd=1" class="external" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div><b>Molecular mechanism of E. lemming.</b> A light-sensitive dimerizing complex fused to proteins of the chemotaxis pathway at a spatially fixed location is induced by light pulses and therefore localization of the two molecules can be manipulated.</div></div></div><br />
</html><br />
<br />
The core idea of E. lemming is based on the '''spatial localization''' of one of the species of the chemotaxis network, so called '''Che proteins'''. Phosphorylated CheY (further referred to as CheYp) binds to the flagellar motor protein FliM, where it induces tumbling. Our research aimed at gaining control over this molecular switch and thus over the [https://2010.igem.org/Team:ETHZ_Basel/Modeling/Movement: flagellar machine]. Through localizing (intracellular anchoring), the effective concentration of the free cytosolic CheY protein is decreased at its site of action, greatly affecting the activity on its downstream partners. Anchoring is achieved with the help of '''light-sensitive proteins (LSPs)''' that dimerize upon a light signal (photodimerization). The Che protein is fused to LSP1, while its binding partner LSP2 is itself fused to a so called '''anchor protein'''. Dimerization of the two LSPs into an LSP1/LSP2 complex, where LSP1 is still bound to CheY, results in spatial re-localization of the Che protein, which, as a final measurable output, induces a change in the ratio between tumbling and directed flagellar movement. The general idea is nicely represented by the video on the right side. Read more about the [[Team:ETHZ_Basel/Biology/Molecular_Mechanism|'''Molecular mechanism''']].<br />
<br />
A second approach for the design of E. lemming is the usage of a photoreceptor connected to the bacterial chemotaxis system. Find out more about the [[Team:ETHZ_Basel/Biology/Archeal_Light_Receptor|'''Archeal Light Receptor''']] that enabled us to '''successfully''' implement the light-inducible synthetic network via the fusion of archeal and eubactarial parts. <br />
<br />
The fusion proteins were constructed according to the [[Team:ETHZ_Basel/Biology/Cloning|'''Cloning Strategy BBF RFC28''']], a method for the combinatorial multi-part assembly based on the type II restriction enzmye AarI.<br />
<br />
In the section [[Team:ETHZ_Basel/Biology/Implementation|'''Implementation''']], you find details on the experimental design such as the ideal conditions for the observation of chemotaxis behavior (strain, media, growth temperature, growth phase etc.) and the functionality and expression level assays of the fusion proteins.<br />
<br />
Of course, we also reflected a lot about [[Team:ETHZ_Basel/Biology/Safety|'''Human Practices and Safety''']] during our project, because knowledge also means responsibility. This section summarizes our findings on potential risks and safety issues and the measures we have taken in order to work as safely as possible.</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/ModelingTeam:ETHZ Basel/Modeling2010-10-27T19:09:41Z<p>Georgerosenberger: /* Mathematical Modeling Overview */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Modeling}}<br />
<br />
= Mathematical Modeling Overview =<br />
[[Image:ETHZ_Basel_molecular_comb.png|thumb|400px|'''Figure 1: schematical overview of the modeled processes in E. lemming.''' LSP refers to light switch protein, AP to anchor protein, and Che to the attacked protein of the chemotaxis pathway.]]<br />
<br />
A complex mathematical model of E. lemming from both literature inspired and self developed submodels was created that covers the processes displayed in Figure 1.<br />
<br />
In a first step, existing models for the individual processes of E. lemming have been identified by literature research, implemented, corrected and adapted to our needs. Where we could not rely on established models, we started modeling on our own and calibrated the model with regard to available literature knowledge.<br />
<br />
* [[Team:ETHZ_Basel/Modeling/Light_Switch|'''Light Switch''']]: both implementation approaches have been modeled:<br />
** [[Team:ETHZ_Basel/Modeling/Light_Switch#Modeling_of_the_light_switch:_PhyB.2FPIF3|'''PhyB/PIF3''']]: a deterministic molecular model based on the light-sensitive dimerizing Arabidopsis proteins PhyB and PIF3.<br />
** [[Team:ETHZ_Basel/Modeling/Light_Switch#Modeling_of_the_PhyB.2FPIF3_light_switch#Archeal_light_receptor|'''Archeal Light Receptor''']]: a deterministic molecular model based on the archeal light receptor.<br />
* [[Team:ETHZ_Basel/Modeling/Chemotaxis|'''Chemotaxis Pathway''']]: two deterministic molecular models of the chemotaxis pathway.<br />
* [[Team:ETHZ_Basel/Modeling/Movement|'''Bacterial Movement''']]: a self developed stochastic model of ''E. coli'' movement on basis of the CheYp bias.<br />
<br />
In a second part, we combined the submodels stepwise to more comprehensive models that we could use to address different important questions to: <br />
* [[Team:ETHZ_Basel/Modeling/Combined#PhyB.2FPIF3_light_switch_-_Chemotaxis |'''PhyB/PIF3 light switch - Chemotaxis''']]: this model was used to reduce [[Team:ETHZ_Basel/Biology|wet laboratory experiments]] by identification molecular targets by [[Team:ETHZ_Basel/Modeling/Experimental_Design|experimental design]].<br />
* [[Team:ETHZ_Basel/Modeling/Combined#Archeal_light_receptor_-_Chemotaxis |'''Archeal light receptor - Chemotaxis''']]: this model was combined identically to the one above.<br />
* [[Team:ETHZ_Basel/Modeling/Combined#Chemotaxis_-_Movement |'''Chemotaxis - Movement''']]: complete model of E. lemming as a simulative test bench for the [[Team:ETHZ_Basel/InformationProcessing/Controller|controller]] design and as a brick of the comprehensive simulation of [[Team:ETHZ_Basel/InformationProcessing|information processing]].</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/ModelingTeam:ETHZ Basel/Modeling2010-10-27T19:07:14Z<p>Georgerosenberger: /* Mathematical Modeling Overview */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Modeling}}<br />
<br />
= Mathematical Modeling Overview =<br />
[[Image:ETHZ_Basel_molecular_comb.png|thumb|400px|'''Figure 1: schematical overview of the modeled processes in E. lemming.''' LSP refers to light switch protein, AP to anchor protein, and Che to the attacked protein of the chemotaxis pathway.]]<br />
<br />
A complex mathematical model of E. lemming from both literature inspired and self developed submodels was created that covers the processes displayed in Figure 1.<br />
<br />
In a first step, existing models for the individual processes of E. lemming have been identified by literature research, implemented, corrected and adapted to our needs. Where we could not rely on established models, we started modeling on our own and calibrating the model with regard to available literature knowledge.<br />
<br />
* [[Team:ETHZ_Basel/Modeling/Light_Switch|'''Light Switch''']]: both implementation approaches have been modeled:<br />
** [[Team:ETHZ_Basel/Modeling/Light_Switch#Modeling_of_the_light_switch:_PhyB.2FPIF3|'''PhyB/PIF3''']]: a deterministic molecular model based on the light-sensitive dimerizing Arabidopsis proteins PhyB and PIF3.<br />
** [[Team:ETHZ_Basel/Modeling/Light_Switch#Modeling_of_the_PhyB.2FPIF3_light_switch#Archeal_light_receptor|'''Archeal Light Receptor''']]: a deterministic molecular model based on the archeal light receptor.<br />
* [[Team:ETHZ_Basel/Modeling/Chemotaxis|'''Chemotaxis Pathway''']]: two deterministic molecular models of the chemotaxis pathway.<br />
* [[Team:ETHZ_Basel/Modeling/Movement|'''Bacterial Movement''']]: a self developed stochastic model of ''E. coli'' movement on basis of the CheYp bias.<br />
<br />
Secondly we combined the submodels stepwise to more comprehensive models that we could use to address different important questions to: <br />
* [[Team:ETHZ_Basel/Modeling/Combined#PhyB.2FPIF3_light_switch_-_Chemotaxis |'''PhyB/PIF3 light switch - Chemotaxis''']]: this model was used to reduce [[Team:ETHZ_Basel/Biology|wet laboratory experiments]] by identification molecular targets by [[Team:ETHZ_Basel/Modeling/Experimental_Design|experimental design]].<br />
* [[Team:ETHZ_Basel/Modeling/Combined#Archeal_light_receptor_-_Chemotaxis |'''Archeal light receptor - Chemotaxis''']]: this model was combined identically to the one above.<br />
* [[Team:ETHZ_Basel/Modeling/Combined#Chemotaxis_-_Movement |'''Chemotaxis - Movement''']]: complete model of E. lemming as a simulative test bench for the [[Team:ETHZ_Basel/InformationProcessing/Controller|controller]] design and as a brick of the comprehensive simulation of [[Team:ETHZ_Basel/InformationProcessing|information processing]].</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/ModelingTeam:ETHZ Basel/Modeling2010-10-27T19:05:49Z<p>Georgerosenberger: /* Mathematical Modeling Overview */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Modeling}}<br />
<br />
= Mathematical Modeling Overview =<br />
[[Image:ETHZ_Basel_molecular_comb.png|thumb|400px|'''Figure 1: schematical overview of the modeled processes in E. lemming.''' LSP refers to light switch protein, AP to anchor protein, and Che to the attacked protein of the chemotaxis pathway.]]<br />
<br />
A complex mathematical model of E. lemming from both literature inspired and self developed submodels was created that covers the processes displayed in Figure 1.<br />
<br />
In a first step, existing models for the individual processes of E. lemming have been identified by literature research, implemented, corrected and adapted to our needs. Where we could not rely on established models, we started modeling on our own and calibrating the model with regard to available literature knowledge.<br />
<br />
* [[Team:ETHZ_Basel/Modeling/Light_Switch|'''Light Switch''']]: both implementation approaches have been modeled:<br />
** [[Team:ETHZ_Basel/Modeling/Light_Switch#Modeling_of_the_light_switch:_PhyB.2FPIF3|'''PhyB/PIF3''']]: a deterministic molecular model based on the light-sensitive dimerizing Arabidopsis proteins PhyB and PIF3.<br />
** [[Team:ETHZ_Basel/Modeling/Light_Switch#Modeling_of_the_PhyB.2FPIF3_light_switch#Archeal_light_receptor|'''Archeal Light Receptor''']]: a deterministic molecular model based on the archeal light receptor.<br />
* [[Team:ETHZ_Basel/Modeling/Chemotaxis|'''Chemotaxis Pathway''']]: two deterministic molecular models of the chemotaxis pathway.<br />
* [[Team:ETHZ_Basel/Modeling/Movement|'''Bacterial Movement''']]: a self developed stochastic model of ''E. coli'' movement on basis of the CheYp bias.<br />
<br />
Secondly we combined the submodels stepwise to more comprehensive models that we could use to address different important questions to: <br />
* [[Team:ETHZ_Basel/Modeling/Combined#PhyB.2FPIF3_light_switch_-_Chemotaxis |'''PhyB/PIF3 light switch - Chemotaxis''']]: this model was used to reduce [[Team:ETHZ_Basel/Biology|wet laboratory experiments]] by identify molecular targets by [[Team:ETHZ_Basel/Modeling/Experimental_Design|experimental design]].<br />
* [[Team:ETHZ_Basel/Modeling/Combined#Archeal_light_receptor_-_Chemotaxis |'''Archeal light receptor - Chemotaxis''']]: complete model of E. lemming as a simulative test bench for the [[Team:ETHZ_Basel/InformationProcessing/Controller|controller]] design and as a brick of the comprehensive simulation of [[Team:ETHZ_Basel/InformationProcessing|information processing]].<br />
* [[Team:ETHZ_Basel/Modeling/Combined#Chemotaxis_-_Movement |'''Chemotaxis - Movement''']]: complete model of E. lemming as a simulative test bench for the [[Team:ETHZ_Basel/InformationProcessing/Controller|controller]] design and as a brick of the comprehensive simulation of [[Team:ETHZ_Basel/InformationProcessing|information processing]].</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/ModelingTeam:ETHZ Basel/Modeling2010-10-27T19:02:33Z<p>Georgerosenberger: /* Mathematical Modeling Overview */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Modeling}}<br />
<br />
= Mathematical Modeling Overview =<br />
[[Image:ETHZ_Basel_molecular_comb.png|thumb|400px|'''Figure 1: schematical overview of the modeled processes in E. lemming.''' LSP refers to light switch protein, AP to anchor protein, and Che to the attacked protein of the chemotaxis pathway.]]<br />
<br />
A complex mathematical model of E. lemming from both literature inspired and self developed submodels was created that covers the processes displayed in Figure 1.<br />
<br />
In a first step, existing models for the individual processes of E. lemming have been identified by literature research, implemented, corrected and adapted to our needs. Where we could not rely on established models, we started modeling on our own and calibrating the model with regard to available literature knowledge.<br />
<br />
* [[Team:ETHZ_Basel/Modeling/Light_Switch|'''Light Switch''']]: both implementation approaches have been modeled:<br />
** [[Team:ETHZ_Basel/Modeling/Light_Switch#Modeling_of_the_light_switch:_PhyB.2FPIF3|'''PhyB/PIF3''']]: a deterministic molecular model based on the light-sensitive dimerizing Arabidopsis proteins PhyB and PIF3.<br />
** [[Team:ETHZ_Basel/Modeling/Light_Switch#Modeling_of_the_PhyB.2FPIF3_light_switch#Archeal_light_receptor|'''Archeal Light Receptor''']]: a deterministic molecular model based on the archeal light receptor.<br />
* [[Team:ETHZ_Basel/Modeling/Chemotaxis|'''Chemotaxis Pathway''']]: two deterministic molecular models of the chemotaxis pathway.<br />
* [[Team:ETHZ_Basel/Modeling/Movement|'''Bacterial Movement''']]: a self developed stochastic model of ''E. coli'' movement on basis of the CheYp bias.<br />
<br />
Secondly we combined the submodels stepwise to more comprehensive models that we could use to address different important questions to: <br />
* [[Team:ETHZ_Basel/Modeling/Combined#Light_switch_-_Chemotaxis |'''Light switch - Chemotaxis''']]: this model was used to reduce [[Team:ETHZ_Basel/Biology|wet laboratory experiments]] by identify molecular targets by [[Team:ETHZ_Basel/Modeling/Experimental_Design|experimental design]].<br />
* [[Team:ETHZ_Basel/Modeling/Combined#Light_switch_-_Chemotaxis_-_Movement |'''Light switch - Chemotaxis - Movement''']]: complete model of E. lemming as a simulative test bench for the [[Team:ETHZ_Basel/InformationProcessing/Controller|controller]] design and as a brick of the comprehensive simulation of [[Team:ETHZ_Basel/InformationProcessing|information processing]].</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Achievements/Matlab_ToolboxTeam:ETHZ Basel/Achievements/Matlab Toolbox2010-10-27T19:00:14Z<p>Georgerosenberger: /* E. lemming 2D Game */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Achievements}}<br />
<br />
= Matlab / Simulink Toolbox =<br />
== Background ==<br />
[[Image:lemmingToolbox.jpg|thumb|350px|Screenshot of the Simulink blocks available in the toolbox. Please note that these blocks can be visually assembled with the Simulink blocks of other Toolboxes (e.g. blocks for nearly any mathematical function), and that the algorithms we developed can be accessed directly through Matlab code, too.]]<br />
<br />
During the iGEM competition we developed several fast algorithms (e.g. for cell detection and tracking), complex models, as well as novel visualization, user input and microscope control approaches. Already during their development we took serious efforts to construct all parts in a modular and interchangeable way to deal with the combinatorial diversity of the questions our models as well as the information processing had to answer. Besides the various modules which can easily be reused by people experienced in programming, we also developed a graphical block representation of the various modules based on Simulink. This graphical user interface (GUI) can also be used by people with no or only little programming knowledge to solve complex tasks. These tasks do not have to be necessarily related to our iGEM project, but can e.g. include the simulation of wild type chemotaxis, the detection of various cell types or the transfer of image data between a microscope and Matlab. For the use of anyone interested, we bundled all these Matlab & Simulink files together in the form of an easy to use Matlab Toolbox, which we named the Lemming Toolbox. This Lemming Toolbox was also used extensively during our project and speeded up the ''in silico'' part significantly due to its modular design, which allowed for fast reassembly of program parts to solve urgent last-minute questions.<br />
<br />
Since science is based on the open availability of information and approaches, we decided to give something back to the Systems and Synthetic Biology community by cleaning and documenting the Lemming Toolkit and making it available as Open Source under the GNU General Public License (see [http://www.gnu.org/licenses/gpl.html]). In the following we give a short overview about the abilities and requirements of the software, as well as providing free download possibilities.<br />
Finally we shortly present the various systems (Simulink models) build with the help of the Lemming Toolkit, for which we also provide download possibilities. We hope that the Lemming Toolkit can help other researches as well as future iGEM participants to faster solve their tasks.<br />
<br />
== Features ==<br />
The Lemming toolbox has, amongst others, the following features:<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|light switch], PhyB/PIF3 and ALR.<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|chemotaxis pathway]], based on the published models of Spiro et al. (1997) and Mello & Tu (2003).<br />
* A stochastic model of the [[Team:ETHZ_Basel/Modeling/Movement|movement of E. coli]] generating paths for an ''E. coli'' cell for time varying bias signals.<br />
* Various image sources, e.g. modules loading saved microscope images, generating microscope look-alike images from simulations, or pulling images in real-time from a microscope<sup>(1)</sup>.<br />
* Fast cell detection and tracking algorithms compatible with all image sources.<br />
* Visualization methods for real-time post-processing and displaying microscope images, together with an intuitive representation of the results of upstream modules like cell detection.<br />
* Various user input possibilities, like real-time control of modules with either a joystick or the keyboard.<br />
* Modules enabling the control of a automated microscope with Matlab scripts<sup>(1)</sup>.<br />
* Either accessible to Matlab scripts, realized as a broad set of standardized Matlab functions, or by an...<br />
* Intuitive graphical user interface based on Simulink, which can fully be combined with other Simulink toolboxes.<br />
* Modular and expandable design.<br />
* Open Source under the GNU General Public License.<br />
* Platform independent.<br />
<br />
<small><sup>(1)</sup>This functionality is only usable with one of the various supported microscopes and an installation of &mu;Manager and &mu;PlateImager. A finished version of &mu;PlateImager will be published soon, but a beta version can be obtained for free by writing a request to [mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]. &mu;Manager is a third party open source program available under [http://www.micro-manager.org/|http://www.micro-manager.org/].</small><br />
<br />
== Requirements ==<br />
The following requirements are only necessary to be able to use all features of the Lemming Toolbox. Most modules can still be used even if one or several of the requirements are not fulfilled. In such cases, we recommand to simply download the Toolbox and test the corresponding modules. We tried to make this list comprehensive, however we cannot guarantee that we did not miss one or several requirements. The following requirements we are aware of:<br />
* Matlab R2007b or higher (not tested with lower versions).<br />
* Installed [http://www.mathworks.com/products/image/Image Image Processing Toolbox].<br />
* Installed [http://www.mathworks.com/products/3d-animation/ Simulink 3D Animation] (former named Virtual Reality Toolbox).<br />
* Approximately 24 MB of free disk space.<br />
* When using the joystick input: Joystick with at least three axes and six buttons. Force feedback optional.<br />
* For smooth real-time image analysis we recommend at least a 1GHz processor with 1024 MB RAM.<br />
<br />
== Download ==<br />
The current release of the Matlab / Simulink Toolbox as well as all examples can be downloaded as single files or as all-in-one package from the project page on SourceForge.net. In addition, a [https://sourceforge.net/scm/?type=svn&group_id=337301 '''SVN repository'''] is available with the current development revision.<br />
<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox_Setup.zip/download '''Download the Matlab Toolbox including all models''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox.zip/download '''Download only the Matlab Toolbox''']<br />
<br />
==Implemented models and examples ==<br />
=== Tracking the E. lemming from Saved Images ===<br />
[[Image:imageStreamJoystick.jpg|thumb|250px|Screenshot of the <em>Tracking from Image Stream Model</em> in the joystick input version.]]This example shows how to continuously load saved microscopy files from the disk, and to detect and track the cells on them. Furthermore the user can select one cell for which the movement direction is visualized and for which the path is plotted. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating the E. lemming ===<br />
[[Image:modelJoystick.jpg|thumb|250px|Screenshot of the <em>Simulation Model</em> in the joystick input version.]]This model exemplifies how to use the "molecular model" and the "movement model" block to stochastically generate possible paths of the E. lemming based on the light inputs. The user can manually input the light signals either with the joystick or the mouse or activate a controller which forces the E. lemming to a user defined direction. For every time-step a microscope look-alike image is generated and visualized. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating and Detecting the E. lemming ===<br />
[[Image:fullModelKeyboard.jpg|thumb|250px|Screenshot of the <em>Simulation and Detection Model</em> in the keyboard input version.]]Same as the previous example, only that this time not the outputs of the "movement model" block are directly used to determine the position. Instead, the generated image for the visualization is also used as the input for the "cell detection" and the "cell tracking" block. The detected position of the E. lemming is then used for visualization and as an input for the controller. This version requires more sophisticated user inputs. This model is also available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Real-time Tracking and Control of the E. lemming (''in vivo'')===<br />
[[Image:realTimeModel.jpg|thumb|250px|Screenshot of the <em>Real-Time Cell Tracking Model</em> used to connect to the microscope and control the ''in vivo'' E. lemming in real-time.]]The model shows the setup of how the connection to the microscope was established, how the E. lemming was controlled in real-time and forced in the direction the user defined either with the keyboard or with a joystick. This model exists also in a keyboard and in a joystick version, but is not provided for download here for several reasons: First, for the model a supported automatized microscope is needed. Second, additional software has to be installed. Although we could provide this software for download, mistakes in using it can easily damage the microscope and lead to serious financial harm. Nevertheless, if you have an automatized microscope, and you are skilled and authorized, you can contact us by mail ([mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]) and we will provide the models together with the needed software as well as with some security and usage information.<br />
<br clear="all" /><br />
<br />
=== Controller Design Model ===<br />
[[Image:competitionModel.jpg|thumb|250px|Screenshot of the <em> Controller Design Model</em> used in the group internal controller design competition.]]This model represents the model which was used to design and evaluate the different controllers used to force the E. lemming on the user defined direction. For speed reasons, only a simple graphical output is required. Furthermore no user input is needed during the simulation.<br />
* [http://sourceforge.net/projects/ethzigem10/files/Competition.zip/download '''Download the original competition model.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelSquare.zip/download '''Download the model showing how the controller is forcing the E. lemming around a rectangle.''']<br />
<br clear="all" /><br />
<br />
=== E. lemming 2D Game ===<br />
[[Image:gamingJoystick.jpg|thumb|250px|Screenshot of the <em>E. lemming 2D Gaming Model</em> in the joystick input version.]]Here, the user has to directly control the red and far-red light inputs to the "molecular model" block. In a slightly modified graphical visualization he thus has to "hunt" other ''E. coli'' cells. When close enough, the user can release photons to eliminate other cells. For more details, see [[Team:ETHZ_Basel/InformationProcessing/Game | here]]. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingKeyboard.zip/download '''Download keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingJoystick.zip/download '''Download joystick version.''']<br />
<br clear="all" /><br />
<br />
== References ==<br />
[1] [http://www.gnu.org/licenses/gpl.txt GNU General Public License, Version 3]<br />
<br />
[2] [http://www.micro-manager.org/ μManager Website]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Achievements/Matlab_ToolboxTeam:ETHZ Basel/Achievements/Matlab Toolbox2010-10-27T18:55:57Z<p>Georgerosenberger: /* Tracking the E. lemming from Saved Images */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Achievements}}<br />
<br />
= Matlab / Simulink Toolbox =<br />
== Background ==<br />
[[Image:lemmingToolbox.jpg|thumb|350px|Screenshot of the Simulink blocks available in the toolbox. Please note that these blocks can be visually assembled with the Simulink blocks of other Toolboxes (e.g. blocks for nearly any mathematical function), and that the algorithms we developed can be accessed directly through Matlab code, too.]]<br />
<br />
During the iGEM competition we developed several fast algorithms (e.g. for cell detection and tracking), complex models, as well as novel visualization, user input and microscope control approaches. Already during their development we took serious efforts to construct all parts in a modular and interchangeable way to deal with the combinatorial diversity of the questions our models as well as the information processing had to answer. Besides the various modules which can easily be reused by people experienced in programming, we also developed a graphical block representation of the various modules based on Simulink. This graphical user interface (GUI) can also be used by people with no or only little programming knowledge to solve complex tasks. These tasks do not have to be necessarily related to our iGEM project, but can e.g. include the simulation of wild type chemotaxis, the detection of various cell types or the transfer of image data between a microscope and Matlab. For the use of anyone interested, we bundled all these Matlab & Simulink files together in the form of an easy to use Matlab Toolbox, which we named the Lemming Toolbox. This Lemming Toolbox was also used extensively during our project and speeded up the ''in silico'' part significantly due to its modular design, which allowed for fast reassembly of program parts to solve urgent last-minute questions.<br />
<br />
Since science is based on the open availability of information and approaches, we decided to give something back to the Systems and Synthetic Biology community by cleaning and documenting the Lemming Toolkit and making it available as Open Source under the GNU General Public License (see [http://www.gnu.org/licenses/gpl.html]). In the following we give a short overview about the abilities and requirements of the software, as well as providing free download possibilities.<br />
Finally we shortly present the various systems (Simulink models) build with the help of the Lemming Toolkit, for which we also provide download possibilities. We hope that the Lemming Toolkit can help other researches as well as future iGEM participants to faster solve their tasks.<br />
<br />
== Features ==<br />
The Lemming toolbox has, amongst others, the following features:<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|light switch], PhyB/PIF3 and ALR.<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|chemotaxis pathway]], based on the published models of Spiro et al. (1997) and Mello & Tu (2003).<br />
* A stochastic model of the [[Team:ETHZ_Basel/Modeling/Movement|movement of E. coli]] generating paths for an ''E. coli'' cell for time varying bias signals.<br />
* Various image sources, e.g. modules loading saved microscope images, generating microscope look-alike images from simulations, or pulling images in real-time from a microscope<sup>(1)</sup>.<br />
* Fast cell detection and tracking algorithms compatible with all image sources.<br />
* Visualization methods for real-time post-processing and displaying microscope images, together with an intuitive representation of the results of upstream modules like cell detection.<br />
* Various user input possibilities, like real-time control of modules with either a joystick or the keyboard.<br />
* Modules enabling the control of a automated microscope with Matlab scripts<sup>(1)</sup>.<br />
* Either accessible to Matlab scripts, realized as a broad set of standardized Matlab functions, or by an...<br />
* Intuitive graphical user interface based on Simulink, which can fully be combined with other Simulink toolboxes.<br />
* Modular and expandable design.<br />
* Open Source under the GNU General Public License.<br />
* Platform independent.<br />
<br />
<small><sup>(1)</sup>This functionality is only usable with one of the various supported microscopes and an installation of &mu;Manager and &mu;PlateImager. A finished version of &mu;PlateImager will be published soon, but a beta version can be obtained for free by writing a request to [mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]. &mu;Manager is a third party open source program available under [http://www.micro-manager.org/|http://www.micro-manager.org/].</small><br />
<br />
== Requirements ==<br />
The following requirements are only necessary to be able to use all features of the Lemming Toolbox. Most modules can still be used even if one or several of the requirements are not fulfilled. In such cases, we recommand to simply download the Toolbox and test the corresponding modules. We tried to make this list comprehensive, however we cannot guarantee that we did not miss one or several requirements. The following requirements we are aware of:<br />
* Matlab R2007b or higher (not tested with lower versions).<br />
* Installed [http://www.mathworks.com/products/image/Image Image Processing Toolbox].<br />
* Installed [http://www.mathworks.com/products/3d-animation/ Simulink 3D Animation] (former named Virtual Reality Toolbox).<br />
* Approximately 24 MB of free disk space.<br />
* When using the joystick input: Joystick with at least three axes and six buttons. Force feedback optional.<br />
* For smooth real-time image analysis we recommend at least a 1GHz processor with 1024 MB RAM.<br />
<br />
== Download ==<br />
The current release of the Matlab / Simulink Toolbox as well as all examples can be downloaded as single files or as all-in-one package from the project page on SourceForge.net. In addition, a [https://sourceforge.net/scm/?type=svn&group_id=337301 '''SVN repository'''] is available with the current development revision.<br />
<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox_Setup.zip/download '''Download the Matlab Toolbox including all models''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox.zip/download '''Download only the Matlab Toolbox''']<br />
<br />
==Implemented models and examples ==<br />
=== Tracking the E. lemming from Saved Images ===<br />
[[Image:imageStreamJoystick.jpg|thumb|250px|Screenshot of the <em>Tracking from Image Stream Model</em> in the joystick input version.]]This example shows how to continuously load saved microscopy files from the disk, and to detect and track the cells on them. Furthermore the user can select one cell for which the movement direction is visualized and for which the path is plotted. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating the E. lemming ===<br />
[[Image:modelJoystick.jpg|thumb|250px|Screenshot of the <em>Simulation Model</em> in the joystick input version.]]This model exemplifies how to use the "molecular model" and the "movement model" block to stochastically generate possible paths of the E. lemming based on the light inputs. The user can manually input the light signals either with the joystick or the mouse or activate a controller which forces the E. lemming to a user defined direction. For every time-step a microscope look-alike image is generated and visualized. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating and Detecting the E. lemming ===<br />
[[Image:fullModelKeyboard.jpg|thumb|250px|Screenshot of the <em>Simulation and Detection Model</em> in the keyboard input version.]]Same as the previous example, only that this time not the outputs of the "movement model" block are directly used to determine the position. Instead, the generated image for the visualization is also used as the input for the "cell detection" and the "cell tracking" block. The detected position of the E. lemming is then used for visualization and as an input for the controller. This version requires more sophisticated user inputs. This model is also available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Real-time Tracking and Control of the E. lemming (''in vivo'')===<br />
[[Image:realTimeModel.jpg|thumb|250px|Screenshot of the <em>Real-Time Cell Tracking Model</em> used to connect to the microscope and control the ''in vivo'' E. lemming in real-time.]]The model shows the setup of how the connection to the microscope was established, how the E. lemming was controlled in real-time and forced in the direction the user defined either with the keyboard or with a joystick. This model exists also in a keyboard and in a joystick version, but is not provided for download here for several reasons: First, for the model a supported automatized microscope is needed. Second, additional software has to be installed. Although we could provide this software for download, mistakes in using it can easily damage the microscope and lead to serious financial harm. Nevertheless, if you have an automatized microscope, and you are skilled and authorized, you can contact us by mail ([mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]) and we will provide the models together with the needed software as well as with some security and usage information.<br />
<br clear="all" /><br />
<br />
=== Controller Design Model ===<br />
[[Image:competitionModel.jpg|thumb|250px|Screenshot of the <em> Controller Design Model</em> used in the group internal controller design competition.]]This model represents the model which was used to design and evaluate the different controllers used to force the E. lemming on the user defined direction. For speed reasons, only a simple graphical output is required. Furthermore no user input is needed during the simulation.<br />
* [http://sourceforge.net/projects/ethzigem10/files/Competition.zip/download '''Download the original competition model.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelSquare.zip/download '''Download the model showing how the controller is forcing the E. lemming around a rectangle.''']<br />
<br clear="all" /><br />
<br />
=== E. lemming 2D Game ===<br />
[[Image:gamingJoystick.jpg|thumb|250px|Screenshot of the <em>E. lemming 2D Gaming Model</em> in the joystick input version.]]Here, the user has to directly control the red and far-red light inputs to the "molecular model" block. In a slightly modified graphical visualization he thus has to "hunt" other E. coli cells. When close enough, the user can release photons to eliminate other cells. For more details, see [[Team:ETHZ_Basel/InformationProcessing/Game | here]]. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingKeyboard.zip/download '''Download keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingJoystick.zip/download '''Download joystick version.''']<br />
<br clear="all" /><br />
<br />
== References ==<br />
[1] [http://www.gnu.org/licenses/gpl.txt GNU General Public License, Version 3]<br />
<br />
[2] [http://www.micro-manager.org/ μManager Website]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Achievements/Matlab_ToolboxTeam:ETHZ Basel/Achievements/Matlab Toolbox2010-10-27T18:55:18Z<p>Georgerosenberger: /* Requirements */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Achievements}}<br />
<br />
= Matlab / Simulink Toolbox =<br />
== Background ==<br />
[[Image:lemmingToolbox.jpg|thumb|350px|Screenshot of the Simulink blocks available in the toolbox. Please note that these blocks can be visually assembled with the Simulink blocks of other Toolboxes (e.g. blocks for nearly any mathematical function), and that the algorithms we developed can be accessed directly through Matlab code, too.]]<br />
<br />
During the iGEM competition we developed several fast algorithms (e.g. for cell detection and tracking), complex models, as well as novel visualization, user input and microscope control approaches. Already during their development we took serious efforts to construct all parts in a modular and interchangeable way to deal with the combinatorial diversity of the questions our models as well as the information processing had to answer. Besides the various modules which can easily be reused by people experienced in programming, we also developed a graphical block representation of the various modules based on Simulink. This graphical user interface (GUI) can also be used by people with no or only little programming knowledge to solve complex tasks. These tasks do not have to be necessarily related to our iGEM project, but can e.g. include the simulation of wild type chemotaxis, the detection of various cell types or the transfer of image data between a microscope and Matlab. For the use of anyone interested, we bundled all these Matlab & Simulink files together in the form of an easy to use Matlab Toolbox, which we named the Lemming Toolbox. This Lemming Toolbox was also used extensively during our project and speeded up the ''in silico'' part significantly due to its modular design, which allowed for fast reassembly of program parts to solve urgent last-minute questions.<br />
<br />
Since science is based on the open availability of information and approaches, we decided to give something back to the Systems and Synthetic Biology community by cleaning and documenting the Lemming Toolkit and making it available as Open Source under the GNU General Public License (see [http://www.gnu.org/licenses/gpl.html]). In the following we give a short overview about the abilities and requirements of the software, as well as providing free download possibilities.<br />
Finally we shortly present the various systems (Simulink models) build with the help of the Lemming Toolkit, for which we also provide download possibilities. We hope that the Lemming Toolkit can help other researches as well as future iGEM participants to faster solve their tasks.<br />
<br />
== Features ==<br />
The Lemming toolbox has, amongst others, the following features:<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|light switch], PhyB/PIF3 and ALR.<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|chemotaxis pathway]], based on the published models of Spiro et al. (1997) and Mello & Tu (2003).<br />
* A stochastic model of the [[Team:ETHZ_Basel/Modeling/Movement|movement of E. coli]] generating paths for an ''E. coli'' cell for time varying bias signals.<br />
* Various image sources, e.g. modules loading saved microscope images, generating microscope look-alike images from simulations, or pulling images in real-time from a microscope<sup>(1)</sup>.<br />
* Fast cell detection and tracking algorithms compatible with all image sources.<br />
* Visualization methods for real-time post-processing and displaying microscope images, together with an intuitive representation of the results of upstream modules like cell detection.<br />
* Various user input possibilities, like real-time control of modules with either a joystick or the keyboard.<br />
* Modules enabling the control of a automated microscope with Matlab scripts<sup>(1)</sup>.<br />
* Either accessible to Matlab scripts, realized as a broad set of standardized Matlab functions, or by an...<br />
* Intuitive graphical user interface based on Simulink, which can fully be combined with other Simulink toolboxes.<br />
* Modular and expandable design.<br />
* Open Source under the GNU General Public License.<br />
* Platform independent.<br />
<br />
<small><sup>(1)</sup>This functionality is only usable with one of the various supported microscopes and an installation of &mu;Manager and &mu;PlateImager. A finished version of &mu;PlateImager will be published soon, but a beta version can be obtained for free by writing a request to [mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]. &mu;Manager is a third party open source program available under [http://www.micro-manager.org/|http://www.micro-manager.org/].</small><br />
<br />
== Requirements ==<br />
The following requirements are only necessary to be able to use all features of the Lemming Toolbox. Most modules can still be used even if one or several of the requirements are not fulfilled. In such cases, we recommand to simply download the Toolbox and test the corresponding modules. We tried to make this list comprehensive, however we cannot guarantee that we did not miss one or several requirements. The following requirements we are aware of:<br />
* Matlab R2007b or higher (not tested with lower versions).<br />
* Installed [http://www.mathworks.com/products/image/Image Image Processing Toolbox].<br />
* Installed [http://www.mathworks.com/products/3d-animation/ Simulink 3D Animation] (former named Virtual Reality Toolbox).<br />
* Approximately 24 MB of free disk space.<br />
* When using the joystick input: Joystick with at least three axes and six buttons. Force feedback optional.<br />
* For smooth real-time image analysis we recommend at least a 1GHz processor with 1024 MB RAM.<br />
<br />
== Download ==<br />
The current release of the Matlab / Simulink Toolbox as well as all examples can be downloaded as single files or as all-in-one package from the project page on SourceForge.net. In addition, a [https://sourceforge.net/scm/?type=svn&group_id=337301 '''SVN repository'''] is available with the current development revision.<br />
<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox_Setup.zip/download '''Download the Matlab Toolbox including all models''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox.zip/download '''Download only the Matlab Toolbox''']<br />
<br />
==Implemented models and examples ==<br />
=== Tracking the E. lemming from Saved Images ===<br />
[[Image:imageStreamJoystick.jpg|thumb|250px|Screenshot of the <em>Tracking from Image Stream Model</em> in the joystick input version.]]This example shows how to continuously load saved microscope files from the disk, and to detect and track the cells on them. Furthermore the user can select one cell for which the movement direction is visualized and for which the path is plotted. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating the E. lemming ===<br />
[[Image:modelJoystick.jpg|thumb|250px|Screenshot of the <em>Simulation Model</em> in the joystick input version.]]This model exemplifies how to use the "molecular model" and the "movement model" block to stochastically generate possible paths of the E. lemming based on the light inputs. The user can manually input the light signals either with the joystick or the mouse or activate a controller which forces the E. lemming to a user defined direction. For every time-step a microscope look-alike image is generated and visualized. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating and Detecting the E. lemming ===<br />
[[Image:fullModelKeyboard.jpg|thumb|250px|Screenshot of the <em>Simulation and Detection Model</em> in the keyboard input version.]]Same as the previous example, only that this time not the outputs of the "movement model" block are directly used to determine the position. Instead, the generated image for the visualization is also used as the input for the "cell detection" and the "cell tracking" block. The detected position of the E. lemming is then used for visualization and as an input for the controller. This version requires more sophisticated user inputs. This model is also available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Real-time Tracking and Control of the E. lemming (''in vivo'')===<br />
[[Image:realTimeModel.jpg|thumb|250px|Screenshot of the <em>Real-Time Cell Tracking Model</em> used to connect to the microscope and control the ''in vivo'' E. lemming in real-time.]]The model shows the setup of how the connection to the microscope was established, how the E. lemming was controlled in real-time and forced in the direction the user defined either with the keyboard or with a joystick. This model exists also in a keyboard and in a joystick version, but is not provided for download here for several reasons: First, for the model a supported automatized microscope is needed. Second, additional software has to be installed. Although we could provide this software for download, mistakes in using it can easily damage the microscope and lead to serious financial harm. Nevertheless, if you have an automatized microscope, and you are skilled and authorized, you can contact us by mail ([mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]) and we will provide the models together with the needed software as well as with some security and usage information.<br />
<br clear="all" /><br />
<br />
=== Controller Design Model ===<br />
[[Image:competitionModel.jpg|thumb|250px|Screenshot of the <em> Controller Design Model</em> used in the group internal controller design competition.]]This model represents the model which was used to design and evaluate the different controllers used to force the E. lemming on the user defined direction. For speed reasons, only a simple graphical output is required. Furthermore no user input is needed during the simulation.<br />
* [http://sourceforge.net/projects/ethzigem10/files/Competition.zip/download '''Download the original competition model.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelSquare.zip/download '''Download the model showing how the controller is forcing the E. lemming around a rectangle.''']<br />
<br clear="all" /><br />
<br />
=== E. lemming 2D Game ===<br />
[[Image:gamingJoystick.jpg|thumb|250px|Screenshot of the <em>E. lemming 2D Gaming Model</em> in the joystick input version.]]Here, the user has to directly control the red and far-red light inputs to the "molecular model" block. In a slightly modified graphical visualization he thus has to "hunt" other E. coli cells. When close enough, the user can release photons to eliminate other cells. For more details, see [[Team:ETHZ_Basel/InformationProcessing/Game | here]]. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingKeyboard.zip/download '''Download keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingJoystick.zip/download '''Download joystick version.''']<br />
<br clear="all" /><br />
<br />
== References ==<br />
[1] [http://www.gnu.org/licenses/gpl.txt GNU General Public License, Version 3]<br />
<br />
[2] [http://www.micro-manager.org/ μManager Website]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Achievements/Matlab_ToolboxTeam:ETHZ Basel/Achievements/Matlab Toolbox2010-10-27T18:54:57Z<p>Georgerosenberger: /* Features */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Achievements}}<br />
<br />
= Matlab / Simulink Toolbox =<br />
== Background ==<br />
[[Image:lemmingToolbox.jpg|thumb|350px|Screenshot of the Simulink blocks available in the toolbox. Please note that these blocks can be visually assembled with the Simulink blocks of other Toolboxes (e.g. blocks for nearly any mathematical function), and that the algorithms we developed can be accessed directly through Matlab code, too.]]<br />
<br />
During the iGEM competition we developed several fast algorithms (e.g. for cell detection and tracking), complex models, as well as novel visualization, user input and microscope control approaches. Already during their development we took serious efforts to construct all parts in a modular and interchangeable way to deal with the combinatorial diversity of the questions our models as well as the information processing had to answer. Besides the various modules which can easily be reused by people experienced in programming, we also developed a graphical block representation of the various modules based on Simulink. This graphical user interface (GUI) can also be used by people with no or only little programming knowledge to solve complex tasks. These tasks do not have to be necessarily related to our iGEM project, but can e.g. include the simulation of wild type chemotaxis, the detection of various cell types or the transfer of image data between a microscope and Matlab. For the use of anyone interested, we bundled all these Matlab & Simulink files together in the form of an easy to use Matlab Toolbox, which we named the Lemming Toolbox. This Lemming Toolbox was also used extensively during our project and speeded up the ''in silico'' part significantly due to its modular design, which allowed for fast reassembly of program parts to solve urgent last-minute questions.<br />
<br />
Since science is based on the open availability of information and approaches, we decided to give something back to the Systems and Synthetic Biology community by cleaning and documenting the Lemming Toolkit and making it available as Open Source under the GNU General Public License (see [http://www.gnu.org/licenses/gpl.html]). In the following we give a short overview about the abilities and requirements of the software, as well as providing free download possibilities.<br />
Finally we shortly present the various systems (Simulink models) build with the help of the Lemming Toolkit, for which we also provide download possibilities. We hope that the Lemming Toolkit can help other researches as well as future iGEM participants to faster solve their tasks.<br />
<br />
== Features ==<br />
The Lemming toolbox has, amongst others, the following features:<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|light switch], PhyB/PIF3 and ALR.<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|chemotaxis pathway]], based on the published models of Spiro et al. (1997) and Mello & Tu (2003).<br />
* A stochastic model of the [[Team:ETHZ_Basel/Modeling/Movement|movement of E. coli]] generating paths for an ''E. coli'' cell for time varying bias signals.<br />
* Various image sources, e.g. modules loading saved microscope images, generating microscope look-alike images from simulations, or pulling images in real-time from a microscope<sup>(1)</sup>.<br />
* Fast cell detection and tracking algorithms compatible with all image sources.<br />
* Visualization methods for real-time post-processing and displaying microscope images, together with an intuitive representation of the results of upstream modules like cell detection.<br />
* Various user input possibilities, like real-time control of modules with either a joystick or the keyboard.<br />
* Modules enabling the control of a automated microscope with Matlab scripts<sup>(1)</sup>.<br />
* Either accessible to Matlab scripts, realized as a broad set of standardized Matlab functions, or by an...<br />
* Intuitive graphical user interface based on Simulink, which can fully be combined with other Simulink toolboxes.<br />
* Modular and expandable design.<br />
* Open Source under the GNU General Public License.<br />
* Platform independent.<br />
<br />
<small><sup>(1)</sup>This functionality is only usable with one of the various supported microscopes and an installation of &mu;Manager and &mu;PlateImager. A finished version of &mu;PlateImager will be published soon, but a beta version can be obtained for free by writing a request to [mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]. &mu;Manager is a third party open source program available under [http://www.micro-manager.org/|http://www.micro-manager.org/].</small><br />
<br />
== Requirements ==<br />
The following requirements are only necessary to be able to use all features of the Lemming Toolbox. Most modules can still be used even if one or several of the requirements are not fulfilled. In such cases, we recommand to simply download the Toolbox and test the corresponding modules. We tried to make this list comprehensive, however we cannot guarantee that we did not miss one or several requirements. The following requirements we are aware of:<br />
* Matlab R2007b or higher (not tested with lower versions).<br />
* Installed [http://www.mathworks.com/products/image/Image Image Processing Toolbox].<br />
* Installed [http://www.mathworks.com/products/3d-animation/ Simulink 3D Animation] (former named Virtual Reality Toolbox).<br />
* Actual Windows, Mac OS or Linux operating system.<br />
* Approximately 24 MB of free disk space.<br />
* When using the joystick input: Joystick with at least three axes and six buttons. Force feedback optional.<br />
* For smooth real-time image analysis we recommend at least a 1GHz processor with 1024 MB RAM.<br />
<br />
== Download ==<br />
The current release of the Matlab / Simulink Toolbox as well as all examples can be downloaded as single files or as all-in-one package from the project page on SourceForge.net. In addition, a [https://sourceforge.net/scm/?type=svn&group_id=337301 '''SVN repository'''] is available with the current development revision.<br />
<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox_Setup.zip/download '''Download the Matlab Toolbox including all models''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox.zip/download '''Download only the Matlab Toolbox''']<br />
<br />
==Implemented models and examples ==<br />
=== Tracking the E. lemming from Saved Images ===<br />
[[Image:imageStreamJoystick.jpg|thumb|250px|Screenshot of the <em>Tracking from Image Stream Model</em> in the joystick input version.]]This example shows how to continuously load saved microscope files from the disk, and to detect and track the cells on them. Furthermore the user can select one cell for which the movement direction is visualized and for which the path is plotted. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating the E. lemming ===<br />
[[Image:modelJoystick.jpg|thumb|250px|Screenshot of the <em>Simulation Model</em> in the joystick input version.]]This model exemplifies how to use the "molecular model" and the "movement model" block to stochastically generate possible paths of the E. lemming based on the light inputs. The user can manually input the light signals either with the joystick or the mouse or activate a controller which forces the E. lemming to a user defined direction. For every time-step a microscope look-alike image is generated and visualized. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating and Detecting the E. lemming ===<br />
[[Image:fullModelKeyboard.jpg|thumb|250px|Screenshot of the <em>Simulation and Detection Model</em> in the keyboard input version.]]Same as the previous example, only that this time not the outputs of the "movement model" block are directly used to determine the position. Instead, the generated image for the visualization is also used as the input for the "cell detection" and the "cell tracking" block. The detected position of the E. lemming is then used for visualization and as an input for the controller. This version requires more sophisticated user inputs. This model is also available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Real-time Tracking and Control of the E. lemming (''in vivo'')===<br />
[[Image:realTimeModel.jpg|thumb|250px|Screenshot of the <em>Real-Time Cell Tracking Model</em> used to connect to the microscope and control the ''in vivo'' E. lemming in real-time.]]The model shows the setup of how the connection to the microscope was established, how the E. lemming was controlled in real-time and forced in the direction the user defined either with the keyboard or with a joystick. This model exists also in a keyboard and in a joystick version, but is not provided for download here for several reasons: First, for the model a supported automatized microscope is needed. Second, additional software has to be installed. Although we could provide this software for download, mistakes in using it can easily damage the microscope and lead to serious financial harm. Nevertheless, if you have an automatized microscope, and you are skilled and authorized, you can contact us by mail ([mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]) and we will provide the models together with the needed software as well as with some security and usage information.<br />
<br clear="all" /><br />
<br />
=== Controller Design Model ===<br />
[[Image:competitionModel.jpg|thumb|250px|Screenshot of the <em> Controller Design Model</em> used in the group internal controller design competition.]]This model represents the model which was used to design and evaluate the different controllers used to force the E. lemming on the user defined direction. For speed reasons, only a simple graphical output is required. Furthermore no user input is needed during the simulation.<br />
* [http://sourceforge.net/projects/ethzigem10/files/Competition.zip/download '''Download the original competition model.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelSquare.zip/download '''Download the model showing how the controller is forcing the E. lemming around a rectangle.''']<br />
<br clear="all" /><br />
<br />
=== E. lemming 2D Game ===<br />
[[Image:gamingJoystick.jpg|thumb|250px|Screenshot of the <em>E. lemming 2D Gaming Model</em> in the joystick input version.]]Here, the user has to directly control the red and far-red light inputs to the "molecular model" block. In a slightly modified graphical visualization he thus has to "hunt" other E. coli cells. When close enough, the user can release photons to eliminate other cells. For more details, see [[Team:ETHZ_Basel/InformationProcessing/Game | here]]. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingKeyboard.zip/download '''Download keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingJoystick.zip/download '''Download joystick version.''']<br />
<br clear="all" /><br />
<br />
== References ==<br />
[1] [http://www.gnu.org/licenses/gpl.txt GNU General Public License, Version 3]<br />
<br />
[2] [http://www.micro-manager.org/ μManager Website]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Achievements/Matlab_ToolboxTeam:ETHZ Basel/Achievements/Matlab Toolbox2010-10-27T18:52:44Z<p>Georgerosenberger: /* Background */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Achievements}}<br />
<br />
= Matlab / Simulink Toolbox =<br />
== Background ==<br />
[[Image:lemmingToolbox.jpg|thumb|350px|Screenshot of the Simulink blocks available in the toolbox. Please note that these blocks can be visually assembled with the Simulink blocks of other Toolboxes (e.g. blocks for nearly any mathematical function), and that the algorithms we developed can be accessed directly through Matlab code, too.]]<br />
<br />
During the iGEM competition we developed several fast algorithms (e.g. for cell detection and tracking), complex models, as well as novel visualization, user input and microscope control approaches. Already during their development we took serious efforts to construct all parts in a modular and interchangeable way to deal with the combinatorial diversity of the questions our models as well as the information processing had to answer. Besides the various modules which can easily be reused by people experienced in programming, we also developed a graphical block representation of the various modules based on Simulink. This graphical user interface (GUI) can also be used by people with no or only little programming knowledge to solve complex tasks. These tasks do not have to be necessarily related to our iGEM project, but can e.g. include the simulation of wild type chemotaxis, the detection of various cell types or the transfer of image data between a microscope and Matlab. For the use of anyone interested, we bundled all these Matlab & Simulink files together in the form of an easy to use Matlab Toolbox, which we named the Lemming Toolbox. This Lemming Toolbox was also used extensively during our project and speeded up the ''in silico'' part significantly due to its modular design, which allowed for fast reassembly of program parts to solve urgent last-minute questions.<br />
<br />
Since science is based on the open availability of information and approaches, we decided to give something back to the Systems and Synthetic Biology community by cleaning and documenting the Lemming Toolkit and making it available as Open Source under the GNU General Public License (see [http://www.gnu.org/licenses/gpl.html]). In the following we give a short overview about the abilities and requirements of the software, as well as providing free download possibilities.<br />
Finally we shortly present the various systems (Simulink models) build with the help of the Lemming Toolkit, for which we also provide download possibilities. We hope that the Lemming Toolkit can help other researches as well as future iGEM participants to faster solve their tasks.<br />
<br />
== Features ==<br />
The Lemming toolbox has, amongst others, the following features:<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|chemotaxis pathway]], based on the published models of Spiro et al. (1997) and Mello & Tu (2003).<br />
* A stochastic model of the [[Team:ETHZ_Basel/Modeling/Movement|movement of E. coli]] generating paths for an E. coli cell for time varying bias signals.<br />
* Various image sources, e.g. modules loading saved microscope images, generating microscope look-alike images from simulations, or pulling images in real-time from a microscope<sup>(1)</sup>.<br />
* Fast cell detection and tracking algorithms compatible with all image sources.<br />
* Visualization methods for real-time post-processing and displaying microscope images, together with an intuitive representation of the results of upstream modules like cell detection.<br />
* Various user input possibilities, like real-time control of modules with either a joystick or the keyboard.<br />
* Modules enabling the control of a automated microscope with Matlab scripts<sup>(1)</sup>.<br />
* Either accessible to Matlab scripts, realized as a broad set of standardized Matlab functions, or by an...<br />
* Intuitive graphical user interface based on Simulink, which can fully be combined with other Simulink toolboxes.<br />
* Modular and expandable design.<br />
* Open Source under the GNU General Public License.<br />
* Platform independent.<br />
<br />
<small><sup>(1)</sup>This functionality is only usable with one of the various supported microscopes and an installation of &mu;Manager and &mu;PlateImager. A finished version of &mu;PlateImager will be published soon, but a beta version can be obtained for free by writing a request to [mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]. &mu;Manager is a third party open source program available under [http://www.micro-manager.org/|http://www.micro-manager.org/].</small><br />
<br />
== Requirements ==<br />
The following requirements are only necessary to be able to use all features of the Lemming Toolbox. Most modules can still be used even if one or several of the requirements are not fulfilled. In such cases, we recommand to simply download the Toolbox and test the corresponding modules. We tried to make this list comprehensive, however we cannot guarantee that we did not miss one or several requirements. The following requirements we are aware of:<br />
* Matlab R2007b or higher (not tested with lower versions).<br />
* Installed [http://www.mathworks.com/products/image/Image Image Processing Toolbox].<br />
* Installed [http://www.mathworks.com/products/3d-animation/ Simulink 3D Animation] (former named Virtual Reality Toolbox).<br />
* Actual Windows, Mac OS or Linux operating system.<br />
* Approximately 24 MB of free disk space.<br />
* When using the joystick input: Joystick with at least three axes and six buttons. Force feedback optional.<br />
* For smooth real-time image analysis we recommend at least a 1GHz processor with 1024 MB RAM.<br />
<br />
== Download ==<br />
The current release of the Matlab / Simulink Toolbox as well as all examples can be downloaded as single files or as all-in-one package from the project page on SourceForge.net. In addition, a [https://sourceforge.net/scm/?type=svn&group_id=337301 '''SVN repository'''] is available with the current development revision.<br />
<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox_Setup.zip/download '''Download the Matlab Toolbox including all models''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox.zip/download '''Download only the Matlab Toolbox''']<br />
<br />
==Implemented models and examples ==<br />
=== Tracking the E. lemming from Saved Images ===<br />
[[Image:imageStreamJoystick.jpg|thumb|250px|Screenshot of the <em>Tracking from Image Stream Model</em> in the joystick input version.]]This example shows how to continuously load saved microscope files from the disk, and to detect and track the cells on them. Furthermore the user can select one cell for which the movement direction is visualized and for which the path is plotted. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating the E. lemming ===<br />
[[Image:modelJoystick.jpg|thumb|250px|Screenshot of the <em>Simulation Model</em> in the joystick input version.]]This model exemplifies how to use the "molecular model" and the "movement model" block to stochastically generate possible paths of the E. lemming based on the light inputs. The user can manually input the light signals either with the joystick or the mouse or activate a controller which forces the E. lemming to a user defined direction. For every time-step a microscope look-alike image is generated and visualized. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating and Detecting the E. lemming ===<br />
[[Image:fullModelKeyboard.jpg|thumb|250px|Screenshot of the <em>Simulation and Detection Model</em> in the keyboard input version.]]Same as the previous example, only that this time not the outputs of the "movement model" block are directly used to determine the position. Instead, the generated image for the visualization is also used as the input for the "cell detection" and the "cell tracking" block. The detected position of the E. lemming is then used for visualization and as an input for the controller. This version requires more sophisticated user inputs. This model is also available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Real-time Tracking and Control of the E. lemming (''in vivo'')===<br />
[[Image:realTimeModel.jpg|thumb|250px|Screenshot of the <em>Real-Time Cell Tracking Model</em> used to connect to the microscope and control the ''in vivo'' E. lemming in real-time.]]The model shows the setup of how the connection to the microscope was established, how the E. lemming was controlled in real-time and forced in the direction the user defined either with the keyboard or with a joystick. This model exists also in a keyboard and in a joystick version, but is not provided for download here for several reasons: First, for the model a supported automatized microscope is needed. Second, additional software has to be installed. Although we could provide this software for download, mistakes in using it can easily damage the microscope and lead to serious financial harm. Nevertheless, if you have an automatized microscope, and you are skilled and authorized, you can contact us by mail ([mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]) and we will provide the models together with the needed software as well as with some security and usage information.<br />
<br clear="all" /><br />
<br />
=== Controller Design Model ===<br />
[[Image:competitionModel.jpg|thumb|250px|Screenshot of the <em> Controller Design Model</em> used in the group internal controller design competition.]]This model represents the model which was used to design and evaluate the different controllers used to force the E. lemming on the user defined direction. For speed reasons, only a simple graphical output is required. Furthermore no user input is needed during the simulation.<br />
* [http://sourceforge.net/projects/ethzigem10/files/Competition.zip/download '''Download the original competition model.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelSquare.zip/download '''Download the model showing how the controller is forcing the E. lemming around a rectangle.''']<br />
<br clear="all" /><br />
<br />
=== E. lemming 2D Game ===<br />
[[Image:gamingJoystick.jpg|thumb|250px|Screenshot of the <em>E. lemming 2D Gaming Model</em> in the joystick input version.]]Here, the user has to directly control the red and far-red light inputs to the "molecular model" block. In a slightly modified graphical visualization he thus has to "hunt" other E. coli cells. When close enough, the user can release photons to eliminate other cells. For more details, see [[Team:ETHZ_Basel/InformationProcessing/Game | here]]. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingKeyboard.zip/download '''Download keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingJoystick.zip/download '''Download joystick version.''']<br />
<br clear="all" /><br />
<br />
== References ==<br />
[1] [http://www.gnu.org/licenses/gpl.txt GNU General Public License, Version 3]<br />
<br />
[2] [http://www.micro-manager.org/ μManager Website]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Achievements/Matlab_ToolboxTeam:ETHZ Basel/Achievements/Matlab Toolbox2010-10-27T18:49:49Z<p>Georgerosenberger: /* Background */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Achievements}}<br />
<br />
= Matlab / Simulink Toolbox =<br />
== Background ==<br />
[[Image:lemmingToolbox.jpg|thumb|350px|Screenshot of the Simulink blocks available in the toolbox. Please note that these blocks can be visually assembled with the Simulink blocks of other Toolboxes (e.g. blocks for nearly any mathematical function), and that the algorithms we developed can be accessed directly through Matlab code, too.]]<br />
<br />
During the iGEM competition we developed several fast algorithms (e.g. for cell detection and tracking), complex models, as well as novel visualization, user input and microscope control approaches. Already during their development we took serious efforts to construct all parts in a modular and interchangeable way to deal with the combinatorial diversity of the questions our models as well as the information processing had to answer. Besides the various modules which can easily be reused by people experienced in programming, we also developed a graphical block representation of the various modules based on Simulink. This graphical user interface (GUI) can also be used by people with no or only little programming knowledge to solve complex tasks. These tasks do not have to be necessarily related to our iGEM project, but can e.g. include the simulation of wild type chemotaxis, the detection of various cell types or the transfer of image data between a microscope and Matlab. For the use of anyone interested, we bundled all these Matlab & Simulink files together in the form of an easy to use Matlab Toolbox, which we named the Lemming Toolbox. This Lemming Toolbox was also used extensively during our project and speeded up the ''in silico'' part significantly due to its modular design, which allowed for fast reassembly of program parts to solve urgent last-minute questions.<br />
<br />
Since science is based on the open availability of information and approaches, we decided to give something back to the Systems and Synthetic Biology community by cleaning and documenting the Lemming Toolkit and making it available as Open Source under the GNU General Public License (see [http://www.gnu.org/licenses/gpl.html]). In the following we give a short overview about the abilities and requirements of the software, as well as providing free download possibilities.<br />
Finally we shortly present the various systems (Simulink models) build with the help of the Lemming Toolkit, for which we also provide download possibilities. We hope that the Lemming Toolkit can help other researches as well as future iGem participants to faster solve their tasks.<br />
<br />
== Features ==<br />
The Lemming toolbox has, amongst others, the following features:<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|chemotaxis pathway]], based on the published models of Spiro et al. (1997) and Mello & Tu (2003).<br />
* A stochastic model of the [[Team:ETHZ_Basel/Modeling/Movement|movement of E. coli]] generating paths for an E. coli cell for time varying bias signals.<br />
* Various image sources, e.g. modules loading saved microscope images, generating microscope look-alike images from simulations, or pulling images in real-time from a microscope<sup>(1)</sup>.<br />
* Fast cell detection and tracking algorithms compatible with all image sources.<br />
* Visualization methods for real-time post-processing and displaying microscope images, together with an intuitive representation of the results of upstream modules like cell detection.<br />
* Various user input possibilities, like real-time control of modules with either a joystick or the keyboard.<br />
* Modules enabling the control of a automated microscope with Matlab scripts<sup>(1)</sup>.<br />
* Either accessible to Matlab scripts, realized as a broad set of standardized Matlab functions, or by an...<br />
* Intuitive graphical user interface based on Simulink, which can fully be combined with other Simulink toolboxes.<br />
* Modular and expandable design.<br />
* Open Source under the GNU General Public License.<br />
* Platform independent.<br />
<br />
<small><sup>(1)</sup>This functionality is only usable with one of the various supported microscopes and an installation of &mu;Manager and &mu;PlateImager. A finished version of &mu;PlateImager will be published soon, but a beta version can be obtained for free by writing a request to [mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]. &mu;Manager is a third party open source program available under [http://www.micro-manager.org/|http://www.micro-manager.org/].</small><br />
<br />
== Requirements ==<br />
The following requirements are only necessary to be able to use all features of the Lemming Toolbox. Most modules can still be used even if one or several of the requirements are not fulfilled. In such cases, we recommand to simply download the Toolbox and test the corresponding modules. We tried to make this list comprehensive, however we cannot guarantee that we did not miss one or several requirements. The following requirements we are aware of:<br />
* Matlab R2007b or higher (not tested with lower versions).<br />
* Installed [http://www.mathworks.com/products/image/Image Image Processing Toolbox].<br />
* Installed [http://www.mathworks.com/products/3d-animation/ Simulink 3D Animation] (former named Virtual Reality Toolbox).<br />
* Actual Windows, Mac OS or Linux operating system.<br />
* Approximately 24 MB of free disk space.<br />
* When using the joystick input: Joystick with at least three axes and six buttons. Force feedback optional.<br />
* For smooth real-time image analysis we recommend at least a 1GHz processor with 1024 MB RAM.<br />
<br />
== Download ==<br />
The current release of the Matlab / Simulink Toolbox as well as all examples can be downloaded as single files or as all-in-one package from the project page on SourceForge.net. In addition, a [https://sourceforge.net/scm/?type=svn&group_id=337301 '''SVN repository'''] is available with the current development revision.<br />
<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox_Setup.zip/download '''Download the Matlab Toolbox including all models''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox.zip/download '''Download only the Matlab Toolbox''']<br />
<br />
==Implemented models and examples ==<br />
=== Tracking the E. lemming from Saved Images ===<br />
[[Image:imageStreamJoystick.jpg|thumb|250px|Screenshot of the <em>Tracking from Image Stream Model</em> in the joystick input version.]]This example shows how to continuously load saved microscope files from the disk, and to detect and track the cells on them. Furthermore the user can select one cell for which the movement direction is visualized and for which the path is plotted. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating the E. lemming ===<br />
[[Image:modelJoystick.jpg|thumb|250px|Screenshot of the <em>Simulation Model</em> in the joystick input version.]]This model exemplifies how to use the "molecular model" and the "movement model" block to stochastically generate possible paths of the E. lemming based on the light inputs. The user can manually input the light signals either with the joystick or the mouse or activate a controller which forces the E. lemming to a user defined direction. For every time-step a microscope look-alike image is generated and visualized. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating and Detecting the E. lemming ===<br />
[[Image:fullModelKeyboard.jpg|thumb|250px|Screenshot of the <em>Simulation and Detection Model</em> in the keyboard input version.]]Same as the previous example, only that this time not the outputs of the "movement model" block are directly used to determine the position. Instead, the generated image for the visualization is also used as the input for the "cell detection" and the "cell tracking" block. The detected position of the E. lemming is then used for visualization and as an input for the controller. This version requires more sophisticated user inputs. This model is also available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Real-time Tracking and Control of the E. lemming (''in vivo'')===<br />
[[Image:realTimeModel.jpg|thumb|250px|Screenshot of the <em>Real-Time Cell Tracking Model</em> used to connect to the microscope and control the ''in vivo'' E. lemming in real-time.]]The model shows the setup of how the connection to the microscope was established, how the E. lemming was controlled in real-time and forced in the direction the user defined either with the keyboard or with a joystick. This model exists also in a keyboard and in a joystick version, but is not provided for download here for several reasons: First, for the model a supported automatized microscope is needed. Second, additional software has to be installed. Although we could provide this software for download, mistakes in using it can easily damage the microscope and lead to serious financial harm. Nevertheless, if you have an automatized microscope, and you are skilled and authorized, you can contact us by mail ([mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]) and we will provide the models together with the needed software as well as with some security and usage information.<br />
<br clear="all" /><br />
<br />
=== Controller Design Model ===<br />
[[Image:competitionModel.jpg|thumb|250px|Screenshot of the <em> Controller Design Model</em> used in the group internal controller design competition.]]This model represents the model which was used to design and evaluate the different controllers used to force the E. lemming on the user defined direction. For speed reasons, only a simple graphical output is required. Furthermore no user input is needed during the simulation.<br />
* [http://sourceforge.net/projects/ethzigem10/files/Competition.zip/download '''Download the original competition model.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelSquare.zip/download '''Download the model showing how the controller is forcing the E. lemming around a rectangle.''']<br />
<br clear="all" /><br />
<br />
=== E. lemming 2D Game ===<br />
[[Image:gamingJoystick.jpg|thumb|250px|Screenshot of the <em>E. lemming 2D Gaming Model</em> in the joystick input version.]]Here, the user has to directly control the red and far-red light inputs to the "molecular model" block. In a slightly modified graphical visualization he thus has to "hunt" other E. coli cells. When close enough, the user can release photons to eliminate other cells. For more details, see [[Team:ETHZ_Basel/InformationProcessing/Game | here]]. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingKeyboard.zip/download '''Download keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingJoystick.zip/download '''Download joystick version.''']<br />
<br clear="all" /><br />
<br />
== References ==<br />
[1] [http://www.gnu.org/licenses/gpl.txt GNU General Public License, Version 3]<br />
<br />
[2] [http://www.micro-manager.org/ μManager Website]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/TeamTeam:ETHZ Basel/Team2010-10-27T18:39:37Z<p>Georgerosenberger: /* Contact */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Team}}<br />
<br />
= Team =<br />
{| border="0" align="center"<br />
|[[Image:ETHZTeam1.jpg|thumb|center|800px|'''ETH Zurich iGEM Team 2010''']]<br />
|}<br />
<br />
= Students =<br />
{| border="0"<br />
|- valign="top"<br />
| width="210pt" |[[Image:Thanuja_lab2.png|thumb|180px|left]]<br />
| width="250pt" |'''Thanuja Ambegoda'''<br>Thanuja is currently a master's student in Computational Biology & Bioinformatics. Prior to this, he graduated from Electronics & Telecommunications Engineering. He's part of the modeling subgroup for this year's team for iGEM, from ETH Zurich.<br />
| width="210pt" |[[Image:Sonja.JPG|thumb|180px|left]]<br />
| width="250pt" |'''Sonja Billerbeck'''<br>Sonja is a Phd-student in the Bioprocess Lab at D-BSSE and realizes her thesis in the area of synthetic biology. She studied Biology at the University of Tübingen (Germany).<br />
|- valign="top"<br />
|[[Image:Simona1.jpg|thumb|180px|left]]<br />
|'''Simona Constantinescu'''<br>Simona's background in Mathematics encouraged her to believe that analyzing and implementing rational designs of synthetic organisms is something worth spending the 2010 summer on, as part of the modeling group of ETH's iGEM Team. She is currently a master student in Computational Biology and Bioinformatics, at ETH Zurich.<br />
|[[Image:moritz.jpg|thumb|180px|left]]<br />
|'''Moritz Lang'''<br>Moritz is a Phd student in the [http://www.csb.ethz.ch/ Computational Systems Biology] group of the [http://www.bsse.ethz.ch/ D-BSSE] ([http://www.ethz.ch/ ETH Z&uuml;rich]). He is writing his thesis about the identification of biomolecular systems. Moritz obtained his diploma in [http://www.techkyb.de/ Technical Cybernetics] at the [http://www.uni-stuttgart.de/index.en.html University of Stuttgart] (Germany). He is part of the modeling subgroup and takes care of the [[Team:ETHZ Basel/ImagingPipeline|microscope coupling]] and parts of the modeling.<br />
|- valign="top"<br />
|[[Image:Luzi.JPG|thumb|180px|left]]<br />
|'''Luzius Pestalozzi'''<br>Luzius is a Biotechnology bachelor student in the sixth semester. As he has studied biology in his first two years at the ETH Zurich he is a member of the wet lab subteam involved in implementing the newly engineered "E. lemming" chemotactic pathway into "Escherichia coli".<br />
|[[Image:George.JPG|180px|thumb|left]]<br />
|'''George Rosenberger'''<br>George is a student of MSc Biotechnology at ETH Zurich in third semester. During his BSc Biology (chemical orientation) / Biotechnology studies, he got in touch with synthetic biology and wanted to join the ETH Zurich iGEM Team. He's in the modeling subteam and his job is to design and maintain the wiki.<br />
|- valign="top"<br />
|[[Image:Elsa.JPG|thumb|180px|left]]<br />
|'''Elsa Sotiriadis'''<br>Elsa is a Msc Biotechnology student with Business and Marketing background. She studied Biochemistry at [http://www.ethz.ch/: ETH Zurich] and Biology at the [http://www.biozentrum.unibas.ch/: Biozentrum Basel] ([http://www.unibas.ch/: University of Basel]). She's part of the ETHZ/[http://www.bsse.ethz.ch/: BSSE] wetlab team and is responsible for the group's poster for the Jamboree.<br />
|[[Image:Katharina.JPG|180px|thumb|left]]<br />
|'''Katharina Zwicky'''<br>Katharina is a Biotechnology master student at the D-BSSE in Basel in her second semester. Due to her Biology background, she is part of the ETHZ iGEM wetlab team. Go cloning!<br />
|}<br />
<br />
= Instructors =<br />
{| border="0"<br />
|- valign="top"<br />
| width="210pt" |[[Image:ETHZ_Basel_SPanke.jpg|thumb|180px|left]]<br />
| width="250pt" |'''Sven Panke'''<br><br />
Sven has been a supervisor for the ETH Zurich iGEM team since they first competed in 2005. He is an Associate Professor for Bioprocess Engineering. His research focuses on the development of highly efficient biocatalysts for novel bioprocesses for the chemical and pharmaceutical industry.<br />
<br />
| width="210pt" |[[Image:ETHZ_Basel_JStelling.jpg|thumb|180px|left]]<br />
| width="250pt" |'''Jörg Stelling'''<br><br />
Jörg is an Assistant Professor for Bioinformatics at ETH Zurich. His current research interests are focused on the analysis and synthesis of biological networks using methods from systems theory and computer science. He has been a supervisor for the ETH Zurich iGEM team since their first participation in the competition in 2005.<br />
<br />
<br />
|}<br />
<br />
= Advisors =<br />
{| border="0"<br />
|- valign="top"<br />
| width="210pt" |[[Image:Christoph.JPG|thumb|180px|left]]<br />
| width="250pt" |'''Christoph Hold'''<br>Being an engineer by training, Christoph once specialized in biochemical engineering before moving on to systems biology. He's currently working on his PhD in Sven Panke's synthetic biology lab and therefore interested in modeling, design of experiment and parameter estimation. May MATLAB be with him!<br />
|- valign="top"<br />
| width="210pt" |[[Image:ETHZ_Basel_MMarchisio.jpg|thumb|180px|left]]<br />
| width="250pt" |'''Mario Marchisio'''<br> Mario studied physics before moving to computational synthetic biology. He is currently Post Doc in Jörg Stelling's group. <br />
| width="210pt" |[[Image:ETHZ_Basel_VRouilly.jpg|thumb|180px|left]]<br />
| width="250pt" |'''Vincent Rouilly'''<br>Trained as a Bioengineer, Vincent's interests lie in bringing closer computational biology and the wet lab work, with the idea of getting better at characterizing Synthetic Biology systems. He seems to be quite addicted to iGEM as this is his 5th participation as an advisor. Vincent currently works at the Biozentrum (University of Basel) on a High Content Screening processing pipeline. <br />
|}<br />
<br />
= Contact =<br />
You can contact us by email at: [[Image:ETHZ_Basel_mail.png|157px|]] or contact<br />
<br />
ETH Zürich<br />
Prof. Dr. Sven Panke<br />
Bioprocess Laboratory D-BSSE<br />
1058 7.40<br />
Mattenstrasse 26<br />
4058 Basel<br />
Phone: +41 61 387 32 09</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Introduction/MediaTeam:ETHZ Basel/Introduction/Media2010-10-27T18:39:01Z<p>Georgerosenberger: /* Contact */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Introduction}}<br />
<br />
= Media =<br />
<br />
<br />
== Media coverage ==<br />
In October, Biotechniques contacted us for an interview about our project E. lemming. They showed particular interest in our motivation to participate in the iGEM competition as well as in project development and team collaborations. <br />
<br />
Read more about our experiences during the iGEM 2010 period on:<br />
* [http://biotechniques.com/news/iGEM-competitors-gear-up-for-2010-challenge/biotechniques-304538.html BioTechniques - iGEM competitors gear up for 2010 challenge]<br />
<br />
== Media resources ==<br />
*[http://www.youtube.com/watch?v=JQZZ7gT8Tjk E. lemming - The Movie on YouTube]<br />
*[http://www.youtube.com/watch?v=mulRvAVExSc&hd=1 E. lemming - (The Lemming) on YouTube]<br />
*[http://www.youtube.com/watch?v=1o4RzI-vwAw&hd=1 E. lemming - (The Lemming's Brother) on YouTube]<br />
<br />
== Contact ==<br />
You can contact us by email at: [[Image:ETHZ_Basel_mail.png|157px|]] or contact<br />
<br />
ETH Zürich<br />
Prof. Dr. Sven Panke<br />
Bioprocess Laboratory D-BSSE<br />
1058 7.40<br />
Mattenstrasse 26<br />
4058 Basel<br />
Phone: +41 61 387 32 09</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Introduction/MediaTeam:ETHZ Basel/Introduction/Media2010-10-27T18:38:13Z<p>Georgerosenberger: /* Contact */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Introduction}}<br />
<br />
= Media =<br />
<br />
<br />
== Media coverage ==<br />
In October, Biotechniques contacted us for an interview about our project E. lemming. They showed particular interest in our motivation to participate in the iGEM competition as well as in project development and team collaborations. <br />
<br />
Read more about our experiences during the iGEM 2010 period on:<br />
* [http://biotechniques.com/news/iGEM-competitors-gear-up-for-2010-challenge/biotechniques-304538.html BioTechniques - iGEM competitors gear up for 2010 challenge]<br />
<br />
== Media resources ==<br />
*[http://www.youtube.com/watch?v=JQZZ7gT8Tjk E. lemming - The Movie on YouTube]<br />
*[http://www.youtube.com/watch?v=mulRvAVExSc&hd=1 E. lemming - (The Lemming) on YouTube]<br />
*[http://www.youtube.com/watch?v=1o4RzI-vwAw&hd=1 E. lemming - (The Lemming's Brother) on YouTube]<br />
<br />
== Contact ==<br />
You can contact us by email at: [[Image:ETHZ_Basel_mail.png|157px|]] or contact<br />
<br />
ETH Zürich<br />
<br />
Prof. Dr. Sven Panke<br />
<br />
Bioprocess Laboratory D-BSSE<br />
<br />
1058 7.40<br />
<br />
Mattenstrasse 26<br />
<br />
4058 Basel<br />
<br />
Phone: +41 61 387 32 09</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Introduction/MediaTeam:ETHZ Basel/Introduction/Media2010-10-27T18:37:55Z<p>Georgerosenberger: /* Contact */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Introduction}}<br />
<br />
= Media =<br />
<br />
<br />
== Media coverage ==<br />
In October, Biotechniques contacted us for an interview about our project E. lemming. They showed particular interest in our motivation to participate in the iGEM competition as well as in project development and team collaborations. <br />
<br />
Read more about our experiences during the iGEM 2010 period on:<br />
* [http://biotechniques.com/news/iGEM-competitors-gear-up-for-2010-challenge/biotechniques-304538.html BioTechniques - iGEM competitors gear up for 2010 challenge]<br />
<br />
== Media resources ==<br />
*[http://www.youtube.com/watch?v=JQZZ7gT8Tjk E. lemming - The Movie on YouTube]<br />
*[http://www.youtube.com/watch?v=mulRvAVExSc&hd=1 E. lemming - (The Lemming) on YouTube]<br />
*[http://www.youtube.com/watch?v=1o4RzI-vwAw&hd=1 E. lemming - (The Lemming's Brother) on YouTube]<br />
<br />
== Contact ==<br />
You can contact us by email at: [[Image:ETHZ_Basel_mail.png|157px|]] or contact<br />
<br />
ETH Zürich<br />
Prof. Dr. Sven Panke<br />
Bioprocess Laboratory D-BSSE<br />
1058 7.40<br />
Mattenstrasse 26<br />
4058 Basel<br />
Phone: +41 61 387 32 09</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Achievements/Matlab_ToolboxTeam:ETHZ Basel/Achievements/Matlab Toolbox2010-10-27T18:32:00Z<p>Georgerosenberger: /* Examples */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Achievements}}<br />
<br />
= Matlab / Simulink Toolbox =<br />
== Background ==<br />
[[Image:lemmingToolbox.jpg|thumb|350px|Screenshot of the Simulink blocks available in the toolbox. Please note that these blocks can be visually assembled with the Simulink blocks of other Toolboxes (e.g. blocks for nearly any mathematical function), and that the algorithms we developed can be accessed directly through Matlab code, too.]]During the iGem competition we developed several fast algorithms (e.g. for cell detection and tracking), complex models, as well as novel visualization, user input and microscope control approaches. Already during their development we took serious efforts to construct all parts in a modular and interchangeable way to deal with the combinatorial diversity of the questions our models as well as the information processing had to answer. Besides the various modules which can easily be reused by people experienced in programming, we also developed a graphical block representation of the various modules based on Simulink. This graphical user interface (GUI) can also be used by people with no or only little programming knowledge to solve complex tasks. These tasks do not have to be necessarily related to our iGem project, but can e.g. include the simulation of wild type chemotaxis, the detection of various cell types or the transfer of image data between a microscope and Matlab. For the use of anyone interested, we bundled all these Matlab & Simulink files together in the form of an easy to use Matlab Toolbox, which we named the Lemming Toolbox. This Lemming Toolbox was also used extensively during our project and speeded up the in-silico part significantly due to its modular design, which allowed for fast reassembly of program parts to solve urgent last-minute questions.<br />
<br />
Since science is based on the open availability of information and approaches, we decided to give something back to the Systems and Synthetic Biology community by cleaning and documenting the Lemming Toolkit and making it available as Open Source under the GNU General Public License (see [http://www.gnu.org/licenses/gpl.html]). In the following we give a short overview about the abilities and requirements of the software, as well as providing free download possibilities.<br />
Finally we shortly present the various systems (Simulink models) build with the help of the Lemming Toolkit, for which we also provide download possibilities. We hope that the Lemming Toolkit can help other researches as well as future iGem participants to faster solve their tasks.<br />
<br />
== Features ==<br />
The Lemming toolbox has, amongst others, the following features:<br />
* Two molecular ODE models of the [[Team:ETHZ_Basel/Modeling/Chemotaxis|chemotaxis pathway]], based on the published models of Spiro et al. (1997) and Mello & Tu (2003).<br />
* A stochastic model of the [[Team:ETHZ_Basel/Modeling/Movement|movement of E. coli]] generating paths for an E. coli cell for time varying bias signals.<br />
* Various image sources, e.g. modules loading saved microscope images, generating microscope look-alike images from simulations, or pulling images in real-time from a microscope<sup>(1)</sup>.<br />
* Fast cell detection and tracking algorithms compatible with all image sources.<br />
* Visualization methods for real-time post-processing and displaying microscope images, together with an intuitive representation of the results of upstream modules like cell detection.<br />
* Various user input possibilities, like real-time control of modules with either a joystick or the keyboard.<br />
* Modules enabling the control of a automated microscope with Matlab scripts<sup>(1)</sup>.<br />
* Either accessible to Matlab scripts, realized as a broad set of standardized Matlab functions, or by an...<br />
* Intuitive graphical user interface based on Simulink, which can fully be combined with other Simulink toolboxes.<br />
* Modular and expandable design.<br />
* Open Source under the GNU General Public License.<br />
* Platform independent.<br />
<br />
<small><sup>(1)</sup>This functionality is only usable with one of the various supported microscopes and an installation of &mu;Manager and &mu;PlateImager. A finished version of &mu;PlateImager will be published soon, but a beta version can be obtained for free by writing a request to [mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]. &mu;Manager is a third party open source program available under [http://www.micro-manager.org/|http://www.micro-manager.org/].</small><br />
<br />
== Requirements ==<br />
The following requirements are only necessary to be able to use all features of the Lemming Toolbox. Most modules can still be used even if one or several of the requirements are not fulfilled. In such cases, we recommand to simply download the Toolbox and test the corresponding modules. We tried to make this list comprehensive, however we cannot guarantee that we did not miss one or several requirements. The following requirements we are aware of:<br />
* Matlab R2007b or higher (not tested with lower versions).<br />
* Installed [http://www.mathworks.com/products/image/Image Image Processing Toolbox].<br />
* Installed [http://www.mathworks.com/products/3d-animation/ Simulink 3D Animation] (former named Virtual Reality Toolbox).<br />
* Actual Windows, Mac OS or Linux operating system.<br />
* Approximately 24 MB of free disk space.<br />
* When using the joystick input: Joystick with at least three axes and six buttons. Force feedback optional.<br />
* For smooth real-time image analysis we recommend at least a 1GHz processor with 1024 MB RAM.<br />
<br />
== Download ==<br />
The current release of the Matlab / Simulink Toolbox as well as all examples can be downloaded as single files or as all-in-one package from the project page on SourceForge.net. In addition, a [https://sourceforge.net/scm/?type=svn&group_id=337301 '''SVN repository'''] is available with the current development revision.<br />
<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox_Setup.zip/download '''Download the Matlab Toolbox including all models''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/LemmingToolbox.zip/download '''Download only the Matlab Toolbox''']<br />
<br />
==Implemented models and examples ==<br />
=== Tracking the E. lemming from Saved Images ===<br />
[[Image:imageStreamJoystick.jpg|thumb|250px|Screenshot of the <em>Tracking from Image Stream Model</em> in the joystick input version.]]This example shows how to continuously load saved microscope files from the disk, and to detect and track the cells on them. Furthermore the user can select one cell for which the movement direction is visualized and for which the path is plotted. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/imageStreamJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating the E. lemming ===<br />
[[Image:modelJoystick.jpg|thumb|250px|Screenshot of the <em>Simulation Model</em> in the joystick input version.]]This model exemplifies how to use the "molecular model" and the "movement model" block to stochastically generate possible paths of the E. lemming based on the light inputs. The user can manually input the light signals either with the joystick or the mouse or activate a controller which forces the E. lemming to a user defined direction. For every time-step a microscope look-alike image is generated and visualized. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Simulating and Detecting the E. lemming ===<br />
[[Image:fullModelKeyboard.jpg|thumb|250px|Screenshot of the <em>Simulation and Detection Model</em> in the keyboard input version.]]Same as the previous example, only that this time not the outputs of the "movement model" block are directly used to determine the position. Instead, the generated image for the visualization is also used as the input for the "cell detection" and the "cell tracking" block. The detected position of the E. lemming is then used for visualization and as an input for the controller. This version requires more sophisticated user inputs. This model is also available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelKeyboard.zip/download '''Download the keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/fullModelJoystick.zip/download '''Download the joystick version.''']<br />
<br clear="all" /><br />
<br />
=== Real-time Tracking and Control of the E. lemming (''in vivo'')===<br />
[[Image:realTimeModel.jpg|thumb|250px|Screenshot of the <em>Real-Time Cell Tracking Model</em> used to connect to the microscope and control the ''in vivo'' E. lemming in real-time.]]The model shows the setup of how the connection to the microscope was established, how the E. lemming was controlled in real-time and forced in the direction the user defined either with the keyboard or with a joystick. This model exists also in a keyboard and in a joystick version, but is not provided for download here for several reasons: First, for the model a supported automatized microscope is needed. Second, additional software has to be installed. Although we could provide this software for download, mistakes in using it can easily damage the microscope and lead to serious financial harm. Nevertheless, if you have an automatized microscope, and you are skilled and authorized, you can contact us by mail ([mailto:moritz.lang@bsse.ethz.ch moritz.lang@bsse.ethz.ch]) and we will provide the models together with the needed software as well as with some security and usage information.<br />
<br clear="all" /><br />
<br />
=== Controller Design Model ===<br />
[[Image:competitionModel.jpg|thumb|250px|Screenshot of the <em> Controller Design Model</em> used in the group internal controller design competition.]]This model represents the model which was used to design and evaluate the different controllers used to force the E. lemming on the user defined direction. For speed reasons, only a simple graphical output is required. Furthermore no user input is needed during the simulation.<br />
* [http://sourceforge.net/projects/ethzigem10/files/Competition.zip/download '''Download the original competition model.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/modelSquare.zip/download '''Download the model showing how the controller is forcing the E. lemming around a rectangle.''']<br />
<br clear="all" /><br />
<br />
=== E. lemming 2D Game ===<br />
[[Image:gamingJoystick.jpg|thumb|250px|Screenshot of the <em>E. lemming 2D Gaming Model</em> in the joystick input version.]]Here, the user has to directly control the red and far-red light inputs to the "molecular model" block. In a slightly modified graphical visualization he thus has to "hunt" other E. coli cells. When close enough, the user can release photons to eliminate other cells. For more details, see [[Team:ETHZ_Basel/InformationProcessing/Game | here]]. This model is available as a joystick input and a keyboard input version.<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingKeyboard.zip/download '''Download keyboard version.''']<br />
* [http://sourceforge.net/projects/ethzigem10/files/gamingJoystick.zip/download '''Download joystick version.''']<br />
<br clear="all" /><br />
<br />
== References ==<br />
[1] [http://www.gnu.org/licenses/gpl.txt GNU General Public License, Version 3]<br />
<br />
[2] [http://www.micro-manager.org/ μManager Website]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Introduction/MediaTeam:ETHZ Basel/Introduction/Media2010-10-27T18:21:35Z<p>Georgerosenberger: /* Media resources */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Introduction}}<br />
<br />
= Media =<br />
<br />
<br />
== Media coverage ==<br />
In October, Biotechniques contacted us for an interview about our project E. lemming. They showed particular interest in our motivation to participate in the iGEM competition as well as in project development and team collaborations. <br />
<br />
Read more about our experiences during the iGEM 2010 period on:<br />
* [http://biotechniques.com/news/iGEM-competitors-gear-up-for-2010-challenge/biotechniques-304538.html BioTechniques - iGEM competitors gear up for 2010 challenge]<br />
<br />
== Media resources ==<br />
*[http://www.youtube.com/watch?v=JQZZ7gT8Tjk E. lemming - The Movie on YouTube]<br />
*[http://www.youtube.com/watch?v=mulRvAVExSc&hd=1 E. lemming - (The Lemming) on YouTube]<br />
*[http://www.youtube.com/watch?v=1o4RzI-vwAw&hd=1 E. lemming - (The Lemming's Brother) on YouTube]<br />
<br />
== Contact ==<br />
You can contact us by email at: [[Image:ETHZ_Basel_mail.png|157px|]]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Introduction/MediaTeam:ETHZ Basel/Introduction/Media2010-10-27T18:21:23Z<p>Georgerosenberger: /* Media resources */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Introduction}}<br />
<br />
= Media =<br />
<br />
<br />
== Media coverage ==<br />
In October, Biotechniques contacted us for an interview about our project E. lemming. They showed particular interest in our motivation to participate in the iGEM competition as well as in project development and team collaborations. <br />
<br />
Read more about our experiences during the iGEM 2010 period on:<br />
* [http://biotechniques.com/news/iGEM-competitors-gear-up-for-2010-challenge/biotechniques-304538.html BioTechniques - iGEM competitors gear up for 2010 challenge]<br />
<br />
== Media resources ==<br />
*[http://www.youtube.com/watch?v=JQZZ7gT8Tjk E. lemming - The Movie on YouTube]<br />
*[http://www.youtube.com/watch?v=mulRvAVExSc&hd=1 E. lemming (The Lemming) on YouTube]<br />
*[http://www.youtube.com/watch?v=1o4RzI-vwAw&hd=1 E. lemming (The Lemming's Brother) on YouTube]<br />
<br />
== Contact ==<br />
You can contact us by email at: [[Image:ETHZ_Basel_mail.png|157px|]]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Introduction/MediaTeam:ETHZ Basel/Introduction/Media2010-10-27T18:18:50Z<p>Georgerosenberger: /* Media resources */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Introduction}}<br />
<br />
= Media =<br />
<br />
<br />
== Media coverage ==<br />
In October, Biotechniques contacted us for an interview about our project E. lemming. They showed particular interest in our motivation to participate in the iGEM competition as well as in project development and team collaborations. <br />
<br />
Read more about our experiences during the iGEM 2010 period on:<br />
* [http://biotechniques.com/news/iGEM-competitors-gear-up-for-2010-challenge/biotechniques-304538.html BioTechniques - iGEM competitors gear up for 2010 challenge]<br />
<br />
== Media resources ==<br />
*[http://www.youtube.com/watch?v=JQZZ7gT8Tjk E. lemming - The Movie on YouTube]<br />
*[http://www.youtube.com/watch?v=mulRvAVExSc&hd=1 E. lemming (The Lemming)]<br />
*[http://www.youtube.com/watch?v=1o4RzI-vwAw&hd=1 E. lemming (The Lemming's Brother)]<br />
<br />
== Contact ==<br />
You can contact us by email at: [[Image:ETHZ_Basel_mail.png|157px|]]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Achievements/E_lemmingTeam:ETHZ Basel/Achievements/E lemming2010-10-27T18:04:21Z<p>Georgerosenberger: /* Experimental Results */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Achievements}}<br />
<br />
= The E. lemming =<br />
<br />
== What it needs to bring E. lemming alive ==<br />
It needs an '''archeal photoreceptor''' that is fused to a '''bacterial chemotactic transducer'''. <br />
This was successfully demonstrated by Jung ''et al.'' in 2001, who fused the ''Natronobacterium pharaonis'' NpSRII (Np seven-transmembrane retinylidene photoreceptor sensory rhodopsins II) and their cognate transducer HtrII to the cytoplasmic domain of the chemotaxis transducer EcTsr of ''Escherichia coli''. For more information visit our [[Team:ETHZ_Basel/Biology/Archeal_Light_Receptor|Archeal Light Receptor]] wiki page.<br />
<br />
To make the nice videos shown below, the optimal chemotactic conditions, that were concluded from a [[Team:ETHZ_Basel/Biology/Implementation|series of different microscopy images]], were applied. ''Escherichia coli'' K12 cells were grown at 30 °C in Lysogeny Broth to on OD of 1.0. IPTG for induction of gene expression and all-trans retinal for NpSRII folding were added to the media.<br />
<br />
== Experimental Results ==<br />
We imaged several transfected E. coli cells with a 20&times; lens in a &asymp;50&mu;m high flow channel. Approximately 5% of the cells reacted on the switch-on and -off of the blue light signal by changing significantly their swimming behavior. In Video 1 shows an E. lemming swimming in regular circles in a constant light environment. When switching the blue light on, it completely changes its motility after a 2-3s delay by swimming straight for several seconds. When the light is switched off, it returns to its original behavior after a similar delay (see paragraph [[Team:ETHZ_Basel/Achievements/E_lemming#Characterization|&quot;Characterization&quot;]]).<br />
<br />
Video 2 shows another E. lemming which is swimming straight with frequent interruptions by tumblings when being in a constant light environment. When the blue light is switched on, the tumblings nearly completely disappear and the E. lemming is swimming straight over large distances. When the light is switched off, the tumbling disappears or the E. lemming alternatively stops movement at all.<br />
<br />
<html><table width="90%" border="0"><tr><br />
<td valign="top" style="width:50%"><br />
<div class="thumb tright"><div class="thumbinner" style="width:402px;"><br />
<iframe title="YouTube video player" class="youtube-player" type="text/html" width="400" height="325" src="http://www.youtube.com/embed/mulRvAVExSc?rel=0&hd=1" frameborder="0"></iframe><br />
<div class="thumbcaption"><div class="magnify"><a href="http://www.youtube.com/watch?v=mulRvAVExSc&hd=1" class="external" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div><b>Video 1: This video shows the E. lemming in action.</b><br />The unprocessed microscope images are available <a href="https://2010.igem.org/Team:ETHZ_Basel/Achievements/OriginalImages">here</a>.</div></div></div><br />
</td><br />
<td valign="top" style="width:50%"><br />
<html><div class="thumb tright"><div class="thumbinner" style="width:402px;"><br />
<iframe title="YouTube video player" class="youtube-player" type="text/html" width="400" height="325" src="http://www.youtube.com/embed/1o4RzI-vwAw?rel=0&hd=1" frameborder="0"></iframe><br />
<div class="thumbcaption"><div class="magnify"><a href="http://www.youtube.com/watch?v=1o4RzI-vwAw&hd=1" class="external" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div><b>Video 2: This is the brother of the E. lemming, who decided to swim several times nearly out of focus and out of the field of view such that he had to be tracked manually.</b>.<br />The unprocessed microscope images are available <a href="https://2010.igem.org/Team:ETHZ_Basel/Achievements/OriginalImages">here</a>.</div></div></div><br />
</td></tr></table><br />
</html><br />
In both movies we visually highlighted the current position of the respective E. lemming. In the first movie this was possible by using our [[Team:ETHZ_Basel/InformationProcessing/CellDetection|cell detection and tracking]] algorithm, such that also all other cells could be easily highlighted, too. In the second video this was not possible, since the E. lemming nearly swims out-of-focus once and the stage had to be moved during the experiment to keep the E. lemming in the field of view of the microscope. Thus, the tracking had to be done by hand (&asymp;230 frames) for the second movie.<br />
<br />
== Characterization ==<br />
To characterize the change of swimming behavior when switching on or off the blue light signal, we estimated the angle of the E. lemming for each frame of Video 1. This was done by obtaining the positions (x<sub>i</sub>, y<sub>i</sub>) of the E. lemming from our [[Team:ETHZ_Basel/InformationProcessing/CellDetection|cell detection and tracking algorithm]]. The angle &phi;<sub>i</sub> of frame i was then calculated by central differences:<br /><br />
<code>tan(&phi;<sub>i</sub>)=(y<sub>i+1</sub>-y<sub>i-1</sub>)/(x<sub>i+1</sub>-x<sub>i-1</sub>).</code><br /><br />
[[Image:AngleOverTime.jpg|thumb|center|900px|'''Figure 1: Angle of the E. lemming''' during one measurement (see Video 1) as calculated from the central differences of its positions. The estimated reaction times between the switching of the blue light and the reactions of the E. lemming are marked in the image. For the reaction delay between switch-on of the light and straight swimming we obtained &Delta;t<sub>1</sub>&asymp;2.1s and &Delta;t<sub>2</sub>&asymp;3.0s. For the delay between the switch-off of the blue light and start of tumbling it was only possible to estimate the time delay for the second light pulse, &Delta;t<sub>3</sub>&asymp;2.4s. White background: blue light off. Light blue background: blue light on.]]<br />
When plotting the angle over time (see Figure 1), one observes that during white light periods the angle is increasing with a nearly constant angular speed of about 27° per second (&asymp8° per frame). When switching on blue light, the angular speed decreases to nearly zero for several seconds after a delay between 2 and 3s. <br />
<br />
For the first light pulse this decrease of angular speed lasted for about 10s until the return to pre-blue light behavior, for the second light pulse this effect only ended after the blue light was switched off again. In the latter, normal swimming behavior re-established after a delay of approximately 2.4s, which is nearly the same delay as the delay when switching the light on.<br />
Please note that the natural adaptation system of the chemotaxis pathway downstream of the light receptor is active in this mutant, such that the swimming behavior only changes directly after the blue light is switched on or off, but is not necessarily different between long periods of light on or off.<br />
<br />
We furthermore noticed that the E. lemming seems to have the tendency to show a bigger tumble right before starting swimming straight when the blue light is switched on. However, if this behavior occurred by chance or if this is a general property of the E. lemming was yet not possible to show.</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Achievements/E_lemmingTeam:ETHZ Basel/Achievements/E lemming2010-10-27T18:03:53Z<p>Georgerosenberger: /* Experimental Results */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Achievements}}<br />
<br />
= The E. lemming =<br />
<br />
== What it needs to bring E. lemming alive ==<br />
It needs an '''archeal photoreceptor''' that is fused to a '''bacterial chemotactic transducer'''. <br />
This was successfully demonstrated by Jung ''et al.'' in 2001, who fused the ''Natronobacterium pharaonis'' NpSRII (Np seven-transmembrane retinylidene photoreceptor sensory rhodopsins II) and their cognate transducer HtrII to the cytoplasmic domain of the chemotaxis transducer EcTsr of ''Escherichia coli''. For more information visit our [[Team:ETHZ_Basel/Biology/Archeal_Light_Receptor|Archeal Light Receptor]] wiki page.<br />
<br />
To make the nice videos shown below, the optimal chemotactic conditions, that were concluded from a [[Team:ETHZ_Basel/Biology/Implementation|series of different microscopy images]], were applied. ''Escherichia coli'' K12 cells were grown at 30 °C in Lysogeny Broth to on OD of 1.0. IPTG for induction of gene expression and all-trans retinal for NpSRII folding were added to the media.<br />
<br />
== Experimental Results ==<br />
We imaged several transfected E. coli cells with a 20&times; lens in a &asymp;50&mu;m high flow channel. Approximately 5% of the cells reacted on the switch-on and -off of the blue light signal by changing significantly their swimming behavior. In Video 1 shows an E. lemming swimming in regular circles in a constant light environment. When switching the blue light on, it completely changes its motility after a 2-3s delay by swimming straight for several seconds. When the light is switched off, it returns to its original behavior after a similar delay (see paragraph [[Team:ETHZ_Basel/Achievements/E_lemming#Characterization|&quot;Characterization&quot;]]).<br />
<br />
Video 2 shows another E. lemming which is swimming straight with frequent interruptions by tumblings when being in a constant light environment. When the blue light is switched on, the tumblings nearly completely disappear and the E. lemming is swimming straight over large distances. When the light is switched off, the tumbling disappears or the E. lemming alternatively stops movement at all.<br />
<br />
<html><table width="90%" border="0"><tr><br />
<td valign="top" style="width:50%"><br />
<div class="thumb tright"><div class="thumbinner" style="width:402px;"><br />
<iframe title="YouTube video player" class="youtube-player" type="text/html" width="400" height="325" src="http://www.youtube.com/embed/mulRvAVExSc?rel=0&hd=1" frameborder="0"></iframe><br />
<div class="thumbcaption"><div class="magnify"><a href="http://www.youtube.com/watch?v=mulRvAVExSc&hd=1" class="external" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div><b>Video 1: This video shows the E. lemming in action.</b><br />The unprocessed microscope images are available <a href="https://2010.igem.org/Team:ETHZ_Basel/Achievements/OriginalImages">here</a>.</div></div></div><br />
</td><br />
<td valign="top" style="width:50%"><br />
<html><div class="thumb tright"><div class="thumbinner" style="width:402px;"><br />
<iframe title="YouTube video player" class="youtube-player" type="text/html" width="400" height="325" src="http://www.youtube.com/embed/1o4RzI-vwAw?rel=0&hd=1" frameborder="0"></iframe><br />
<div class="thumbcaption"><div class="magnify"><a href="http://www.youtube.com/watch?v=1o4RzI-vwAw&hd=1" class="external" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div><b>Video 2: this the brother of the E. lemming, who decided to swim several times nearly out of focus and out of the field of view such that he had to be tracked manually.</b>.<br />The unprocessed microscope images are available <a href="https://2010.igem.org/Team:ETHZ_Basel/Achievements/OriginalImages">here</a>.</div></div></div><br />
</td></tr></table><br />
</html><br />
In both movies we visually highlighted the current position of the respective E. lemming. In the first movie this was possible by using our [[Team:ETHZ_Basel/InformationProcessing/CellDetection|cell detection and tracking]] algorithm, such that also all other cells could be easily highlighted, too. In the second video this was not possible, since the E. lemming nearly swims out-of-focus once and the stage had to be moved during the experiment to keep the E. lemming in the field of view of the microscope. Thus, the tracking had to be done by hand (&asymp;230 frames) for the second movie.<br />
<br />
== Characterization ==<br />
To characterize the change of swimming behavior when switching on or off the blue light signal, we estimated the angle of the E. lemming for each frame of Video 1. This was done by obtaining the positions (x<sub>i</sub>, y<sub>i</sub>) of the E. lemming from our [[Team:ETHZ_Basel/InformationProcessing/CellDetection|cell detection and tracking algorithm]]. The angle &phi;<sub>i</sub> of frame i was then calculated by central differences:<br /><br />
<code>tan(&phi;<sub>i</sub>)=(y<sub>i+1</sub>-y<sub>i-1</sub>)/(x<sub>i+1</sub>-x<sub>i-1</sub>).</code><br /><br />
[[Image:AngleOverTime.jpg|thumb|center|900px|'''Figure 1: Angle of the E. lemming''' during one measurement (see Video 1) as calculated from the central differences of its positions. The estimated reaction times between the switching of the blue light and the reactions of the E. lemming are marked in the image. For the reaction delay between switch-on of the light and straight swimming we obtained &Delta;t<sub>1</sub>&asymp;2.1s and &Delta;t<sub>2</sub>&asymp;3.0s. For the delay between the switch-off of the blue light and start of tumbling it was only possible to estimate the time delay for the second light pulse, &Delta;t<sub>3</sub>&asymp;2.4s. White background: blue light off. Light blue background: blue light on.]]<br />
When plotting the angle over time (see Figure 1), one observes that during white light periods the angle is increasing with a nearly constant angular speed of about 27° per second (&asymp8° per frame). When switching on blue light, the angular speed decreases to nearly zero for several seconds after a delay between 2 and 3s. <br />
<br />
For the first light pulse this decrease of angular speed lasted for about 10s until the return to pre-blue light behavior, for the second light pulse this effect only ended after the blue light was switched off again. In the latter, normal swimming behavior re-established after a delay of approximately 2.4s, which is nearly the same delay as the delay when switching the light on.<br />
Please note that the natural adaptation system of the chemotaxis pathway downstream of the light receptor is active in this mutant, such that the swimming behavior only changes directly after the blue light is switched on or off, but is not necessarily different between long periods of light on or off.<br />
<br />
We furthermore noticed that the E. lemming seems to have the tendency to show a bigger tumble right before starting swimming straight when the blue light is switched on. However, if this behavior occurred by chance or if this is a general property of the E. lemming was yet not possible to show.</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/InformationProcessingTeam:ETHZ Basel/InformationProcessing2010-10-27T17:54:09Z<p>Georgerosenberger: /* Information Processing Overview */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_InformationProcessing}}<br />
<br />
= Information Processing Overview =<br />
<html><br />
<div class="thumb tright"><div class="thumbinner" style="width:402px;"><br />
<iframe title="YouTube video player" class="youtube-player" type="text/html" width="400" height="325" src="http://www.youtube.com/embed/DmglULaxNrY?hd=1" frameborder="0"></iframe><br />
<div class="thumbcaption"><div class="magnify"><a href="http://www.youtube.com/watch?v=DmglULaxNrY?hd=1" class="external" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div><b>Information processing principle of E. lemming.</b> Tumbling / directed movement rates are monitored by image processing algorithms, which are linked to the light-pulse generator. Therefore, <i>E. coli</i> tumbling is induced or suppressed simply by pressing a light switch. This synthetic network enables control of single E. lemming cells.</div></div></div><br />
</html><br />
<br />
Although the synthetic network we implemented makes the tumbling frequency of ''E. coli'' cells dependent on red and far-red light, the [[Team:ETHZ_Basel/Biology | '''biological part''']] alone is not sufficient to control the swimming direction of E. lemming. Thus, it is complemented by a complex ''in silico'' setup centered around a controller which guides the cell towards the desired destination.<br />
<br />
E. Lemming cells are imaged using [[Team:ETHZ_Basel/InformationProcessing/Microscope|'''microscopy techniques''']]. The resulting images are processed by fast [[Team:ETHZ_Basel/InformationProcessing/CellDetection|'''cell detection and cell tracking algorithms''']], that determine the current movement direction & trajectory of the chosen bacterium. The desired reference direction which is clearly [[Team:ETHZ_Basel/InformationProcessing/Visualization|'''visualized''']] is set by the input of the user, which is translated by the [[Team:ETHZ_Basel/InformationProcessing/Controller|'''the controller algorithm''']] into series of light pulses (red light and far-red light) that would lead E. lemming the right way. Therefore, by the change of the tumbling frequency, the cell is forced to swim in a desired direction in real time.<br />
<br />
To demonstrate parts of the information processing pipeline, the sidekick <br>[[Team:ETHZ_Basel/InformationProcessing/Game|'''E. lemming 2D Game''']] was created, which is built using the capabilities of our very own [[Team:ETHZ_Basel/Achievements/Matlab_Toolbox|'''Matlab Toolbox (Lemming Toolbox)''']].</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Modeling/ChemotaxisTeam:ETHZ Basel/Modeling/Chemotaxis2010-10-27T17:47:29Z<p>Georgerosenberger: /* Model based on Barkai & Leibler (1997) */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Modeling}}<br />
<br />
= Modeling of the chemotaxis pathway =<br />
[[Image:ETHZ_Basel_molecular_che.png|thumb|400px|'''Schematical overview of the light switch device and the interaction with the chemotaxis pathway.''' LSP refers to light switch protein, AP to anchor protein and Che to the attacked protein of the chemotaxis pathway.]]<br />
<br />
== Background ==<br />
[[Image:ETHZ_Basel_chemotactical_network.png|thumb|400px|'''Schematical overview of the chemotaxis pathway.''' MCPs refers to the membrane receptor proteins and Che to the intracellular chemotaxis proteins.]]<br />
<br />
The complex [[Team:ETHZ_Basel/Biology/Molecular_Mechanism|chemotaxis pathway]] in ''E. coli'' has been well analyzed in the modeling literature and, as the following published models [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[3]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]] show, many and different assumptions are necessary in order to answer the investigated questions. In the case of E. lemming, the question regarding the chemotaxis pathway is:<br />
<br />
''How does the output species (CheYp bias) react to perturbations of upstream species?''<br />
<br />
The chemotaxis network represents the main decision factor in bacterial movement and therefore, it received special attention for the [[Team:ETHZ_Basel/Modeling/Experimental_Design|optimal experimental design]]. In order to achieve a more general consensus prediction of the chemotaxis behavior in E. lemming, it was decided to adapt and extend four different models based on published approaches on modeling the chemotaxis pathway [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[3]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]].<br />
<br />
The interface to the light switch model was defined to be the selected Che species, which is linked to one light-sensitive protein (LSP1). Concentration of this species (LSP1-Che) is determined by the [[Team:ETHZ_Basel/Modeling/Light_Switch|light switch model]]. Evaluation of the model based on this approach was conducted by changing the concentration of the selected Che species according to a series of time steps reflecting light pulses. This assumes [[Team:ETHZ_Basel/Modeling/Combined|total removal]] of the species: A red light pulse will activate and dimerize the LSPs and thus result in spatial localization at the anchor and therefore inactivation of the coupled Che protein. In addition to the selected Che species (CheR, B, Y, Z), possible phosphorylated subspecies were analyzed.<br />
<br />
Important for analyzing the chemotaxis network in E. lemming is the concentration of the output species CheYp. Threshold of the difference between the two states after activation by light pulses of CheYp concentration is determined, according to predictions of the [[Team:ETHZ_Basel/Modeling/Movement|movement model]], regarding an optimization of corresponding tumbling / directed movement frequency. For CheR and Y, the CheYp concentration after light pulse induction decreases in relation to the initial value, while for CheB and Z it increases. Manipulation of CheR and Y concentration therefore have an inverse effect on tumbling / directed movement ratio than CheB and Z. The response of the chemotaxis models was measured by taking the relative amplitude in CheYp concentration between two different light pulses.<br />
<br />
Out of the four models of the chemotaxis pathway that our modeling team implemented, only two of them were further investigated in the combined model of E. lemming: Spiro et al. (1997) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]] and Mello & Tu (2003) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]]. These models were chosen not only because they are representative for modeling the chemotaxis pathway, but also because they differ in a few important aspects, as explained later.<br />
<br />
{| border="1" align="center"<br />
|+ '''Statistics of implemented and original models'''<br />
! model based on !! che species !! receptor species<br />
|-<br />
! scope="row" | Spiro et al.<br />
| 6 || 12<br />
|-<br />
! scope="row" | Mello & Tu<br />
| 6 || 15<br />
|-<br />
! scope="row" | Barkai & Leibler<br />
| 2 || 1 (26 forms)<br />
|-<br />
! scope="row" | Rao et al.<br />
| 4 || 10<br />
|-<br />
! scope="row" | original Mello & Tu<br />
| 5 || 15<br />
|}<br />
<br />
== Model based on Spiro et al. (1997) ==<br />
The model based on Spiro et al. (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[1]]] has been used to identify candidates of the chemotaxis receptor pathway by enabling removal or addition of a species upon light induction. For all Che proteins (CheR, Y, B, Z), the concentrations stay below/above the threshold, until they are added again (LSPs are deactivated with far-red light and dimerization is reversed). In terms of aspartate ligand concentration, the best results were obtained for assuming a high ligand concentration (saturation, the methylation level of the receptors is high). For CheY and Z, the reaction times are much faster than for CheB and CheR.<br />
<br />
[[Image:ETHZ_Basel_chemotaxis_spiro_1.png|thumb|center|833px|'''Che protein species predicted by the model based on Spiro et al. (1997)''' CheY is coupled to PIF3. PhyB is present in a concentration of 100 μM, anchor in a concentration of 130 μM. Medium asparate levels (10^-6 uM) were chosen. Red light pulses were induced for 0.3s at times 10s, 200s and 390s; far-red light pulses were induced for 10s at times 50s, 250s and 440s.]]<br />
<br />
{| border="0" align="center"<br />
|- valign="top"<br />
|[[Image:ETHZ_Basel_chemotaxis_spiro_2.png|thumb|center|550px|'''Total Che protein species predicted by the model based on Spiro et al. (1997)''' Only the total concentration of CheY is changed by the light switch in this model.]]<br />
|[[Image:ETHZ_Basel_chemotaxis_spiro_3.png|thumb|250px|'''Response of the system.''' CheYp amplitude is predicted to be high, according to the model based on Spiro et al. (1997).]]<br />
|}<br />
<br />
== Model based on Mello & Tu (2003) ==<br />
The model based on Mello & Tu [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[2]]] differs from the one based on Spiro et al. (1997) in a way that it is able to reach perfect and near-perfect adaptation. Mello & Tu investigated robustness of the chemotaxis receptor network, covering the effect of attractant binding through the phosphorylation of CheY. Governing ODEs are derived by applying the law of mass action to the known reactions. Five states of methylation and demethylation of the attractant-bound and free receptors are considered.<br />
<br />
The published model assumes the binding and unbinding of the ligand to the receptors to be a fast reaction and thus is approximated by a quasi-steady state assumption. Aspartate ligand binding is therefore described by a fraction of total saturation of the chemotaxis receptors. To make it compatible to absolute ligand concentration (as used by the other model), the binding and unbinding reaction rate constants used by Spiro et al. (1997) were used.<br />
<br />
Another adaptation was made, since the receptors in the publication of Mello & Tu (2003) were defined by an algebraic equation. To solve the resulting differential algebraic equations, they were included as additional states with a stable equilibrium to fulfill the algebraic equations.<br />
<br />
The model based on Mello & Tu (2003) shows similar behavior compared to the adapted Spiro et al. (1997) model.<br />
<br />
[[Image:ETHZ_Basel_chemotaxis_mello_1.png|thumb|center|833px|'''Che protein species predicted by the model based on Mello & Tu (2003)''' CheY is coupled to PIF3. PhyB is present in a concentration of 100 μM, anchor in a concentration of 130 uM. Medium asparate levels (10^-6 μM) were chosen. Red light pulses were induced for 0.3s at times 10s, 200s and 390s; far-red light pulses were induced for 10s at times 50s, 250s and 440s.]]<br />
<br />
{| border="0" align="center"<br />
|- valign="top"<br />
|[[Image:ETHZ_Basel_chemotaxis_mello_2.png|thumb|center|550px|'''Total Che protein species predicted by the model based on Mello & Tu (2003).''' The total concentration of CheR is changed in addition to the CheYp concentration in this model.]]<br />
|[[Image:ETHZ_Basel_chemotaxis_mello_3.png|thumb|250px|'''Response of the system.''' The model based on Mello & Tu (2003) predicts a much smaller CheYp amplitude than the model based on Spiro et al. (1997).]]<br />
|}<br />
<br />
== Model based on Rao et al. (2004) == <br />
[[Image:ETHZ_Rao_sensitivity.png|thumb|400px|'''Sensitivity Analysis.''' for the model based on Rao et al. (2004) [3] ]]<br />
The Rao et al. (2004) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[3]]] chemotaxis model combines the two state model proposed for adaptation by Barkai & Leibler (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[4]]] with the model for the phosphorylation cascade proposed by Sourjik and Berg (2002a).<br />
<br />
The receptor methylation is modeled using the method proposed by Barkai & Leibler (1997) with the modifications suggested by Morton-Firth et al. (1999) i.e. CheR binds only to inactive receptors & CheBp binds only to active receptors.<br />
<br />
The predictions are quite a similar behavior of the Che proteins, as demonstrated by Spiro et al (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[1]]]. A notable difference is that the response of CheYp level to the change of the level of the other Che proteins is robust to the fluctuations of the ligand (attractant) concentration. In Spiro et al. (1997), the most desirable results were obtained only for higher concentrations of the ligand.<br />
<br clear="all" /><br />
<br />
== Model based on Barkai & Leibler (1997) ==<br />
<br />
[[Image:Eth_igem_barkai_leibler.png|thumb|400px| '''Near perfect adaptation of the activity level in the chemotaxis pathway as modeled by Barkai & Leibler (1997) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]].''' The system adapts to successive additions/removals of attractant and the almost exact same steady state value of the system activity is reached soon after the changes in input concentration.]]<br />
<br />
The importance of the two - state chemotaxis network model developed by Barkai & Leibler (1997) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]] lies in the fact that it is the first model to show perfect adaptation over a wide range of parameters (phenomenon also known as '''robust adaptation'''). The model is using a single receptor species (MCPs+CheA+CheW) referred to as 'E', which can be in either one of the two states: 'active' or 'inactive'. The active state is characterized by an increased CheA activity, which phosphorylates CheY, therefore inducing tumbling.<br />
<br />
The output of the model is the overall activity of the complex, calculated as a weighted average of all the individual forms of the receptor complex and their activity probabilities (''i.e.'' the average number of receptors in the active state). This quantity is functionally dependent on the CheYp level and on the kinetic rates of CheY dynamics, but the actual dependency law is not stated. The activity probabilities are depending on the input value and on the methylation level of the complex.<br />
<br />
The receptor complex can exist in either attracted - bound or attracted - free form, it can be successively methylated, up to M methylation sites, and also either in an attractant - bound or attractant - free form. The rates of change of all possibilities resulting from combining the above states render the ODE system proposed by Barkai & Leibler (1997). <br />
<br />
The central assumptions of the model are that CheB can only demethylate active receptors, unlike CheR, which methylates both active and inactive ones, and that the methylation and demethylation reactions have slower timescales than the other processes. <br />
<br />
As CheYp value was not the direct output of Barkai & Leibler (1997) model and the dependency between the activity of the system and its CheYp level was not clearly stated, we decided to use the models developed Spiro et. al [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]] and by Mello & Tu (2003) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], the latter one also reaching near - perfect adaptation, in developing the complete model of E. lemming.<br />
<br />
== Download ==<br />
The chemotaxis models based on Spiro et al. (1997) and Mello & Tu (2003) are included within the [[Team:ETHZ_Basel/Achievements/Matlab_Toolbox|Matlab Toolbox]] and can be downloaded there.<br />
<br />
The chemotaxis models based on Barkai & Leibler (1997) and Rao et al. (2004) are provided as independent implementations and can be downloaded from [http://sourceforge.net/projects/ethzigem10/files/additionalChemotaxis.zip/download here].<br />
<br />
== References ==<br />
[1] [http://www.pnas.org/content/94/14/7263.full Spiro et al: A model of excitation and adaptation in bacterial chemotaxis. PNAS 1997 94;14;7263-7268.]<br />
<br />
[2] [http://www.cell.com/biophysj/retrieve/pii/S0006349503700216 Mello & Tu: Perfect and Near-Perfect Adaptation in a Model of Bacterial Chemotaxis. Biophysical Journal 2003 84;5;2943-2956.]<br />
<br />
[3] [http://www.plosbiology.org/article/info:doi/10.1371/journal.pbio.0020049 Rao et al: Design and Diversity in Bacterial Chemotaxis. PLoS Biol 2004;2;2;239-252.]<br />
<br />
[4] [http://www.nature.com/nature/journal/v387/n6636/abs/387913a0.html Barkai & Leibler: Robustness in simple biochemical networks. Nature 1997;387;913-917.]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Modeling/ChemotaxisTeam:ETHZ Basel/Modeling/Chemotaxis2010-10-27T17:47:00Z<p>Georgerosenberger: /* Model based on Barkai & Leibler (1997) */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Modeling}}<br />
<br />
= Modeling of the chemotaxis pathway =<br />
[[Image:ETHZ_Basel_molecular_che.png|thumb|400px|'''Schematical overview of the light switch device and the interaction with the chemotaxis pathway.''' LSP refers to light switch protein, AP to anchor protein and Che to the attacked protein of the chemotaxis pathway.]]<br />
<br />
== Background ==<br />
[[Image:ETHZ_Basel_chemotactical_network.png|thumb|400px|'''Schematical overview of the chemotaxis pathway.''' MCPs refers to the membrane receptor proteins and Che to the intracellular chemotaxis proteins.]]<br />
<br />
The complex [[Team:ETHZ_Basel/Biology/Molecular_Mechanism|chemotaxis pathway]] in ''E. coli'' has been well analyzed in the modeling literature and, as the following published models [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[3]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]] show, many and different assumptions are necessary in order to answer the investigated questions. In the case of E. lemming, the question regarding the chemotaxis pathway is:<br />
<br />
''How does the output species (CheYp bias) react to perturbations of upstream species?''<br />
<br />
The chemotaxis network represents the main decision factor in bacterial movement and therefore, it received special attention for the [[Team:ETHZ_Basel/Modeling/Experimental_Design|optimal experimental design]]. In order to achieve a more general consensus prediction of the chemotaxis behavior in E. lemming, it was decided to adapt and extend four different models based on published approaches on modeling the chemotaxis pathway [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[3]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]].<br />
<br />
The interface to the light switch model was defined to be the selected Che species, which is linked to one light-sensitive protein (LSP1). Concentration of this species (LSP1-Che) is determined by the [[Team:ETHZ_Basel/Modeling/Light_Switch|light switch model]]. Evaluation of the model based on this approach was conducted by changing the concentration of the selected Che species according to a series of time steps reflecting light pulses. This assumes [[Team:ETHZ_Basel/Modeling/Combined|total removal]] of the species: A red light pulse will activate and dimerize the LSPs and thus result in spatial localization at the anchor and therefore inactivation of the coupled Che protein. In addition to the selected Che species (CheR, B, Y, Z), possible phosphorylated subspecies were analyzed.<br />
<br />
Important for analyzing the chemotaxis network in E. lemming is the concentration of the output species CheYp. Threshold of the difference between the two states after activation by light pulses of CheYp concentration is determined, according to predictions of the [[Team:ETHZ_Basel/Modeling/Movement|movement model]], regarding an optimization of corresponding tumbling / directed movement frequency. For CheR and Y, the CheYp concentration after light pulse induction decreases in relation to the initial value, while for CheB and Z it increases. Manipulation of CheR and Y concentration therefore have an inverse effect on tumbling / directed movement ratio than CheB and Z. The response of the chemotaxis models was measured by taking the relative amplitude in CheYp concentration between two different light pulses.<br />
<br />
Out of the four models of the chemotaxis pathway that our modeling team implemented, only two of them were further investigated in the combined model of E. lemming: Spiro et al. (1997) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]] and Mello & Tu (2003) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]]. These models were chosen not only because they are representative for modeling the chemotaxis pathway, but also because they differ in a few important aspects, as explained later.<br />
<br />
{| border="1" align="center"<br />
|+ '''Statistics of implemented and original models'''<br />
! model based on !! che species !! receptor species<br />
|-<br />
! scope="row" | Spiro et al.<br />
| 6 || 12<br />
|-<br />
! scope="row" | Mello & Tu<br />
| 6 || 15<br />
|-<br />
! scope="row" | Barkai & Leibler<br />
| 2 || 1 (26 forms)<br />
|-<br />
! scope="row" | Rao et al.<br />
| 4 || 10<br />
|-<br />
! scope="row" | original Mello & Tu<br />
| 5 || 15<br />
|}<br />
<br />
== Model based on Spiro et al. (1997) ==<br />
The model based on Spiro et al. (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[1]]] has been used to identify candidates of the chemotaxis receptor pathway by enabling removal or addition of a species upon light induction. For all Che proteins (CheR, Y, B, Z), the concentrations stay below/above the threshold, until they are added again (LSPs are deactivated with far-red light and dimerization is reversed). In terms of aspartate ligand concentration, the best results were obtained for assuming a high ligand concentration (saturation, the methylation level of the receptors is high). For CheY and Z, the reaction times are much faster than for CheB and CheR.<br />
<br />
[[Image:ETHZ_Basel_chemotaxis_spiro_1.png|thumb|center|833px|'''Che protein species predicted by the model based on Spiro et al. (1997)''' CheY is coupled to PIF3. PhyB is present in a concentration of 100 μM, anchor in a concentration of 130 μM. Medium asparate levels (10^-6 uM) were chosen. Red light pulses were induced for 0.3s at times 10s, 200s and 390s; far-red light pulses were induced for 10s at times 50s, 250s and 440s.]]<br />
<br />
{| border="0" align="center"<br />
|- valign="top"<br />
|[[Image:ETHZ_Basel_chemotaxis_spiro_2.png|thumb|center|550px|'''Total Che protein species predicted by the model based on Spiro et al. (1997)''' Only the total concentration of CheY is changed by the light switch in this model.]]<br />
|[[Image:ETHZ_Basel_chemotaxis_spiro_3.png|thumb|250px|'''Response of the system.''' CheYp amplitude is predicted to be high, according to the model based on Spiro et al. (1997).]]<br />
|}<br />
<br />
== Model based on Mello & Tu (2003) ==<br />
The model based on Mello & Tu [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[2]]] differs from the one based on Spiro et al. (1997) in a way that it is able to reach perfect and near-perfect adaptation. Mello & Tu investigated robustness of the chemotaxis receptor network, covering the effect of attractant binding through the phosphorylation of CheY. Governing ODEs are derived by applying the law of mass action to the known reactions. Five states of methylation and demethylation of the attractant-bound and free receptors are considered.<br />
<br />
The published model assumes the binding and unbinding of the ligand to the receptors to be a fast reaction and thus is approximated by a quasi-steady state assumption. Aspartate ligand binding is therefore described by a fraction of total saturation of the chemotaxis receptors. To make it compatible to absolute ligand concentration (as used by the other model), the binding and unbinding reaction rate constants used by Spiro et al. (1997) were used.<br />
<br />
Another adaptation was made, since the receptors in the publication of Mello & Tu (2003) were defined by an algebraic equation. To solve the resulting differential algebraic equations, they were included as additional states with a stable equilibrium to fulfill the algebraic equations.<br />
<br />
The model based on Mello & Tu (2003) shows similar behavior compared to the adapted Spiro et al. (1997) model.<br />
<br />
[[Image:ETHZ_Basel_chemotaxis_mello_1.png|thumb|center|833px|'''Che protein species predicted by the model based on Mello & Tu (2003)''' CheY is coupled to PIF3. PhyB is present in a concentration of 100 μM, anchor in a concentration of 130 uM. Medium asparate levels (10^-6 μM) were chosen. Red light pulses were induced for 0.3s at times 10s, 200s and 390s; far-red light pulses were induced for 10s at times 50s, 250s and 440s.]]<br />
<br />
{| border="0" align="center"<br />
|- valign="top"<br />
|[[Image:ETHZ_Basel_chemotaxis_mello_2.png|thumb|center|550px|'''Total Che protein species predicted by the model based on Mello & Tu (2003).''' The total concentration of CheR is changed in addition to the CheYp concentration in this model.]]<br />
|[[Image:ETHZ_Basel_chemotaxis_mello_3.png|thumb|250px|'''Response of the system.''' The model based on Mello & Tu (2003) predicts a much smaller CheYp amplitude than the model based on Spiro et al. (1997).]]<br />
|}<br />
<br />
== Model based on Rao et al. (2004) == <br />
[[Image:ETHZ_Rao_sensitivity.png|thumb|400px|'''Sensitivity Analysis.''' for the model based on Rao et al. (2004) [3] ]]<br />
The Rao et al. (2004) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[3]]] chemotaxis model combines the two state model proposed for adaptation by Barkai & Leibler (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[4]]] with the model for the phosphorylation cascade proposed by Sourjik and Berg (2002a).<br />
<br />
The receptor methylation is modeled using the method proposed by Barkai & Leibler (1997) with the modifications suggested by Morton-Firth et al. (1999) i.e. CheR binds only to inactive receptors & CheBp binds only to active receptors.<br />
<br />
The predictions are quite a similar behavior of the Che proteins, as demonstrated by Spiro et al (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[1]]]. A notable difference is that the response of CheYp level to the change of the level of the other Che proteins is robust to the fluctuations of the ligand (attractant) concentration. In Spiro et al. (1997), the most desirable results were obtained only for higher concentrations of the ligand.<br />
<br clear="all" /><br />
<br />
== Model based on Barkai & Leibler (1997) ==<br />
<br />
[[Image:Eth_igem_barkai_leibler.png|thumb|400px| '''Near perfect adaptation of the activity level in the chemotaxis pathway as modeled by Barkai & Leibler (1997) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]]. The system adapts to successive additions/removals of attractant and the almost exact same steady state value of the system activity is reached soon after the changes in input concentration.]]<br />
<br />
The importance of the two - state chemotaxis network model developed by Barkai & Leibler (1997) lies in the fact that it is the first model to show perfect adaptation over a wide range of parameters (phenomenon also known as '''robust adaptation'''). The model is using a single receptor species (MCPs+CheA+CheW) referred to as 'E', which can be in either one of the two states: 'active' or 'inactive'. The active state is characterized by an increased CheA activity, which phosphorylates CheY, therefore inducing tumbling.<br />
<br />
The output of the model is the overall activity of the complex, calculated as a weighted average of all the individual forms of the receptor complex and their activity probabilities (''i.e.'' the average number of receptors in the active state). This quantity is functionally dependent on the CheYp level and on the kinetic rates of CheY dynamics, but the actual dependency law is not stated. The activity probabilities are depending on the input value and on the methylation level of the complex.<br />
<br />
The receptor complex can exist in either attracted - bound or attracted - free form, it can be successively methylated, up to M methylation sites, and also either in an attractant - bound or attractant - free form. The rates of change of all possibilities resulting from combining the above states render the ODE system proposed by Barkai & Leibler (1997). <br />
<br />
The central assumptions of the model are that CheB can only demethylate active receptors, unlike CheR, which methylates both active and inactive ones, and that the methylation and demethylation reactions have slower timescales than the other processes. <br />
<br />
As CheYp value was not the direct output of Barkai & Leibler (1997) model and the dependency between the activity of the system and its CheYp level was not clearly stated, we decided to use the models developed Spiro et. al [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]] and by Mello & Tu (2003) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], the latter one also reaching near - perfect adaptation, in developing the complete model of E. lemming.<br />
<br />
== Download ==<br />
The chemotaxis models based on Spiro et al. (1997) and Mello & Tu (2003) are included within the [[Team:ETHZ_Basel/Achievements/Matlab_Toolbox|Matlab Toolbox]] and can be downloaded there.<br />
<br />
The chemotaxis models based on Barkai & Leibler (1997) and Rao et al. (2004) are provided as independent implementations and can be downloaded from [http://sourceforge.net/projects/ethzigem10/files/additionalChemotaxis.zip/download here].<br />
<br />
== References ==<br />
[1] [http://www.pnas.org/content/94/14/7263.full Spiro et al: A model of excitation and adaptation in bacterial chemotaxis. PNAS 1997 94;14;7263-7268.]<br />
<br />
[2] [http://www.cell.com/biophysj/retrieve/pii/S0006349503700216 Mello & Tu: Perfect and Near-Perfect Adaptation in a Model of Bacterial Chemotaxis. Biophysical Journal 2003 84;5;2943-2956.]<br />
<br />
[3] [http://www.plosbiology.org/article/info:doi/10.1371/journal.pbio.0020049 Rao et al: Design and Diversity in Bacterial Chemotaxis. PLoS Biol 2004;2;2;239-252.]<br />
<br />
[4] [http://www.nature.com/nature/journal/v387/n6636/abs/387913a0.html Barkai & Leibler: Robustness in simple biochemical networks. Nature 1997;387;913-917.]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Modeling/ChemotaxisTeam:ETHZ Basel/Modeling/Chemotaxis2010-10-27T17:46:28Z<p>Georgerosenberger: /* Model based on Rao et al. (2004) */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Modeling}}<br />
<br />
= Modeling of the chemotaxis pathway =<br />
[[Image:ETHZ_Basel_molecular_che.png|thumb|400px|'''Schematical overview of the light switch device and the interaction with the chemotaxis pathway.''' LSP refers to light switch protein, AP to anchor protein and Che to the attacked protein of the chemotaxis pathway.]]<br />
<br />
== Background ==<br />
[[Image:ETHZ_Basel_chemotactical_network.png|thumb|400px|'''Schematical overview of the chemotaxis pathway.''' MCPs refers to the membrane receptor proteins and Che to the intracellular chemotaxis proteins.]]<br />
<br />
The complex [[Team:ETHZ_Basel/Biology/Molecular_Mechanism|chemotaxis pathway]] in ''E. coli'' has been well analyzed in the modeling literature and, as the following published models [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[3]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]] show, many and different assumptions are necessary in order to answer the investigated questions. In the case of E. lemming, the question regarding the chemotaxis pathway is:<br />
<br />
''How does the output species (CheYp bias) react to perturbations of upstream species?''<br />
<br />
The chemotaxis network represents the main decision factor in bacterial movement and therefore, it received special attention for the [[Team:ETHZ_Basel/Modeling/Experimental_Design|optimal experimental design]]. In order to achieve a more general consensus prediction of the chemotaxis behavior in E. lemming, it was decided to adapt and extend four different models based on published approaches on modeling the chemotaxis pathway [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[3]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]].<br />
<br />
The interface to the light switch model was defined to be the selected Che species, which is linked to one light-sensitive protein (LSP1). Concentration of this species (LSP1-Che) is determined by the [[Team:ETHZ_Basel/Modeling/Light_Switch|light switch model]]. Evaluation of the model based on this approach was conducted by changing the concentration of the selected Che species according to a series of time steps reflecting light pulses. This assumes [[Team:ETHZ_Basel/Modeling/Combined|total removal]] of the species: A red light pulse will activate and dimerize the LSPs and thus result in spatial localization at the anchor and therefore inactivation of the coupled Che protein. In addition to the selected Che species (CheR, B, Y, Z), possible phosphorylated subspecies were analyzed.<br />
<br />
Important for analyzing the chemotaxis network in E. lemming is the concentration of the output species CheYp. Threshold of the difference between the two states after activation by light pulses of CheYp concentration is determined, according to predictions of the [[Team:ETHZ_Basel/Modeling/Movement|movement model]], regarding an optimization of corresponding tumbling / directed movement frequency. For CheR and Y, the CheYp concentration after light pulse induction decreases in relation to the initial value, while for CheB and Z it increases. Manipulation of CheR and Y concentration therefore have an inverse effect on tumbling / directed movement ratio than CheB and Z. The response of the chemotaxis models was measured by taking the relative amplitude in CheYp concentration between two different light pulses.<br />
<br />
Out of the four models of the chemotaxis pathway that our modeling team implemented, only two of them were further investigated in the combined model of E. lemming: Spiro et al. (1997) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]] and Mello & Tu (2003) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]]. These models were chosen not only because they are representative for modeling the chemotaxis pathway, but also because they differ in a few important aspects, as explained later.<br />
<br />
{| border="1" align="center"<br />
|+ '''Statistics of implemented and original models'''<br />
! model based on !! che species !! receptor species<br />
|-<br />
! scope="row" | Spiro et al.<br />
| 6 || 12<br />
|-<br />
! scope="row" | Mello & Tu<br />
| 6 || 15<br />
|-<br />
! scope="row" | Barkai & Leibler<br />
| 2 || 1 (26 forms)<br />
|-<br />
! scope="row" | Rao et al.<br />
| 4 || 10<br />
|-<br />
! scope="row" | original Mello & Tu<br />
| 5 || 15<br />
|}<br />
<br />
== Model based on Spiro et al. (1997) ==<br />
The model based on Spiro et al. (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[1]]] has been used to identify candidates of the chemotaxis receptor pathway by enabling removal or addition of a species upon light induction. For all Che proteins (CheR, Y, B, Z), the concentrations stay below/above the threshold, until they are added again (LSPs are deactivated with far-red light and dimerization is reversed). In terms of aspartate ligand concentration, the best results were obtained for assuming a high ligand concentration (saturation, the methylation level of the receptors is high). For CheY and Z, the reaction times are much faster than for CheB and CheR.<br />
<br />
[[Image:ETHZ_Basel_chemotaxis_spiro_1.png|thumb|center|833px|'''Che protein species predicted by the model based on Spiro et al. (1997)''' CheY is coupled to PIF3. PhyB is present in a concentration of 100 μM, anchor in a concentration of 130 μM. Medium asparate levels (10^-6 uM) were chosen. Red light pulses were induced for 0.3s at times 10s, 200s and 390s; far-red light pulses were induced for 10s at times 50s, 250s and 440s.]]<br />
<br />
{| border="0" align="center"<br />
|- valign="top"<br />
|[[Image:ETHZ_Basel_chemotaxis_spiro_2.png|thumb|center|550px|'''Total Che protein species predicted by the model based on Spiro et al. (1997)''' Only the total concentration of CheY is changed by the light switch in this model.]]<br />
|[[Image:ETHZ_Basel_chemotaxis_spiro_3.png|thumb|250px|'''Response of the system.''' CheYp amplitude is predicted to be high, according to the model based on Spiro et al. (1997).]]<br />
|}<br />
<br />
== Model based on Mello & Tu (2003) ==<br />
The model based on Mello & Tu [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[2]]] differs from the one based on Spiro et al. (1997) in a way that it is able to reach perfect and near-perfect adaptation. Mello & Tu investigated robustness of the chemotaxis receptor network, covering the effect of attractant binding through the phosphorylation of CheY. Governing ODEs are derived by applying the law of mass action to the known reactions. Five states of methylation and demethylation of the attractant-bound and free receptors are considered.<br />
<br />
The published model assumes the binding and unbinding of the ligand to the receptors to be a fast reaction and thus is approximated by a quasi-steady state assumption. Aspartate ligand binding is therefore described by a fraction of total saturation of the chemotaxis receptors. To make it compatible to absolute ligand concentration (as used by the other model), the binding and unbinding reaction rate constants used by Spiro et al. (1997) were used.<br />
<br />
Another adaptation was made, since the receptors in the publication of Mello & Tu (2003) were defined by an algebraic equation. To solve the resulting differential algebraic equations, they were included as additional states with a stable equilibrium to fulfill the algebraic equations.<br />
<br />
The model based on Mello & Tu (2003) shows similar behavior compared to the adapted Spiro et al. (1997) model.<br />
<br />
[[Image:ETHZ_Basel_chemotaxis_mello_1.png|thumb|center|833px|'''Che protein species predicted by the model based on Mello & Tu (2003)''' CheY is coupled to PIF3. PhyB is present in a concentration of 100 μM, anchor in a concentration of 130 uM. Medium asparate levels (10^-6 μM) were chosen. Red light pulses were induced for 0.3s at times 10s, 200s and 390s; far-red light pulses were induced for 10s at times 50s, 250s and 440s.]]<br />
<br />
{| border="0" align="center"<br />
|- valign="top"<br />
|[[Image:ETHZ_Basel_chemotaxis_mello_2.png|thumb|center|550px|'''Total Che protein species predicted by the model based on Mello & Tu (2003).''' The total concentration of CheR is changed in addition to the CheYp concentration in this model.]]<br />
|[[Image:ETHZ_Basel_chemotaxis_mello_3.png|thumb|250px|'''Response of the system.''' The model based on Mello & Tu (2003) predicts a much smaller CheYp amplitude than the model based on Spiro et al. (1997).]]<br />
|}<br />
<br />
== Model based on Rao et al. (2004) == <br />
[[Image:ETHZ_Rao_sensitivity.png|thumb|400px|'''Sensitivity Analysis.''' for the model based on Rao et al. (2004) [3] ]]<br />
The Rao et al. (2004) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[3]]] chemotaxis model combines the two state model proposed for adaptation by Barkai & Leibler (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[4]]] with the model for the phosphorylation cascade proposed by Sourjik and Berg (2002a).<br />
<br />
The receptor methylation is modeled using the method proposed by Barkai & Leibler (1997) with the modifications suggested by Morton-Firth et al. (1999) i.e. CheR binds only to inactive receptors & CheBp binds only to active receptors.<br />
<br />
The predictions are quite a similar behavior of the Che proteins, as demonstrated by Spiro et al (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[1]]]. A notable difference is that the response of CheYp level to the change of the level of the other Che proteins is robust to the fluctuations of the ligand (attractant) concentration. In Spiro et al. (1997), the most desirable results were obtained only for higher concentrations of the ligand.<br />
<br clear="all" /><br />
<br />
== Model based on Barkai & Leibler (1997) ==<br />
<br />
[[Image:Eth_igem_barkai_leibler.png|thumb|400px| '''Near perfect adaptation of the activity level in the chemotaxis pathway as modeled by Barkai & Leibler (1997) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]]'''. The system adapts to successive additions/removals of attractant and the almost exact same steady state value of the system activity is reached soon after the changes in input concentration.]]<br />
<br />
The importance of the two - state chemotaxis network model developed by Barkai & Leibler (1997) lies in the fact that it is the first model to show perfect adaptation over a wide range of parameters (phenomenon also known as '''robust adaptation'''). The model is using a single receptor species (MCPs+CheA+CheW) referred to as 'E', which can be in either one of the two states: 'active' or 'inactive'. The active state is characterized by an increased CheA activity, which phosphorylates CheY, therefore inducing tumbling.<br />
<br />
The output of the model is the overall activity of the complex, calculated as a weighted average of all the individual forms of the receptor complex and their activity probabilities (''i.e.'' the average number of receptors in the active state). This quantity is functionally dependent on the CheYp level and on the kinetic rates of CheY dynamics, but the actual dependency law is not stated. The activity probabilities are depending on the input value and on the methylation level of the complex.<br />
<br />
The receptor complex can exist in either attracted - bound or attracted - free form, it can be successively methylated, up to M methylation sites, and also either in an attractant - bound or attractant - free form. The rates of change of all possibilities resulting from combining the above states render the ODE system proposed by Barkai & Leibler (1997). <br />
<br />
The central assumptions of the model are that CheB can only demethylate active receptors, unlike CheR, which methylates both active and inactive ones, and that the methylation and demethylation reactions have slower timescales than the other processes. <br />
<br />
As CheYp value was not the direct output of Barkai & Leibler (1997) model and the dependency between the activity of the system and its CheYp level was not clearly stated, we decided to use the models developed Spiro et. al [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]] and by Mello & Tu (2003) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], the latter one also reaching near - perfect adaptation, in developing the complete model of E. lemming.<br />
<br />
== Download ==<br />
The chemotaxis models based on Spiro et al. (1997) and Mello & Tu (2003) are included within the [[Team:ETHZ_Basel/Achievements/Matlab_Toolbox|Matlab Toolbox]] and can be downloaded there.<br />
<br />
The chemotaxis models based on Barkai & Leibler (1997) and Rao et al. (2004) are provided as independent implementations and can be downloaded from [http://sourceforge.net/projects/ethzigem10/files/additionalChemotaxis.zip/download here].<br />
<br />
== References ==<br />
[1] [http://www.pnas.org/content/94/14/7263.full Spiro et al: A model of excitation and adaptation in bacterial chemotaxis. PNAS 1997 94;14;7263-7268.]<br />
<br />
[2] [http://www.cell.com/biophysj/retrieve/pii/S0006349503700216 Mello & Tu: Perfect and Near-Perfect Adaptation in a Model of Bacterial Chemotaxis. Biophysical Journal 2003 84;5;2943-2956.]<br />
<br />
[3] [http://www.plosbiology.org/article/info:doi/10.1371/journal.pbio.0020049 Rao et al: Design and Diversity in Bacterial Chemotaxis. PLoS Biol 2004;2;2;239-252.]<br />
<br />
[4] [http://www.nature.com/nature/journal/v387/n6636/abs/387913a0.html Barkai & Leibler: Robustness in simple biochemical networks. Nature 1997;387;913-917.]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Modeling/ChemotaxisTeam:ETHZ Basel/Modeling/Chemotaxis2010-10-27T17:43:13Z<p>Georgerosenberger: /* Background */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Modeling}}<br />
<br />
= Modeling of the chemotaxis pathway =<br />
[[Image:ETHZ_Basel_molecular_che.png|thumb|400px|'''Schematical overview of the light switch device and the interaction with the chemotaxis pathway.''' LSP refers to light switch protein, AP to anchor protein and Che to the attacked protein of the chemotaxis pathway.]]<br />
<br />
== Background ==<br />
[[Image:ETHZ_Basel_chemotactical_network.png|thumb|400px|'''Schematical overview of the chemotaxis pathway.''' MCPs refers to the membrane receptor proteins and Che to the intracellular chemotaxis proteins.]]<br />
<br />
The complex [[Team:ETHZ_Basel/Biology/Molecular_Mechanism|chemotaxis pathway]] in ''E. coli'' has been well analyzed in the modeling literature and, as the following published models [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[3]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]] show, many and different assumptions are necessary in order to answer the investigated questions. In the case of E. lemming, the question regarding the chemotaxis pathway is:<br />
<br />
''How does the output species (CheYp bias) react to perturbations of upstream species?''<br />
<br />
The chemotaxis network represents the main decision factor in bacterial movement and therefore, it received special attention for the [[Team:ETHZ_Basel/Modeling/Experimental_Design|optimal experimental design]]. In order to achieve a more general consensus prediction of the chemotaxis behavior in E. lemming, it was decided to adapt and extend four different models based on published approaches on modeling the chemotaxis pathway [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[3]]], [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]].<br />
<br />
The interface to the light switch model was defined to be the selected Che species, which is linked to one light-sensitive protein (LSP1). Concentration of this species (LSP1-Che) is determined by the [[Team:ETHZ_Basel/Modeling/Light_Switch|light switch model]]. Evaluation of the model based on this approach was conducted by changing the concentration of the selected Che species according to a series of time steps reflecting light pulses. This assumes [[Team:ETHZ_Basel/Modeling/Combined|total removal]] of the species: A red light pulse will activate and dimerize the LSPs and thus result in spatial localization at the anchor and therefore inactivation of the coupled Che protein. In addition to the selected Che species (CheR, B, Y, Z), possible phosphorylated subspecies were analyzed.<br />
<br />
Important for analyzing the chemotaxis network in E. lemming is the concentration of the output species CheYp. Threshold of the difference between the two states after activation by light pulses of CheYp concentration is determined, according to predictions of the [[Team:ETHZ_Basel/Modeling/Movement|movement model]], regarding an optimization of corresponding tumbling / directed movement frequency. For CheR and Y, the CheYp concentration after light pulse induction decreases in relation to the initial value, while for CheB and Z it increases. Manipulation of CheR and Y concentration therefore have an inverse effect on tumbling / directed movement ratio than CheB and Z. The response of the chemotaxis models was measured by taking the relative amplitude in CheYp concentration between two different light pulses.<br />
<br />
Out of the four models of the chemotaxis pathway that our modeling team implemented, only two of them were further investigated in the combined model of E. lemming: Spiro et al. (1997) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]] and Mello & Tu (2003) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]]. These models were chosen not only because they are representative for modeling the chemotaxis pathway, but also because they differ in a few important aspects, as explained later.<br />
<br />
{| border="1" align="center"<br />
|+ '''Statistics of implemented and original models'''<br />
! model based on !! che species !! receptor species<br />
|-<br />
! scope="row" | Spiro et al.<br />
| 6 || 12<br />
|-<br />
! scope="row" | Mello & Tu<br />
| 6 || 15<br />
|-<br />
! scope="row" | Barkai & Leibler<br />
| 2 || 1 (26 forms)<br />
|-<br />
! scope="row" | Rao et al.<br />
| 4 || 10<br />
|-<br />
! scope="row" | original Mello & Tu<br />
| 5 || 15<br />
|}<br />
<br />
== Model based on Spiro et al. (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[1]]] ==<br />
The model based on Spiro et al. (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[1]]] has been used to identify candidates of the chemotaxis receptor pathway by enabling removal or addition of a species upon light induction. For all Che proteins (CheR, Y, B, Z), the concentrations stay below/above the threshold, until they are added again (LSPs are deactivated with far-red light and dimerization is reversed). In terms of aspartate ligand concentration, the best results were obtained for assuming a high ligand concentration (saturation, the methylation level of the receptors is high). For CheY and Z, the reaction times are much faster than for CheB and CheR.<br />
<br />
[[Image:ETHZ_Basel_chemotaxis_spiro_1.png|thumb|center|833px|'''Che protein species predicted by the model based on Spiro et al. (1997)''' CheY is coupled to PIF3. PhyB is present in a concentration of 100 μM, anchor in a concentration of 130 μM. Medium asparate levels (10^-6 uM) were chosen. Red light pulses were induced for 0.3s at times 10s, 200s and 390s; far-red light pulses were induced for 10s at times 50s, 250s and 440s.]]<br />
<br />
{| border="0" align="center"<br />
|- valign="top"<br />
|[[Image:ETHZ_Basel_chemotaxis_spiro_2.png|thumb|center|550px|'''Total Che protein species predicted by the model based on Spiro et al. (1997)''' Only the total concentration of CheY is changed by the light switch in this model.]]<br />
|[[Image:ETHZ_Basel_chemotaxis_spiro_3.png|thumb|250px|'''Response of the system.''' CheYp amplitude is predicted to be high, according to the model based on Spiro et al. (1997).]]<br />
|}<br />
<br />
== Model based on Mello & Tu (2003) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[2]]] ==<br />
The model based on Mello & Tu (2003) differs from the one based on Spiro et al. (1997) in a way that it is able to reach perfect and near-perfect adaptation. Mello & Tu investigated robustness of the chemotaxis receptor network, covering the effect of attractant binding through the phosphorylation of CheY. Governing ODEs are derived by applying the law of mass action to the known reactions. Five states of methylation and demethylation of the attractant-bound and free receptors are considered.<br />
<br />
The published model assumes the binding and unbinding of the ligand to the receptors to be a fast reaction and thus is approximated by a quasi-steady state assumption. Aspartate ligand binding is therefore described by a fraction of total saturation of the chemotaxis receptors. To make it compatible to absolute ligand concentration (as used by the other model), the binding and unbinding reaction rate constants used by Spiro et al. (1997) were used.<br />
<br />
Another adaptation was made, since the receptors in the publication of Mello & Tu (2003) were defined by an algebraic equation. To solve the resulting differential algebraic equations, they were included as additional states with a stable equilibrium to fulfill the algebraic equations.<br />
<br />
The model based on Mello & Tu (2003) shows similar behavior compared to the adapted Spiro et al. (1997) model.<br />
<br />
[[Image:ETHZ_Basel_chemotaxis_mello_1.png|thumb|center|833px|'''Che protein species predicted by the model based on Mello & Tu (2003)''' CheY is coupled to PIF3. PhyB is present in a concentration of 100 μM, anchor in a concentration of 130 uM. Medium asparate levels (10^-6 μM) were chosen. Red light pulses were induced for 0.3s at times 10s, 200s and 390s; far-red light pulses were induced for 10s at times 50s, 250s and 440s.]]<br />
<br />
{| border="0" align="center"<br />
|- valign="top"<br />
|[[Image:ETHZ_Basel_chemotaxis_mello_2.png|thumb|center|550px|'''Total Che protein species predicted by the model based on Mello & Tu (2003).''' The total concentration of CheR is changed in addition to the CheYp concentration in this model.]]<br />
|[[Image:ETHZ_Basel_chemotaxis_mello_3.png|thumb|250px|'''Response of the system.''' The model based on Mello & Tu (2003) predicts a much smaller CheYp amplitude than the model based on Spiro et al. (1997).]]<br />
|}<br />
<br />
== Model based on Rao et al. (2004) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[3]]] == <br />
[[Image:ETHZ_Rao_sensitivity.png|thumb|400px|'''Sensitivity Analysis.''' for the model based on Rao et al. (2004) [3] ]]<br />
This chemotaxis model combines the two state model proposed for adaptation by Barkai & Leibler (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[4]]] with the model for the phosphorylation cascade proposed by Sourjik and Berg (2002a).<br />
<br />
The receptor methylation is modeled using the method proposed by Barkai & Leibler (1997) with the modifications suggested by Morton-Firth et al. (1999) i.e. CheR binds only to inactive receptors & CheBp binds only to active receptors.<br />
<br />
The predictions are quite a similar behavior of the Che proteins, as demonstrated by Spiro et al (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[1]]]. A notable difference is that the response of CheYp level to the change of the level of the other Che proteins is robust to the fluctuations of the ligand (attractant) concentration. In Spiro et al. (1997), the most desirable results were obtained only for higher concentrations of the ligand.<br />
<br clear="all" /><br />
<br />
== Model based on Barkai & Leibler (1997) [[Team:ETHZ Basel/Modeling/Chemotaxis#References|[4]]] ==<br />
<br />
[[Image:Eth_igem_barkai_leibler.png|thumb|400px| '''Near perfect adaptation of the activity level in the chemotaxis pathway as modeled by Barkai & Leibler (1997) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[4]]]'''. The system adapts to successive additions/removals of attractant and the almost exact same steady state value of the system activity is reached soon after the changes in input concentration.]]<br />
<br />
The importance of the two - state chemotaxis network model developed by Barkai & Leibler (1997) lies in the fact that it is the first model to show perfect adaptation over a wide range of parameters (phenomenon also known as '''robust adaptation'''). The model is using a single receptor species (MCPs+CheA+CheW) referred to as 'E', which can be in either one of the two states: 'active' or 'inactive'. The active state is characterized by an increased CheA activity, which phosphorylates CheY, therefore inducing tumbling.<br />
<br />
The output of the model is the overall activity of the complex, calculated as a weighted average of all the individual forms of the receptor complex and their activity probabilities (''i.e.'' the average number of receptors in the active state). This quantity is functionally dependent on the CheYp level and on the kinetic rates of CheY dynamics, but the actual dependency law is not stated. The activity probabilities are depending on the input value and on the methylation level of the complex.<br />
<br />
The receptor complex can exist in either attracted - bound or attracted - free form, it can be successively methylated, up to M methylation sites, and also either in an attractant - bound or attractant - free form. The rates of change of all possibilities resulting from combining the above states render the ODE system proposed by Barkai & Leibler (1997). <br />
<br />
The central assumptions of the model are that CheB can only demethylate active receptors, unlike CheR, which methylates both active and inactive ones, and that the methylation and demethylation reactions have slower timescales than the other processes. <br />
<br />
As CheYp value was not the direct output of Barkai & Leibler (1997) model and the dependency between the activity of the system and its CheYp level was not clearly stated, we decided to use the models developed Spiro et. al [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[1]]] and by Mello & Tu (2003) [[Team:ETHZ_Basel/Modeling/Chemotaxis#References|[2]]], the latter one also reaching near - perfect adaptation, in developing the complete model of E. lemming.<br />
<br />
== Download ==<br />
The chemotaxis models based on Spiro et al. (1997) and Mello & Tu (2003) are included within the [[Team:ETHZ_Basel/Achievements/Matlab_Toolbox|Matlab Toolbox]] and can be downloaded there.<br />
<br />
The chemotaxis models based on Barkai & Leibler (1997) and Rao et al. (2004) are provided as independent implementations and can be downloaded from [http://sourceforge.net/projects/ethzigem10/files/additionalChemotaxis.zip/download here].<br />
<br />
== References ==<br />
[1] [http://www.pnas.org/content/94/14/7263.full Spiro et al: A model of excitation and adaptation in bacterial chemotaxis. PNAS 1997 94;14;7263-7268.]<br />
<br />
[2] [http://www.cell.com/biophysj/retrieve/pii/S0006349503700216 Mello & Tu: Perfect and Near-Perfect Adaptation in a Model of Bacterial Chemotaxis. Biophysical Journal 2003 84;5;2943-2956.]<br />
<br />
[3] [http://www.plosbiology.org/article/info:doi/10.1371/journal.pbio.0020049 Rao et al: Design and Diversity in Bacterial Chemotaxis. PLoS Biol 2004;2;2;239-252.]<br />
<br />
[4] [http://www.nature.com/nature/journal/v387/n6636/abs/387913a0.html Barkai & Leibler: Robustness in simple biochemical networks. Nature 1997;387;913-917.]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Modeling/Light_SwitchTeam:ETHZ Basel/Modeling/Light Switch2010-10-27T17:42:11Z<p>Georgerosenberger: /* Archeal light receptor */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Modeling}}<br />
<br />
= The light switch =<br />
We created two models representing representing the different biological approaches how to control the tumbling frequency of the E. lemming,<br />
* A model representing the [[Team:ETHZ_Basel/Modeling/Light_Switch#Modeling of the PhyB/PIF3 light switch|PhyB/PIF3 based localization]] of proteins of the chemotaxis pathway,<br />
* and a model representing the [[Team:ETHZ_Basel/Modeling/Light_Switch#Archeal light receptor|Archeal light receptor]].<br />
<br />
Both models are part of our E. lemming Matlab Toolbox, which can be downloaded [[Team:ETHZ_Basel/Achievements/Matlab_Toolbox|here]]. The Matlab Toolbox is under the GNU Public license and thus completely free of any charge.<br />
<br />
== Modeling of the PhyB/PIF3 light switch ==<br />
[[Image:ETHZ_Basel_molecular_comb.png|thumb|400px|'''Figure 1: Schematic overview of the devices and change upon light pulse induction.''' LSP refers to light switch protein, AP to anchor protein and Che to the attacked protein of the chemotaxis pathway.]]<br />
<br />
=== Background ===<br />
In our biological setup, the relocation of one of the chemotaxis pathway proteins (either CheR, CheB, CheY or CheZ) is achieved by fusing them to a light-sensitive protein LSP1 (either to PhyB or to PIF3), which dimerizes by red light induction with the corresponding LSP2 (PIF3 or PhyB), fused to a spatially dislocated anchor. Since we decided to implement two different models of the chemotaxis pathway (see section [[Team:ETHZ_Basel/Modeling/Chemotaxis|Chemotaxis Pathway]]), modeling all setups implemented in the wet-lab would have resulted in 16 different models: <br />
<br />
|{CheR, CheB, CheY, CheZ} &times; {PhyB, PIF3} &times; {Model 1, Model 2}|=16.<br />
<br />
Inspired by the modular approach used for the [[Team:ETHZ_Basel/Biology/Cloning|Cloning Strategy]] in the wet-lab, we decided to decrease the combinatorial explosion by also applying a novel modular approach. Not only did this approach reduce the amount of models by a factor of four, it also allowed to widely separate the differential equations of the chemotaxis pathway from those of the light-induced localization system by simultaneously decreasing redundancies and thus decreasing the danger of slip of the pens. The underlying mathematical model for the light-induced relocation was completely developed by us (for a short discussion of the recently by Sorokina et al. published light-induced relocation system and why we did not use it, see [[Team:ETHZ_Basel/Modeling/Sorokina|here]]) as well as - to our knowledge - the approach to couple this model to models of the chemotaxis pathway.<br />
<br />
=== Assumptions ===<br />
The following assumptions have been made according to the [[Team:ETHZ_Basel/Biology/Molecular_Mechanism| molecular mechanism]] to link the light switch and chemotaxis models:<br />
<br />
* Upon red light pulse induction, the two light-sensitive protein (LSP1 and LSP2) domains can hetero-dimerize. <br />
* The TetR-LSP2 can bind to the operator (tetO) on the DNA. <br />
* Only after both reactions took place, we assume the Che protein to be spatially dislocated. This means<br />
** CheR-LSP1 is not able to methylate the MCPs anymore,<br />
** CheY-LSP1 can't be phosphorylated and interact with the motor anymore; nevertheless, it still can be dephosphorylated.<br />
** CheB-LSP1 is not able to demethylate the MCPs and can't be phosphorylated anymore, but still can be dephosphorylated,<br />
** CheZ-LSP1 can't dephosphorylate CheY anymore (This assumption is very unsteady, since CheY is not strictly located).<br />
* If only one of the reactions took place, we assume that the localization and activity of the fusion proteins are the same as for wild-type cells.<br />
<br />
All of these assumptions will lead to a decrease of tumbling / directed movement ratio upon red light induction and an increase of corresponding far-red light induction.<br />
<br />
=== Facing the Combinatorial Explosion ===<br />
The main problem in separating <i>in silico</i> the chemotaxis pathway from the light-induced relocation system is the non-existence of a hierarchical relationship between the two sub-models: The properties of the chemotaxis pathway are clearly influenced if the ''active'' concentration of one of its key species drops, such that giving the amount of localized proteins, obtained by the localization model, as an input to the chemotaxis model is a natural conclusion. However, also the concentration of the localized species of the localization model change depending on the reactions in the chemotaxis model, since several of the Che proteins are modeled as two or more molecular species. The CheY protein for example is modeled as two species, one representing the phosphorylated and one the non-phosphorylated molecular concentration. Thus, the two models cannot be represented as e.g. a hierarchical block structure, which is making a modular approach significant more complicated.<br />
<br />
Our approach to modularize the model is based on an observation of the reaction directions which can take place in the overall model. For example, Figure 2 shows all eight species which have to be implemented to adequately describe the localization and phosphorylation states of CheY when fused to PhyB (the reactions taking place without CheY-PhyB, as for example the binding and unbinding of the PIF3-TetR monomer to tetO, are not depicted for simplicity). As can be seen, the reactions of the chemotaxis pathway and the reactions of the light model have different directions. The reactions of the light model are horizontal and independent of the phosphorylation level of CheY. On the other hand, the reactions of the chemotaxis model are vertically. However, one of the reactions of the chemotaxis model is not independent of the states mainly influenced by the light model: When CheY is localized at the DNA, the receptor complex cannot transfer a phosphor to it anymore. The respective species diagrams for the other three species (CheZ, CheB, CheR) as well as for the other light model (the Che protein is fused to PIF3 instead of PhyB) look similar, although the number of rows and columns can change.<br />
[[Image:ETHZ_Basel_chemotaxis_CheYSpecies.jpg|thumb|center|550px|'''Different species representing different localization and phosphorylation states of CheY.]]<br />
<br />
We used this regularity to modularize the overall model: A variable table of states representing the concentration of all Che proteins in their different phosphorization and localization modes is shared between the light model and the chemotaxis model. The number of rows of this table is dynamically determined by the chemotaxis model and the number of columns is determined by the light model, depending on the choice of which Che protein is fused to which light sensitive protein. The light model may only change the distribution of the species in each row, but may not change their sum (conservation relation). The chemotaxis model on the other hand may only change the distribution of the species concentration in each column. Although the tables may have different sizes, always the last column is representing the localized proteins. The chemotaxis model thus only applies a subset of reactions to this row, as mentioned in the assumptions. <br />
<br />
All other species of both models are not shared between the two models, which also in any other way as mentioned above act independently. Using this approach we succeeded in uncoupling the model of the PhyB/PIF3 system from the model of the chemotaxis pathway, reducing the amount of redundancy and possible error sources significantly.<br />
<br />
== Archeal light receptor ==<br />
Another way we considered to implement the light switch was to fuse an archaeal photoreceptor to the E. coli chemotactic transducer. i.e. we replaced the usual receptor of E. coli that binds & is activated by chemo-attractant, with a receptor that is activated by blue-green light as demonstrated by Jung et al. (2001) [[Team:ETHZ Basel/Modeling/Light_Switch#References|[1]]].<br />
<br />
For this we could use our already [[Team:ETHZ_Basel/Modeling/Chemotaxis|implemented chemotaxis models]]. We picked the chemotaxis model suggested by [[Team:ETHZ_Basel/Modeling/Chemotaxis|Mello & Tu (2003), for which we already have an implementation]] in our [[Team:ETHZ_Basel/Achievements/Matlab_Toolbox|MATLAB]] tool box. We only had to replace the the interaction between the chemo-attractant and the receptor with a similar interaction between light and the receptor which gives rise to the same set of events down stream of the chemotaxis path way.<br />
<br />
The strategy to model this interaction was to define the dynamic receptor occupancy as a function of the light input. This directly corresponds to the receptor occupancy in the usual case with the usual chemo receptor, which is a function of the chemo attractant. The receptor occupancy reflects the fraction of receptors activated by the stimulus (chemo attactant or light).<br />
<br />
== References ==<br />
[1] [http://jb.asm.org/cgi/reprint/183/21/6365?maxtoshow=&hits=10&RESULTFORMAT=1&andorexacttitle=and&andorexacttitleabs=and&fulltext=An+archaeal+photosignal-transducing+module+mediates+phototaxis+in+%27%27Escherichia+&andorexactfulltext=and&searchid=1&FIRSTINDEX=0&sortspec=relevance&resourcetype=HWCIT: Jung et al: An Archaeal Photosignal-Transducing Module Mediates Phototaxis in Escherichia coli]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T17:40:43Z<p>Georgerosenberger: /* Safety */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Safety =<br />
<br />
''What does safety mean to us?''<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety] guideline and its key questions for our documentation:<br />
<br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strains. Furthermore, we have special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project.<br />
<br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
<br />
<br />
= References =<br />
[1] [https://2010.igem.org/Safety iGEM Safety Page]<br />
<br />
[2] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en Swiss Legal Bases Biotechnology]<br />
<br />
[3] [http://www.sicherheit.ethz.ch/ Safety at ETH (german)]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T17:40:31Z<p>Georgerosenberger: /* Safety questions */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Safety =<br />
<br />
''What does safety mean to us?''<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety] guideline and its key questions for our documentation:<br />
<br />
<br />
<br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strains. Furthermore, we have special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project.<br />
<br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
<br />
<br />
= References =<br />
[1] [https://2010.igem.org/Safety iGEM Safety Page]<br />
<br />
[2] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en Swiss Legal Bases Biotechnology]<br />
<br />
[3] [http://www.sicherheit.ethz.ch/ Safety at ETH (german)]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/Molecular_MechanismTeam:ETHZ Basel/Biology/Molecular Mechanism2010-10-27T17:36:42Z<p>Georgerosenberger: /* Chemotaxis network: Che proteins */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Molecular Mechanism =<br />
<br />
== Chemotaxis network: Che proteins ==<br />
[[Image:ETHZ_Basel_chemotactical_network.png|thumb|400px|'''Schematic overview of the chemotaxis pathway.''' MCPs refers to the membrane receptor proteins and Che to the intracellular chemotaxis proteins.]]<br />
[[Image:ETHZ_Basel_CHE proteins.png|thumb|400px|'''Meet the Che's!''' An overview of the Che proteins used to build the E. lemming. Color code: CheR=red, CheB=yellow, CheY=orange, CheW=cyan, CheA=green, CheY/CheZ complex=purple. On the right, the surface structure is shown, on the left the tertiary and quartenary structure. Functional subdomains, ligands and side chains not shown, not sized relatively to each other[9].]]<br />
<br />
The '''chemotaxis signaling network''' is required for the directed movement of bacteria, as a response to changes in the extracellular concentration of chemoattractants or chemorepellents. The concentration change can be seen as an input signal, which is subsequently integrated and converted into a response. The change in direction (or more specifically, the change in the angular momentum) can therefore be understood as a function of extracellular inputs, such as a chemical gradient or a light pulse. The two types of movement that the bacterium can employ are '''tumbling''' (i.e. change in angle and no change in spatial coordinates), occurring when the bacterium does not sense an increase in attractant concentration and '''directed movement''' ( i.e. change in position and slight change in angle), occurring when the attractant concentration is sensed as increasing. Those stimuli are then administered in the chemotaxis network and this produces an output, preferably in such a way, that the bacterium is directed right to the attractant or far away from the repellent. In ''E. coli'', these two types of movements can be mechanistically distinguished by their different rotation directions of the flagellar Mot (motor) proteins (clockwise: tumbling; counter-clockwise: directed movement). <br />
<br />
This network consists of membrane-associated proteins (methyl accepting chemotaxis proteins: MCPs) and soluble (intracellular) proteins (Che) as signal transducers and receptors. MCPs can sense even a minimal change in concentration (input) and transduce this information unit to the respective proteins '''CheW''' and '''CheA''', which are located inside the cell. The autophosphorylation of CheA mediated by the MCPs is the key step in tumbling induction in response to increased repellent or decreased attractant concentration. The methylation state of the MCPs is influenced by the methyltransferase '''CheR''' (transfers a methylgroup to a protein) and the Demethylase '''CheB'''(cleaves a methyl group off a protein). CheA phosphorylates CheY which then freely diffuses (as CheYp) through the cytoplasm to the flagellar motor protein FliM, where it induces tumbling as a response. The phosphatase '''CheZ''' regulates the signal termination via dephosphorylation of CheYp (the p stands for the phosphorylated form of CheY).<br />
<br />
CheY and CheYp, respectively, act as a '''mechanistic switch''' between the tumbling state and the directed movement. This molecular behavior of the protein can be utilized for artificially introducing switching between those two states. When browsing the following pages, you will be introduced to the implementation of our wish, to even use this switch remotely! <br />
<br />
[[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[5]]].<br />
<br />
The [https://2010.igem.org/Team:ETHZ_Basel/Modeling/Movement movement model] developed by our team simulates the motility of E. coli, by probabilistically switching between the two states: directed movement and tumbling, as a function of the CheYp concentration received as input from the [https://2010.igem.org/Team:ETHZ_Basel/Modeling/Chemotaxis chemotaxis pathway model].<br />
<br />
== Light activated system: PhyB-Pif3 ==<br />
In plants and some bacteria, members of the phytochrome family (photoreceptors) regulate phototaxis, photosynthesis and production of protective pigments in response to light stimuli. The chromophore is encoded in the N-terminal domain of the protein [[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[1]]].<br />
There are two mayor types of Phytochromes, type I (PhyA) and type II ('''PhyB''' and PhyC) [2, p.142]. Both exist in a '''biologically inactive form Pr absorbing red light''' and an '''active configuration Pfr which absorbs far-red light''', using a covalently attached Tetraphyrrole chromophore for light absorption [[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[5]]]. The interconversion between these two states takes only milliseconds [[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[3]]]. While the Pr form is very stable (half live of about 100h), the Pfr form, in contrast, is quickly degraded (type I half-life between 30min and 2h, type II half live around 8h) [[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[2]]]<br />
<br />
Light-switchable gene systems often are based on the '''Phytochrome interacting factor Pif3''', a basic protein with a helix-loop-helix motif, which switches on light-induced gene expression. The N-Terminus of Pif3 selectively binds the Prf form of the phytochrome and rapidly dissociates in response to reconversion to the Pr state [[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[3]]]. <br />
<br />
For the design of a light-activated system in Bacteria, one has to consider that chromophores such as phycocyanobilin PBS do not naturally occur; therefore, in order to start expression of light-inducable genes, chromophores either have to be added to the medium or two genes for its biosynthesis (starting from Haem) have to be introduced to the prokaryotic genome. [[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[4]]]. Furthermore, attention must be paid, because phyotochromes in their Prf state in plants can form sequesters in the timescale of seconds! [[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[2]]].<br />
<br />
== Spatial localization in a bacterial cell: Anchor proteins TrigA, MreB and tetR==<br />
{| border="0" align="center"<br />
|- valign="top" -halign="center"<br />
|[[Image:ETHZ_Basel_biology_anchor_tet.png|thumb|center|300px|'''Spatial localization in a bacterial cell using Tet:''' Tet repressor bound to it's operator on a high copy plasmid.]]<br />
|[[Image:ETHZ_Basel_biology_anchor_ribosome.png|thumb|center|300px|'''Spatial localization in a bacterial cell using Ribosomes:''' Ribosome binding domain of trigger factor bound to the large subunit of the ribosome.]]<br />
|[[Image:ETHZ_Basel_biology_anchor_mreb.png|thumb|center|300px|'''Spatial localization in a bacterial cell using MreB protofilament.''']]<br />
|}<br />
<br />
By spatial localization of one Che protein (Che binds to a specific cellular component and is anchored), the tumbling frequency of a bacterial cell can be manipulated. We decided to focus on three different anchors that will be fused to one light sensitive protein LSP, which dimerizes upon light stimulus with it's LSP partner that is bound to a Che-protein. Therefore, upon light signal, the Che-protein is localized in the cell.<br />
<br />
<br />
The three anchors are:<br />
*the '''tetracyclin repressor tetR''', which binds to it's operator tetO (present on a high copy vector in the cell) [[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[6]]] <br />
*the ribosome binding domain of the '''trigger factor trigA''' that binds to the large subunit of the ribosome [[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[7]]]. <br />
*The '''prokaryotic actin homologue MreB''' which anchors the Che protein to the cell wall [[Team:ETHZ_Basel/Biology/Molecular_Mechanism#References|[8]]]. <br />
<br />
<br />
Upon a light stimulus, the light-sensitive proteins LSPs dimerize (photodimerization) and therefore spatially localize the Che-protein. This greatly affects the activity of the Che downstream partners as Che is then no longer available for signal transduction (the intracellular concentration of free Che drastically decreases). '''Thus, these anchors enable us to induce and repress the directed movement or tumbling of the flagellar machine'''.<br />
<br />
<br />
[[Image:ETHZ_Basel_TrigA, MreB and TetR.png|thumb|center|500px|'''Watch TrigA, MreB and tetR getting naked!''' The A-terminal ribosome-binding domain of the ''E. coli'' trigger factor (a chaperone, which helps in co-translational protein folding), the prokaryotic actin homologue MreB (a structural protein, which forms F-actin-like strands and is crucial for cell form determination) and the bacterial tetracycline repressor TetR (the resistance protein TetA, found in gram-negative bacteria is responsible for tetracycline efflux) are used as building blocks of E. lemming's chemotaxis pathway. TrigA=pink, MreB=purple, tetR=blue [9].]]<br />
<br />
== References ==<br />
[1] [http://www.nature.com/nbt/journal/v20/n10/abs/nbt734.html Sato, Hug, Tepperman and Quail: A light-switchable gene promoter system. Nature Biotechnology. 2002; 20.]<br />
<br />
[2] [http://books.google.ch/books?hl=de&lr=&id=BfnKE98pTXMC&oi=fnd&pg=PR8&dq=Photomorphogenesis+in+plants&ots=23AEp7R78F&sig=9SXToaZr0ie6w6ooQb_9rs5IFrM#v=onepage&q&f=false Kendrick and Kronenberg: Photomorphogenesis in plants. Kluwer academic publishers, Dordrecht, The Netherlands. 2nd edition, 1994.]<br />
<br />
[3] [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6TCW-47BX7M3-1&_user=791130&_coverDate=02/28/2003&_rdoc=2&_fmt=high&_orig=browse&_origin=browse&_zone=rslt_list_item&_srch=doc-info(%23toc%235181%232003%23999789997%23384698%23FLA%23display%23Volume)&_cdi=5181&_sort=d&_docanchor=&_ct=10&_acct=C000043379&_version=1&_urlVersion=0&_userid=791130&md5=8b3d8707b40c1250ede257b97c0346fe&searchtype=a Keyes and Mills: Inducible systems see light. Trends in Biotechnology. 2003; 21:2.]<br />
<br />
[4] [http://www.nature.com/nature/journal/v438/n7067/abs/nature04405.html Levskaya, Chevalier, Tabor, Simpson, Lavery, Levy, Davidson, Scourast, Ellington, Marcotte and Voigt: Engineering Escherichia coli to see light. Nature Brief Communications. 2005, 438.]<br />
<br />
[5] [http://www.springerlink.com/content/f602r72767124602/ M.J. Tindall, S.L. Porter, P.K. Maini, G. Gaglia, J.P. Armitage. Overview of Mathematical Approaches Used to Model Bacterial Chemotaxis I: The Single Cell. Bulletin of Mathematical Biology (2008) 70: 1525–1569.]<br />
<br />
[6] [http://onlinelibrary.wiley.com/doi/10.1111/j.1751-7915.2007.00001.x/full Bertram and Hillen: The application of Tet repressor in prokaryotic gene regulation and expression. Microbial Biotechnology. 2008; 1:1.]<br />
<br />
[7] [http://www.jbc.org/content/272/35/21865.full Hesterkamp, Deuerling and Bukau: The Amino-terminal 118 amino acids of Escherichia coli Trigger factor constitute a domain that is necessary and sufficient for binding to ribosomes. The Journal of Biologcial Chemistry. 1997; 272:35.]<br />
<br />
[8] [http://onlinelibrary.wiley.com/doi/10.1111/j.1365-2958.2004.04367.x/full Kruse, Bork-Jensen and Gerdes: The morphogenetic MreBCD proteins of Escherichia coli form an essential membrane-bound complex. Molecular Microbiology. 2005;55:1.]<br />
<br />
[9] [http://www.pdb.org/pdb/home/home.do: RSCB Protein Data Bank and respective publications:]<br />
[http://www.rcsb.org/pdb/explore/explore.do?structureId=1A2O: CheB_1A20]<br />
[http://www.rcsb.org/pdb/explore/explore.do?structureId=1AF7: CheR_1AF7]<br />
[http://www.rcsb.org/pdb/explore/explore.do?structureId=3GWG: CheY_3GWG]<br />
[http://www.rcsb.org/pdb/explore/explore.do?structureId=2HO9: CheW_2HO9]<br />
[http://www.rcsb.org/pdb/explore/explore.do?structureId=1I5D: CheA_1I5D]<br />
[http://www.rcsb.org/pdb/explore/explore.do?structureId=1I5D: CheY/CheZ complex_1I5D]<br />
[http://www.pdb.org/pdb/explore/explore.do?structureId=1JCE: MreB_1JCE]<br />
[http://www.pdb.org/pdb/explore/explore.do?structureId=2XB5: TetR_2XB5]<br />
[http://www.pdb.org/pdb/explore/explore.do?structureId=1W26: TrigA_1W26]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/BiologyTeam:ETHZ Basel/Biology2010-10-27T17:35:06Z<p>Georgerosenberger: /* Biology & Wet Lab: Overview */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Biology & Wet Laboratory: Overview =<br />
<br />
<br />
<html><br />
<div class="thumb tright"><div class="thumbinner" style="width:402px;"><br />
<iframe title="YouTube video player" class="youtube-player" type="text/html" width="400" height="325" src="http://www.youtube.com/embed/yQdX8o8i_uc?hd=1" frameborder="0"></iframe><br />
<div class="thumbcaption"><div class="magnify"><a href="http://www.youtube.com/watch?v=yQdX8o8i_uc?hd=1" class="external" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div><b>Molecular mechanism of E. lemming.</b> A light-sensitive dimerizing complex fused to proteins of the chemotaxis pathway at a spatially fixed location is induced by light pulses and therefore localization of the two molecules can be manipulated.</div></div></div><br />
</html><br />
<br />
The core idea of E. lemming is based on the '''spatial localization''' of one of the species of the chemotaxis network, so called '''Che proteins'''. Phosphorylated CheY (further referred to as CheYp) binds to the flagellar motor protein FliM, where it induces tumbling. Our research aimed at gaining control over this molecular switch and thus over the [https://2010.igem.org/Team:ETHZ_Basel/Modeling/Movement: flagellar machine]. Through localizing (intracellular anchoring), the effective concentration of the free cytosolic CheY protein is decreased at its site of action, greatly affecting the activity on its downstream partners. Anchoring is achieved with the help of '''light-sensitive proteins (LSPs)''' that dimerize upon a light signal (photodimerization). The Che protein is fused to LSP1, while its binding partner LSP2 is itself fused to a so called '''anchor protein'''. Dimerization of the two LSPs into an LSP1/LSP2 complex, where LSP1 is still bound to CheY, results in spatial re-localization of the Che protein, which, as a final measurable output, induces a change in the ratio between tumbling and directed flagellar movement. The general idea is nicely represented by the video on the right side. Read more about the [[Team:ETHZ_Basel/Biology/Molecular_Mechanism|'''Molecular mechanism''']].<br />
<br />
<br />
A second approach for the design of E. lemming is the usage of a photoreceptor connected to the bacterial chemotaxis system. Find out more about the [[Team:ETHZ_Basel/Biology/Archeal_Light_Receptor|'''Archeal Light Receptor''']] that enabled us to '''successfully''' implement the light-inducible synthetic network via the fusion of archeal and eubactarial parts. <br />
<br />
<br />
The fusion proteins were constructed according to the [[Team:ETHZ_Basel/Biology/Cloning|'''Cloning Strategy BBF RFC28''']], a method for the combinatorial multi-part assembly based on the type II restriction enzmye AarI.<br />
<br />
<br />
In the section [[Team:ETHZ_Basel/Biology/Implementation|'''Implementation''']], you find details on the experimental design such as the ideal conditions for the observation of chemotaxis behavior (strain, media, growth temperature, growth phase etc.) and the functionality and expression level assays of the fusion proteins.<br />
<br />
<br />
Of course, we also reflected a lot about [[Team:ETHZ_Basel/Biology/Safety|'''Human Practices and Safety''']] during our project, because knowledge also means responsibility. This section summarizes our findings on potential risks and safety issues and the measures we have taken in order to work as safely as possible..</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T17:13:26Z<p>Georgerosenberger: /* Safety */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Safety =<br />
<br />
''What does safety mean to us?''<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety] guideline and its key questions for our documentation:<br />
<br />
== Safety questions ==<br />
<br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strains. Furthermore, we have special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project.<br />
<br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
<br />
<br />
= References =<br />
[1] [https://2010.igem.org/Safety iGEM Safety Page]<br />
<br />
[2] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en Swiss Legal Bases Biotechnology]<br />
<br />
[3] [http://www.sicherheit.ethz.ch/ Safety at ETH (german)]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T17:08:46Z<p>Georgerosenberger: /* References */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Safety =<br />
<br />
<br />
What does safety mean to us?<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety] guideline and its key questions for our documentation:<br />
<br />
== Safety questions ==<br />
<br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strands. Furthermore, we have (as most other labs) special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project.<br />
<br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
<br />
<br />
= References =<br />
[1] [https://2010.igem.org/Safety iGEM Safety Page]<br />
<br />
[2] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en Swiss Legal Bases Biotechnology]<br />
<br />
[3] [http://www.sicherheit.ethz.ch/ Safety at ETH (german)]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T17:07:00Z<p>Georgerosenberger: /* == */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Safety =<br />
<br />
<br />
What does safety mean to us?<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety] guideline and its key questions for our documentation:<br />
<br />
== Safety questions ==<br />
<br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strands. Furthermore, we have (as most other labs) special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project.<br />
<br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
<br />
<br />
= References =<br />
[1] [https://2010.igem.org/Safety iGEM Safety Page]<br />
<br />
[2] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en: Swiss Legal Bases Biotechnology]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T17:06:49Z<p>Georgerosenberger: /* References */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Safety =<br />
<br />
<br />
What does safety mean to us?<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety] guideline and its key questions for our documentation:<br />
<br />
== Safety questions ==<br />
<br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strands. Furthermore, we have (as most other labs) special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project.<br />
<br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
======<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
<br />
<br />
= References =<br />
[1] [https://2010.igem.org/Safety iGEM Safety Page]<br />
<br />
[2] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en: Swiss Legal Bases Biotechnology]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T17:06:22Z<p>Georgerosenberger: /* Safety */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Safety =<br />
<br />
<br />
What does safety mean to us?<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety] guideline and its key questions for our documentation:<br />
<br />
== Safety questions ==<br />
<br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strands. Furthermore, we have (as most other labs) special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project.<br />
<br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
======<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
<br />
<br />
= References =<br />
<br />
[1] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en: Swiss Legal Bases Biotechnology]<br />
[2] [https://2010.igem.org/Safety iGEM Safety Page]</div>Georgerosenbergerhttp://2010.igem.org/Template:ETHZ_Basel10_BiologyTemplate:ETHZ Basel10 Biology2010-10-27T17:05:25Z<p>Georgerosenberger: </p>
<hr />
<div><html><br />
<div id="navigation"><br />
<ul id="simple-menu"><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel" class="introduction"><span>Introduction</span></a></li><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/Biology" class="biology_current"><span>Biology & Wet Laboratory</span></a></li><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/Modeling" class="modeling"><span>Mathematical Modeling</span></a></li><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/InformationProcessing" class="information"><span>Information Processing</span></a></li><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/Achievements" class="achievements"><span>Achievements</span></a></li><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/Team" class="team"><span>Team</span></a></li><br />
</ul><br />
</div><br />
<div id="subnavigation" class="biology"><br />
<ul id="sub-menu"><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/Biology"><span>Overview</span></a></li><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/Biology/Molecular_Mechanism"><span>Molecular Mechanism</span></a></li><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/Biology/Archeal_Light_Receptor"><span>Archeal Light Receptor</span></a></li><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/Biology/Cloning"><span>Cloning Strategy</span></a></li><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/Biology/Implementation"><span>Implementation</span></a></li><br />
<li><a href="https://2010.igem.org/Team:ETHZ_Basel/Biology/Safety"><span>Safety</span></a></li><br />
</ul><br />
</div><br />
<script language="javascript">setPage()</script> <br />
</html></div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T17:05:07Z<p>Georgerosenberger: /* Human Practices & Safety */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Safety =<br />
<br />
<br />
What does safety mean to us?<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety:Safety] guideline and its key questions for our documentation:<br />
<br />
== Safety questions ==<br />
<br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strands. Furthermore, we have (as most other labs) special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project.<br />
<br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
======<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
<br />
<br />
= References =<br />
<br />
[1] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en: Swiss Legal Bases Biotechnology]<br />
[2] [https://2010.igem.org/Safety iGEM Safety Page]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T17:04:43Z<p>Georgerosenberger: /* Answer */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Human Practices & Safety =<br />
<br />
<br />
What does safety mean to us?<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety:Safety] guideline and its key questions for our documentation:<br />
<br />
== Safety questions ==<br />
<br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strands. Furthermore, we have (as most other labs) special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project.<br />
<br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
======<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
<br />
<br />
= References =<br />
<br />
[1] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en: Swiss Legal Bases Biotechnology]<br />
[2] [https://2010.igem.org/Safety iGEM Safety Page]</div>Georgerosenbergerhttp://2010.igem.org/Team:ETHZ_Basel/Biology/SafetyTeam:ETHZ Basel/Biology/Safety2010-10-27T17:04:23Z<p>Georgerosenberger: /* Safety questions */</p>
<hr />
<div>{{ETHZ_Basel10}}<br />
{{ETHZ_Basel10_Biology}}<br />
<br />
= Human Practices & Safety =<br />
<br />
<br />
What does safety mean to us?<br />
<br />
The understanding of safety guidelines, the reflection on related issues and the respect of those practices is tremendously important for us.<br />
During the process of our work, we therefore continuously discussed and reasoned about potential ethical and safety problems, which could arise from our project. We always strictly follow safety practices guidelines in the lab and respect all the rules and regulations. But this is not enough. This page represents our reflection on an issue, that too often gets forgotten. We use the iGEM [https://2010.igem.org/Safety:Safety] guideline and its key questions for our documentation:<br />
<br />
== Safety questions ==<br />
<br />
== 1. Question ==<br />
Would any of your project ideas raise safety issues in terms of:<br />
* researcher safety,<br />
* public safety, or<br />
* environmental safety?<br />
<br />
===Answer===<br />
* Researcher safety: No. The use of certain chemicals is inevitable for carrying our our assays, but we wear gloves, safety googles and a lab coat for protection. <br />
* Public and environmental safety: No, there is no environmental threat originating from our activities. We exclusively work with non-pathogenic strands. Furthermore, we have (as most other labs) special waste containers for biologically and chemically hazardous material and we do not introduce any potentially harmful material into the environment. Even the air in our lab is filtrated before being released.<br />
<br />
== 2. Question ==<br />
Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues? If yes,<br />
* did you document these issues in the Registry?<br />
* how did you manage to handle the safety issue?<br />
* How could other teams learn from your experience?<br />
<br />
===Answer===<br />
No, our BioBricks are not a matter of concern at all.<br />
<br />
== 3. Question==<br />
Is there a local biosafety group, committee, or review board at your institution?<br />
* If yes, what does your local biosafety group think about your project?<br />
* If no, which specific biosafety rules or guidelines do you have to consider in your country?<br />
<br />
===Answer===<br />
Before starting with the wet lab work, we consulted all relevant sections in the [http://www.parlament.ch/e/wissen/li-bundesverfassung/pages/default.aspx: Swiss Federal Constitution] and it appears to us that our project does not raise any safety issues. There are a few general (chemical and biological safety) agencies, but these are not enough specialized institutions for evaluating our iGEM research project. <br />
Instead, it seemed reasonable to us, to discuss the project with our professor Sven Panke, who is a member of the [http://www.synbiosafe.eu/index.php?page=advisory-board: External Advisory Board] of [http://www.synbiosafe.eu/: Synbiosafe] and has therefore much expertise in this area. We together reflected about the safety issues our project could potentially give rise to and after careful evaluation, we came to the conclusion that this does not harm nor the researchers, nor the social or natural environment.<br />
Of course, we additionally take all precautionary measures which are appropriate when working in a laboratory!<br />
<br />
== 4. Question==<br />
======<br />
Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? <br />
* How could parts, devices and systems be made even safer through biosafety engineering?<br />
<br />
===Answer===<br />
A commonly shared concern in biosafety is the idea, that GMO's could be released to the natural environment, where wildtype bacteria could acquire novel pathogenic tools via horizontal gene transfer. Such bacterial strains, providing a powerful toolbox, which could quickly multiply pathogenity, must be designed in such a way, that they can neither survive in a natural environment (outside the lab), nor contaminate it with the engineered sequences, so that their genetic toolbox cannot be spread through evolutionary mechanisms.<br />
<br />
= Safety considerations in Switzerland and at ETH Zurich =<br />
<br />
<br />
<br />
= References =<br />
<br />
[1] [http://www.bafu.admin.ch/biotechnologie/02618/index.html?lang=en: Swiss Legal Bases Biotechnology]<br />
[2] [https://2010.igem.org/Safety iGEM Safety Page]</div>Georgerosenberger