http://2010.igem.org/wiki/index.php?title=Special:Contributions/Blackrabbit&feed=atom&limit=50&target=Blackrabbit&year=&month=2010.igem.org - User contributions [en]2024-03-19T10:54:14ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-28T03:44:34Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><table><tr><td><embed src="https://static.igem.org/mediawiki/2010/5/58/NYMU_SpeedyBac_ani.mov" width="640" height="480"></td><td></html><br />
Project overview animation: SpeedyBac<br />
#There are three devices in our SpeedyBac system:<br />
#* Speedy Reporter<br />
#* Speedy Switch<br />
#* Speedy Protein Degrader<br />
# When the promoter is induced, transcription starts.<br />
# The speedy reporter will light up immediately when binding to RNA aptamer.<br />
# When induced, the Speedy switch changes its confirmation and translation starts.<br />
# In the end, the Speedy degrader will cause the remaining proteins to degrade faster.<br />
<html></td></tr></table></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Attributions and Contributions</font> =<br />
The idea SpeedyBac was chosen and designed by the students. The experiments were done all by the students. The advisors and instructors only instructed. The breakdown of who participated in which subteam is shown on our [[Team:NYMU-Taipei/Team|Team]] page.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-28T03:42:07Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><table><tr><td><embed src="https://static.igem.org/mediawiki/2010/5/58/NYMU_SpeedyBac_ani.mov" width="640" height="480"></td><td></html><br />
Project overview animation: SpeedyBac<br />
#There are three devices in our SpeedyBac system:<br />
#* Speedy Reporter<br />
#* Speedy Switch<br />
#* Speedy Protein Degrader<br />
# When the promoter is induced, transcription start.<br />
# The speedy reporter will light up immediately when binding to RNA aptamer.<br />
# When induced, the Speedy switch changes its confirmation and translation starts.<br />
# In the end, the Speedy degrader will cause the remaining proteins to degrade faster.<br />
<html></td></tr></table></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Attributions and Contributions</font> =<br />
The idea SpeedyBac was chosen and designed by the students. The experiments were done all by the students. The advisors and instructors only instructed. The breakdown of who participated in which subteam is shown on our [[Team:NYMU-Taipei/Team|Team]] page.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-28T03:40:16Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><table><tr><td><embed src="https://static.igem.org/mediawiki/2010/5/58/NYMU_SpeedyBac_ani.mov" width="640" height="480"></td></tr><tr><td></html><br />
Project overview animation: SpeedyBac<br />
#There are three devices in our SpeedyBac system:<br />
#* Speedy Reporter<br />
#* Speedy Switch<br />
#* Speedy Protein Degrader<br />
# When the promoter is induced, transcription start.<br />
# The speedy reporter will light up immediately when binding to RNA aptamer.<br />
# When induced, the Speedy switch changes its confirmation and translation starts.<br />
# In the end, the Speedy degrader will cause the remaining proteins to degrade faster.<br />
<html></td></tr></table></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Attributions and Contributions</font> =<br />
The idea SpeedyBac was chosen and designed by the students. The experiments were done all by the students. The advisors and instructors only instructed. The breakdown of who participated in which subteam is shown on our [[Team:NYMU-Taipei/Team|Team]] page.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-28T03:37:48Z<p>Blackrabbit: /* Animated Project Overview */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><table><tr><td><embed src="https://static.igem.org/mediawiki/2010/5/58/NYMU_SpeedyBac_ani.mov" width="640" height="480"></td></tr><tr><td><br />
Project overview animation: SpeedyBac<br />
#There are three devices in our SpeedyBac system:<br />
#* Speedy Reporter<br />
#* Speedy Switch<br />
#* Speedy Protein Degrader<br />
# When the promoter is induced, transcription start.<br />
# The speedy reporter will light up immediately when binding to RNA aptamer.<br />
# When induced, the Speedy switch changes its confirmation and translation starts.<br />
# In the end, the Speedy degrader will cause the remaining proteins to degrade faster.<br />
</td></tr></table></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Attributions and Contributions</font> =<br />
The idea SpeedyBac was chosen and designed by the students. The experiments were done all by the students. The advisors and instructors only instructed. The breakdown of who participated in which subteam is shown on our [[Team:NYMU-Taipei/Team|Team]] page.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-28T03:35:19Z<p>Blackrabbit: /* Animated Project Overview */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><div style="float:left;"><embed src="https://static.igem.org/mediawiki/2010/5/58/NYMU_SpeedyBac_ani.mov" width="640" height="480"></div></html><br />
Project overview animation: SpeedyBac<br />
#There are three devices in our SpeedyBac system:<br />
#* Speedy Reporter<br />
#* Speedy Switch<br />
#* Speedy Protein Degrader<br />
# When the promoter is induced, transcription start.<br />
# The speedy reporter will light up immediately when binding to RNA aptamer.<br />
# When induced, the Speedy switch changes its confirmation and translation starts.<br />
# In the end, the Speedy degrader will cause the remaining proteins to degrade faster.<br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Attributions and Contributions</font> =<br />
The idea SpeedyBac was chosen and designed by the students. The experiments were done all by the students. The advisors and instructors only instructed. The breakdown of who participated in which subteam is shown on our [[Team:NYMU-Taipei/Team|Team]] page.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/File:NYMU_SpeedyBac_ani.movFile:NYMU SpeedyBac ani.mov2010-10-28T03:25:44Z<p>Blackrabbit: uploaded a new version of "Image:NYMU SpeedyBac ani.mov"</p>
<hr />
<div></div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/NStyleTeam:NYMU-Taipei/NStyle2010-10-28T02:56:03Z<p>Blackrabbit: </p>
<hr />
<div><html><br />
<style><br />
/* sequence */<br />
.sequence{<br />
border:1px solid black;<br />
font-family:"courier new",courier,helvetica;<br />
font-size:90%;<br />
/*text-transform:lowercase;*/<br />
width:600px;<br />
}<br />
.sequence .seq{<br />
padding:5px;<br />
/*white-space:pre-wrap;<br />
white-space:-moz-pre-wrap;<br />
wordBreak:break-all;<br />
word-wrap:break-word;*/<br />
width:100%;<br />
}<br />
.seq .cut{<br />
background-color:red;<br />
}<br />
.seq .cutmut{<br />
background-color:pink;<br />
text-decoration:overline underline;<br />
}<br />
<br />
/* one primer */<br />
.seq .primer{<br />
background-color:yellow;<br />
}<br />
<br />
/* overlapping primers */<br />
.seq .OP{<br />
background-color:gold;<br />
text-decoration:overline underline;<br />
}<br />
.seq .FP{<br />
background-color:yellow;<br />
text-decoration:overline;<br />
}<br />
.seq .RP{<br />
background-color:yellow;<br />
text-decoration:underline;<br />
}<br />
<br />
/* Parts */<br />
.seq .P{<br />
color:#00ff00;<br />
font-weight:bold;<br />
}<br />
.seq .R{<br />
color:#008000;<br />
font-weight:bold;<br />
}<br />
.seq .rna{<br />
/*color:#008000;*/<br />
}<br />
.seq .C{<br />
/*background:#B5A5D5;*/<br />
color:#663399;<br />
font-weight:bold;<br />
}<br />
.seq .T{<br />
color:#ff0000;<br />
font-weight:bold;<br />
}<br />
.seq .S{<br />
border:1px dashed gray;<br />
background:white;<br />
font-weight:bold;<br />
}<br />
/*needs correcting */<br />
.seq .CORRECT{<br />
background:green;<br />
}<br />
</style><br />
</html><br />
<br />
<html><div class="seq" style="border:1px solid gold; padding:5px;width:350px;"></html><br />
'''Legend'''<br />
{| border="0"<br />
! Effect !! Class<br />
|-<br />
| colspan=2 | '''Primers''': (changes overline/underline and background)<br />
|-<br />
| {{:Team:NYMU-Taipei/N|FP|Forward Primer}} || FP<br />
|-<br />
| {{:Team:NYMU-Taipei/N|OP|Overlapping Primer}} || OP<br />
|-<br />
| {{:Team:NYMU-Taipei/N|RP|Reverse Primer}} || RP<br />
|-<br />
| colspan=2 | '''Parts''': (changes text color)<br />
|-<br />
| {{:Team:NYMU-Taipei/N|P|Promoter}} || P<br />
|-<br />
| {{:Team:NYMU-Taipei/N|R|Ribosome Binding site}} || R<br />
|-<br />
| {{:Team:NYMU-Taipei/N|rna|RNA}} || rna<br />
|-<br />
| {{:Team:NYMU-Taipei/N|C|Coding region}} || C<br />
|-<br />
| {{:Team:NYMU-Taipei/N|T|Terminator}} || T<br />
|-<br />
| {{:Team:NYMU-Taipei/N|S|Special}} || S<br />
|-<br />
| colspan=2 | '''Cutting sites''': (changes background)<br />
|-<br />
| {{:Team:NYMU-Taipei/N|cut|Biobrick cutting site}} || cut<br />
|-<br />
| {{:Team:NYMU-Taipei/N|cutmut|Biobrick cutting site mutation}} || cutmut<br />
|}<br />
<html></div></html></div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporter/Materials_and_MethodsTeam:NYMU-Taipei/Project/Speedy reporter/Materials and Methods2010-10-28T02:55:36Z<p>Blackrabbit: </p>
<hr />
<div>== Fusion Protein ==<br />
<br />
{{:Team:NYMU-Taipei/NStyle}}<br />
<br />
=== GFP ===<br />
<br />
We based splitting GFP ({{:Team:NYMU-Taipei/BBa|E0040}}) based on the split point at 157&158aa used by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715019}} and {{:Team:NYMU-Taipei/BBa|I715020}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715019}}, but the B-part has one base difference from {{:Team:NYMU-Taipei/BBa|I715020}}.<br />
<br />
{{:Team:NYMU-Taipei/Seq|GFP ({{:Team:NYMU-Taipei/BBa|E0040}})|720|<br />
atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggaga<br />
gggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactt<br />
tcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaa<br />
agaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaagg<br />
tattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaaga<br />
atggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgat<br />
ggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttga<br />
gtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa<br />
}}<br />
<br />
{{:Team:NYMU-Taipei/Seq|GFP_A ({{:Team:NYMU-Taipei/BBa|I175019}})|471|<br />
{{:Team:NYMU-Taipei/N|FP|atgcgtaaaggagaagaacttttc}}actggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggaga<br />
gggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactt<br />
tcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaa<br />
agaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaagg<br />
tattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaat{{:Team:NYMU-Taipei/N|RP|gtatacatcatggcagacaaacaa}}<br />
}}<br />
FP (including start codon): atgcgtaaaggagaagaacttttc (55c,24bp,38gc)<br />
RP: ttgtttgtctgccatgatgtatac (55c,24bp,38gc)<br />
<br />
{{:Team:NYMU-Taipei/Seq|GFP_B|249|<br />
{{:Team:NYMU-Taipei/N|FP|aagaatggaatcaaagttaacttcaaaa}}ttagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattg<br />
gcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt<br />
cttgagtttgtaacagctgctgggattaca{{:Team:NYMU-Taipei/N|RP|catggcatggatgaactatacaaa}}taataa<br />
}}<br />
FP: aagaatggaatcaaagttaacttcaaaa (55c,28bp,25gc)<br />
RP (excluding stop codon): tttgtatagttcatccatgccatg (55c,24bp,38gc)<br />
<br />
=== RFP ===<br />
We based splitting RFP ({{:Team:NYMU-Taipei/BBa|E1010}}) based on the split point at 154&155aa used by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715022}} and {{:Team:NYMU-Taipei/BBa|I715023}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715022}}, but the B-part has one base difference from {{:Team:NYMU-Taipei/BBa|I715023}}.<br />
<br />
{{:Team:NYMU-Taipei/Seq|RFP ({{:Team:NYMU-Taipei/BBa|E1010}})|681|<br />
atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtg<br />
aaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagta<br />
cggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaa<br />
gacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc<br />
cggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaact<br />
gaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggac<br />
atcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa<br />
}}<br />
<br />
{{:Team:NYMU-Taipei/Seq|RFP_A ({{:Team:NYMU-Taipei/BBa|I715022}})|462|<br />
{{:Team:NYMU-Taipei/N|FP|atggcttcctccgaagac}}gttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtg<br />
aaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagta<br />
cggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaa<br />
gacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc<br />
cggttatgcagaaaaaaaccatgggttgggaagcttccaccg{{:Team:NYMU-Taipei/N|RP|aacgtatgtacccggaagac}}<br />
}}<br />
FP (including start codon): atggcttcctccgaagac (55C,18bp,56%)<br />
RP: gtcttccgggtacatacgtt (55C,20bp,50%)<br />
<br />
{{:Team:NYMU-Taipei/Seq|RFP_B|219|<br />
{{:Team:NYMU-Taipei/N|FP|ggtgctctgaaaggtgaaatc}}aaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttc<br />
agctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcg{{:Team:NYMU-Taipei/N|RP|tca<br />
ctccaccggtgct}}taataa<br />
}}<br />
FP: ggtgctctgaaaggtgaaatc (55C,21bp,48%)<br />
RP (excluding stop codon): agcaccggtggagtga (56C,16bp,63%)<br />
<br />
=== eIF4A ===<br />
We split eIF4A ({{:Team:NYMU-Taipei/BBa|K411100}}) at 215&216aa based on Natalia E. Broude's study. But first we needed to mutate the two PstI cutting sites.<br />
<br />
We took the protein coding region from the [http://www.ncbi.nlm.nih.gov/nuccore/NM_144958 eIF4A mRNA transcript sequence from Mouse (from NCBI)] and found it had 2 PstI cutting sites:<br />
<br />
{{:Team:NYMU-Taipei/Seq|eIF4A_original([http://partsregistry.org/Part:BBa_K411100 BBa_K411100])|1173|<br />
atggagccggaaggcgtcatcgagagtaactggaacgagattgtggatagctttgatgacatgaatctctcagagtccctcctccgtggtatttatgcct<br />
atggttttgagaagccctctgccatccagcagcgagctattcttccttgtatcaagggttatgatgtgattgctcaagcccagtctgggactgggaaaac<br />
agctacatttgccatatcaatt{{:Team:NYMU-Taipei/N|cut|ctgcag}}cagattgaattagatctaaaggccactcaggctttggttctggcacccacacgtgaattggctcagcagata<br />
caaaaggtggttatggcattaggagactacatgggtgcctcttgtcatgcctgcattgggggcaccaatgtgcgtgctgaggtgcagaag{{:Team:NYMU-Taipei/N|cut|ctgcag}}atgg<br />
aagctccccatatcatcgtgggtacccctggccgggtgtttgacatgcttaaccggagatacctgtcccccaaatacatcaagatgttcgtactggatga<br />
agcagatgaaatgttaagccgagggttcaaggatcagatctatgacatattccagaagctcaacagcaacacacaggtagttttgttgtctgctacaatg<br />
ccttctgatgtccttgaggtgaccaagaaatttatgagagaccctattcggattcttgtcaagaaggaagaattgaccctggagggtatccgccaattct<br />
acatcaatgtggaacgagaggagtggaagcttgacacattgtgtgacttgtatgagacgctgaccatcacccaggcagtcatctttatcaacaccagaag<br />
gaaggtggactggctcaccgagaagatgcatgcccgagatttcactgtttctgccatgcacggagatatggaccaaaaggaacgagatgtgatcatgagg<br />
gagttccggtctggctctagcagagtattaattaccactgacctgttggccagaggcattgatgtgcagcaggtctccttagtcatcaactatgaccttc<br />
ccaccaacagggaaaactacatccacagaatcggtcgaggtggtcggtttggtcgtaagggtgtggctattaacatggtgaccgaagaagacaagaggac<br />
tcttcgagacattgagactttctacaacacctccattgaagagatgcccctcaacgttgctgacctcatttga<br />
}}<br />
<br />
We need to mutate out the two PstI cutting sites. The template of eIF4A on a [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/PGEX4T1.SEQ.html pGEX-4TI vector] was kindly provided by <font color="red">C.Proud</font>. We used these primers to mutate the cutting site:<br />
<font color="blue">2 of pstI cutting site</font><br />
mut1(24bp,55C,42%)<br />
FP: ccatatcaatt<font color="red">ctccag</font>cagattga<br />
RP: caatctg<font color="red">ctggag</font>aattgatatggc<br />
mut2(18bp,55C,56%)<br />
FP: gcagaag<font color="red">ctccag</font>atggaa<br />
RP: tccat<font color="red">ctggag</font>cttctgca<br />
<br />
<br />
<br />
The new sequence after mutation:<br />
{{:Team:NYMU-Taipei/Seq|eIF4A ({{:Team:NYMU-Taipei/BBa|K411100}})|1173|<br />
atggagccggaaggcgtcatcgagagtaactggaacgagattgtggatagctttgatgacatgaatctctcagagtccctcctccgtggtatttatgcct<br />
atggttttgagaagccctctgccatccagcagcgagctattcttccttgtatcaagggttatgatgtgattgctcaagcccagtctgggactgggaaaac<br />
agctacatttg{{:Team:NYMU-Taipei/N|OP|ccatatcaatt{{:Team:NYMU-Taipei/N|cutmut|ctccag}}cagattga}}attagatctaaaggccactcaggctttggttctggcacccacacgtgaattggctcagcagata<br />
caaaaggtggttatggcattaggagactacatgggtgcctcttgtcatgcctgcattgggggcaccaatgtgcgtgctgaggt{{:Team:NYMU-Taipei/N|OP|gcagaag{{:Team:NYMU-Taipei/N|cutmut|ctccag}}atgg<br />
aa}}gctccccatatcatcgtgggtacccctggccgggtgtttgacatgcttaaccggagatacctgtcccccaaatacatcaagatgttcgtactggatga<br />
agcagatgaaatgttaagccgagggttcaaggatcagatctatgacatattccagaagctcaacagcaacacacaggtagttttgttgtctgctacaatg<br />
ccttctgatgtccttgaggtgaccaagaaatttatgagagaccctattcggattcttgtcaagaaggaagaattgaccctggagggtatccgccaattct<br />
acatcaatgtggaacgagaggagtggaagcttgacacattgtgtgacttgtatgagacgctgaccatcacccaggcagtcatctttatcaacaccagaag<br />
gaaggtggactggctcaccgagaagatgcatgcccgagatttcactgtttctgccatgcacggagatatggaccaaaaggaacgagatgtgatcatgagg<br />
gagttccggtctggctctagcagagtattaattaccactgacctgttggccagaggcattgatgtgcagcaggtctccttagtcatcaactatgaccttc<br />
ccaccaacagggaaaactacatccacagaatcggtcgaggtggtcggtttggtcgtaagggtgtggctattaacatggtgaccgaagaagacaagaggac<br />
tcttcgagacattgagactttctacaacacctccattgaagagatgcccctcaacgttgctgacctcatttga<br />
}}<br />
<br />
<br />
{{:Team:NYMU-Taipei/Seq|eIF4A_A|645|<br />
{{:Team:NYMU-Taipei/N|FP|atggagccggaaggcgtcatcga}}gagtaactggaacgagattgtggatagctttgatgacatgaatctctcagagtccctcctccgtggtatttatgcct<br />
atggttttgagaagccctctgccatccagcagcgagctattcttccttgtatcaagggttatgatgtgattgctcaagcccagtctgggactgggaaaac<br />
agctacatttgccatatcaattctccagcagattgaattagatctaaaggccactcaggctttggttctggcacccacacgtgaattggctcagcagata<br />
caaaaggtggttatggcattaggagactacatgggtgcctcttgtcatgcctgcattgggggcaccaatgtgcgtgctgaggtgcagaagctccagatgg<br />
aagctccccatatcatcgtgggtacccctggccgggtgtttgacatgcttaaccggagatacctgtcccccaaatacatcaagatgttcgtactggatga<br />
agcagatgaaatgttaagccgagggttcaaggatcagatctatgacatattccagaagctcaacagcaacacacaggtagttttgttgtctgctacaatg<br />
ccttctgatgtccttgaggtga{{:Team:NYMU-Taipei/N|RP|ccaagaaatttatgagagaccct}}<br />
}}<br />
FP: atggagccggaaggcgtcatcga (66c,24bp,61gc) [design error -- was suppose to design it to be 55c]<br />
RP: agggtctctcataaatttcttgg (54C,23bp,39%)<br />
<br />
{{:Team:NYMU-Taipei/Seq|eIF4A_B|528|<br />
{{:Team:NYMU-Taipei/N|FP|attcggattcttgtcaagaagg}}aagaattgaccctggagggtatccgccaattct<br />
acatcaatgtggaacgagaggagtggaagcttgacacattgtgtgacttgtatgagacgctgaccatcacccaggcagtcatctttatcaacaccagaag<br />
gaaggtggactggctcaccgagaagatgcatgcccgagatttcactgtttctgccatgcacggagatatggaccaaaaggaacgagatgtgatcatgagg<br />
gagttccggtctggctctagcagagtattaattaccactgacctgttggccagaggcattgatgtgcagcaggtctccttagtcatcaactatgaccttc<br />
ccaccaacagggaaaactacatccacagaatcggtcgaggtggtcggtttggtcgtaagggtgtggctattaacatggtgaccgaagaagacaagaggac<br />
tcttcgagacattgagactttctacaacacctccattgaagagatgccc{{:Team:NYMU-Taipei/N|RP|ctcaacgttgctgacctcatttga}}<br />
}}<br />
FP: attcggattcttgtcaagaagg (54C,22bp,41%)<br />
RP (including stop codon): tcaaatgaggtcagcaacgttgag (59c,24bp,46gc) [design error -- was suppose to design it to be 55c]<br />
<br />
=== Linker ===<br />
We took the linker from 2.protocol file from Natalia E. Broude.<br />
<br />
{{:Team:NYMU-Taipei/Seq|linker GSSGSSGSGS|30|<br />
ggcagcagcggcagcagcggcagcggcagc<br />
}}<br />
<br />
<br />
We decided to use primers to create the linker:<br />
cggcagcagcggcagcggcagc<br />
ggcagcagcggcagcagcggcagcggcagc<br />
ggcagcagcggcagcagcggcagc<br />
overlapping region: cggcagcagcggcagc (63c,16bp,81gc)<br />
FP: cggcagcagcggcagcggcagc (22bp)<br />
RP: gctgccgctgctgccgctgctgcc (24bp)<br />
<br />
=== Fusioning it together ===<br />
<br />
==== GFP fusion part ====<br />
(note the extra taa stop codon at the end)<br />
<br />
{{:Team:NYMU-Taipei/Seq|GFP-linker-eIF4A_A ({{:Team:NYMU-Taipei/BBa|K411101}})|1149|<br />
{{:Team:NYMU-Taipei/N|FP|atgcgtaaaggagaagaacttttc}}actggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtg<br />
aaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatgg<br />
tgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc<br />
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatg<br />
gaaacattcttggacacaaattggaatacaactataactcacacaat{{:Team:NYMU-Taipei/N|RP|gtatacatcatggcagacaaacaa}}{{:Team:NYMU-Taipei/N|S|{{:Team:NYMU-Taipei/N|RP|ggcagcag}}{{:Team:NYMU-Taipei/N|OP|cggcagcagcggcagc}}{{:Team:NYMU-Taipei/N|FP|ggcag<br />
c}}}}{{:Team:NYMU-Taipei/N|FP|atggagccggaaggcgtcatcga}}gagtaactggaacgagattgtggatagctttgatgacatgaatctctcagagtccctcctccgtggtatttatgcc<br />
tatggttttgagaagccctctgccatccagcagcgagctattcttccttgtatcaagggttatgatgtgattgctcaagcccagtctgggactgggaaaa<br />
cagctacatttgccatatcaattctccagcagattgaattagatctaaaggccactcaggctttggttctggcacccacacgtgaattggctcagcagat<br />
acaaaaggtggttatggcattaggagactacatgggtgcctcttgtcatgcctgcattgggggcaccaatgtgcgtgctgaggtgcagaagctccagatg<br />
gaagctccccatatcatcgtgggtacccctggccgggtgtttgacatgcttaaccggagatacctgtcccccaaatacatcaagatgttcgtactggatg<br />
aagcagatgaaatgttaagccgagggttcaaggatcagatctatgacatattccagaagctcaacagcaacacacaggtagttttgttgtctgctacaat<br />
gccttctgatgtccttgaggtga{{:Team:NYMU-Taipei/N|RP|ccaagaaatttatgagagacccttga}}<br />
}}<br />
GFP_split_A_FP: gaattcgcggccgcttctagag atgcgtaaaggagaagaacttttc (46bp) OK<br />
GFP_split_A_RP: gctgccgctgctgccgctgctgcc ttgtttgtctgccatgatgtatac (48bp) RE DING<br />
eIF4A_split_A_FP: cggcagcagcggcagcggcagc atggagccggaaggcgtcatcga (45bp) OK<br />
eIF4A_split_A_RP: ctgcagcggccgctactagta tca agggtctctcataaatttcttgg (47bp) OK<br />
<br />
(note that we added as start codon and removed the stop codon of GFP_B)<br />
{{:Team:NYMU-Taipei/Seq|GFP-linker-eIF4A_B ({{:Team:NYMU-Taipei/BBa|K411102}})|804|<br />
{{:Team:NYMU-Taipei/N|FP|atgaagaatggaatcaaagttaacttcaaaa}}ttagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcg<br />
atggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtt<br />
tgtaacagctgctgggattaca{{:Team:NYMU-Taipei/N|RP|catggcatggatgaactatacaaa}}{{:Team:NYMU-Taipei/N|S|{{:Team:NYMU-Taipei/N|RP|ggcagcag}}{{:Team:NYMU-Taipei/N|OP|cggcagcagcggcagc}}{{:Team:NYMU-Taipei/N|FP|ggcagc}}}}{{:Team:NYMU-Taipei/N|FP|attcggattcttgtcaagaagg}}aa<br />
gaattgaccctggagggtatccgccaattctacatcaatgtggaacgagaggagtggaagcttgacacattgtgtgacttgtatgagacgctgaccatca<br />
cccaggcagtcatctttatcaacaccagaaggaaggtggactggctcaccgagaagatgcatgcccgagatttcactgtttctgccatgcacggagatat<br />
ggaccaaaaggaacgagatgtgatcatgagggagttccggtctggctctagcagagtattaattaccactgacctgttggccagaggcattgatgtgcag<br />
caggtctccttagtcatcaactatgaccttcccaccaacagggaaaactacatccacagaatcggtcgaggtggtcggtttggtcgtaagggtgtggcta<br />
ttaacatggtgaccgaagaagacaagaggactcttcgagacattgagactttctacaacacctccattgaagagatgccc{{:Team:NYMU-Taipei/N|RP|ctcaacgttgctgacctcat<br />
ttga}}<br />
}}<br />
GFP_split_B_FP: gaattcgcggccgcttctagag atg aagaatggaatcaaagttaacttcaaaa (53bp)<br />
GFP_split_B_RP: gctgccgctgctgccgctgctgcc tttgtatagttcatccatgccatg (48bp)<br />
eIF4A_split_B_FP: cggcagcagcggcagcggcagc attcggattcttgtcaagaagg (44bp)<br />
eIF4A_split_B_RP: ctgcagcggccgctactagta tcaaatgaggtcagcaacgttgag (45bp)<br />
<br />
==== RFP fusion part ====<br />
(note the extra taa stop codon at the end)<br />
{{:Team:NYMU-Taipei/Seq|RFP-linker-eIF4A_A ({{:Team:NYMU-Taipei/BBa|K411103}})|1140|<br />
{{:Team:NYMU-Taipei/N|FP|atggcttcctccgaagac}}gttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtg<br />
aaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagta<br />
cggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaa<br />
gacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc<br />
cggttatgcagaaaaaaaccatgggttgggaagcttccaccg{{:Team:NYMU-Taipei/N|RP|aacgtatgtacccggaagac}}{{:Team:NYMU-Taipei/N|S|{{:Team:NYMU-Taipei/N|RP|ggcagcag}}{{:Team:NYMU-Taipei/N|OP|cggcagcagcggcagc}}{{:Team:NYMU-Taipei/N|FP|ggcagc}}}}{{:Team:NYMU-Taipei/N|FP|atggagcc<br />
ggaaggcgtcatcga}}gagtaactggaacgagattgtggatagctttgatgacatgaatctctcagagtccctcctccgtggtatttatgcctatggtttt<br />
gagaagccctctgccatccagcagcgagctattcttccttgtatcaagggttatgatgtgattgctcaagcccagtctgggactgggaaaacagctacat<br />
ttgccatatcaattctccagcagattgaattagatctaaaggccactcaggctttggttctggcacccacacgtgaattggctcagcagatacaaaaggt<br />
ggttatggcattaggagactacatgggtgcctcttgtcatgcctgcattgggggcaccaatgtgcgtgctgaggtgcagaagctccagatggaagctccc<br />
catatcatcgtgggtacccctggccgggtgtttgacatgcttaaccggagatacctgtcccccaaatacatcaagatgttcgtactggatgaagcagatg<br />
aaatgttaagccgagggttcaaggatcagatctatgacatattccagaagctcaacagcaacacacaggtagttttgttgtctgctacaatgccttctga<br />
tgtccttgaggtga{{:Team:NYMU-Taipei/N|RP|ccaagaaatttatgagagacccttga}}<br />
}}<br />
RFP_split_A_FP: gaattcgcggccgcttctag atggcttcctccgaagac (38bp)<br />
RFP_split_A_RP: gctgccgctgctgccgctgctgcc gtcttccgggtacatacgtt (44bp)<br />
eIF4A_split_A_FP and RP are the same as the GFP part above.<br />
<br />
(note that we added as start codon and removed the stop codon of RFP_B)<br />
{{:Team:NYMU-Taipei/Seq|RFP-linker-eIF4A_B ({{:Team:NYMU-Taipei/BBa|K411104}})|774|<br />
{{:Team:NYMU-Taipei/N|FP|atgggtgctctgaaaggtgaaatc}}aaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccgg<br />
ttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcg<br />
{{:Team:NYMU-Taipei/N|RP|tcactccaccggtgct}}{{:Team:NYMU-Taipei/N|S|{{:Team:NYMU-Taipei/N|RP|ggcagcag}}{{:Team:NYMU-Taipei/N|OP|cggcagcagcggcagc}}{{:Team:NYMU-Taipei/N|FP|ggcagc}}}}{{:Team:NYMU-Taipei/N|FP|attcggattcttgtcaagaagg}}aagaattgaccctggagggtatccgccaattc<br />
tacatcaatgtggaacgagaggagtggaagcttgacacattgtgtgacttgtatgagacgctgaccatcacccaggcagtcatctttatcaacaccagaa<br />
ggaaggtggactggctcaccgagaagatgcatgcccgagatttcactgtttctgccatgcacggagatatggaccaaaaggaacgagatgtgatcatgag<br />
ggagttccggtctggctctagcagagtattaattaccactgacctgttggccagaggcattgatgtgcagcaggtctccttagtcatcaactatgacctt<br />
cccaccaacagggaaaactacatccacagaatcggtcgaggtggtcggtttggtcgtaagggtgtggctattaacatggtgaccgaagaagacaagagga<br />
ctcttcgagacattgagactttctacaacacctccattgaagagatgccc{{:Team:NYMU-Taipei/N|RP|ctcaacgttgctgacctcatttga}}<br />
}}<br />
RFP_split_B_FP: gaattcgcggccgcttctag atg ggtgctctgaaaggtgaaatc (44bp)<br />
RFP_split_B_RP: gctgccgctgctgccgctgctgcc agcaccggtggagtga (40bp)<br />
eIF4A_split_B_FP and RP are the same as the GFP part above.<br />
<br />
== Aptamer ==<br />
* Aptamer in front of non-coding sequence:<br />
** [[Image:NYMU Aptamer Structure with bb scars non-coding predicted by RNAfold.png|frame|none|RNAfold prediction of Aptamer Structure with Biobrick scars in front of a non-coding region. The scars bond together, but the overall structure does not change.]]<br />
* Check to see if the addition of the biobrick scars affect the secondary structure in front of coding sequence:<br />
** [[Image:NYMU Aptamer Structure with bb scars coding predicted by RNAfold.png|frame|none|RNAfold prediction of Aptamer Structure with Biobrick scars in front of a coding region. The scars bond together, but the overall structure does not change.]]<br />
* Structure interacting with the split proteins: [[Image:NYMU Aptamer Structure interacting with split protein from Paper.png|frame|none| Aptamer Structure interacting with split protein [6]]]<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2010-10-28T01:15:21Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
<div style="float:right;padding:10px;">__TOC__</div><br />
<br />
= <font color=blue>Experiments</font> =<br />
Lab notebooks (click the following links to see details):<br />
* [[Team:NYMU-Taipei/Experiments/Riboswitch|Speedy switch lab notebook]]<br />
* [[mRNA Binding Experiments|Speedy reporter lab notebook]]<br />
* [[SsrA Experiment|Speedy protein degrader lab notebook]]<br />
<br />
'''<font style="background:yellow;">Experimental results</font>''':<br />
* [[Team:NYMU-Taipei/Experiments/Speedy switch#Results|Speedy switch results]]: Several reporter gene assay results for testing the Theophylline riboswitch.<br />
* [[Team:NYMU-Taipei/Experiments/Speedy degrader#Results|Speedy degrader results]]: Several reporter gene assay results for testing the half life of various ssrA tagged and untagged fluorescent proteins.<br />
<br />
== Protocols, preparation and other stuff ==<br />
* [[Team:NYMU-Taipei/Experiments/Protocols|Basic cloning protocols]]. Optimised protocols developed and kept current over the past few years.<br />
* [[Team:NYMU-Taipei/Experiments/Protocols#Gene_Reporter_Assay|Gene reporter assay protocols]]<br />
<br />
* [[Team:NYMU-Taipei/Experiments/pSB1C3|pSB1C3 preparation]]<br />
* [[Team:NYMU-Taipei/Experiments/dddddH2O|dddddH2O preparation]] (fun :P)<br />
<br />
= <font color=blue>Parts</font> =<br />
The range given to each group for this years' parts was divided as follows:<br />
* Speedy Switch: K411000-K411099<br />
* Speedy Reporter: K411100-K411199<br />
* Speedy Protein degrader: K411200-K411299<br />
<br />
The designed parts:<br />
<groupparts>iGEM010 NYMU-Taipei</groupparts><br />
<br />
= <font color=blue>Primers</font> =<br />
This is a list of all the primers we designed for<br />
<br />
== Speedy Reporter ==<br />
{| border=1<br />
! name || sequence || length || desc<br />
|-<br />
| eIF4A_split_A_Fp || cggcagcagcggcagcggcagcATGGAGCCGGAAGGCGTCATCGA || 45 ||<br />
|-<br />
| eIF4A_split_B_Rp || ctgcagcggccgctactagtaTCAAATGAGGTCAGCAACGTTGAG || 45 ||<br />
|-<br />
| GFP_split_A_FP || gaattcgcggccgcttctagagatgcgtaaaggagaagaacttttc || 46 ||<br />
|-<br />
| GFP_split_B_RP || ctgccgctgctgccgctgctgccttattatttgtatagttcatccatgcca || 51 ||<br />
|-<br />
| GFP_split_A_RP || gctgccgctgctgccgctgctgccttgtttgtctgccatgatgtatac || 48 ||<br />
|-<br />
| GFP_split_B_FP ||gctgccgctgctgccgctgctgcctttgtatagttcatccatgccatg || 48 ||<br />
|-<br />
| aptamer_FP || gcttctagagacactcggaggacagcttagatgcaaagccggagtgagtgtacacc || 56 ||<br />
|-<br />
| aptamer_RP || agcctgcagcggccgctactagtattcccctggcgcggggtgtacactcactccggct || 58 ||<br />
|-<br />
| eIFA_FP || gcttctagATGGAGCCGGAAGGCGTCATCGA || 31 ||<br />
|-<br />
| eIF4A_mut1_FP || ccatatcaattctccagcagattga || 25 ||<br />
|-<br />
| eIF4A_mut1_RP || caatctgctggagaattgatatggc || 25 ||<br />
|-<br />
| eIF4A_mut2_FP || gcagaagctccagatggaa || 19 ||<br />
|-<br />
| eIF4A_mut2_RP || tccatctggagcttctgca || 19 ||<br />
|-<br />
| eIF4A_split_A_Rp || ctgcagcggccgctactagtatcaagggtctctcataaatttcttgg || 47 ||<br />
|-<br />
| eIF4A_split_B_Fp || cggcagcagcggcagcggcagcattcggattcttgtcaagaagg || 44 ||<br />
|-<br />
| RFP_split_A_FP || gaattcgcggccgcttctagatggcttcctccgaagac || 38 ||<br />
|-<br />
| RFP_split_A_RP || gctgccgctgctgccgctgctgccgtcttccgggtacatacgtt || 44 ||<br />
|-<br />
| RFP_split_B_FP || gaattcgcggccgcttctagatgggtgctctgaaaggtgaaatc || 44 ||<br />
|-<br />
| RFP_split_B_RP || gctgccgctgctgccgctgctgccagcaccggtggagtga || 40 ||<br />
|-<br />
| Total || || 773 ||<br />
|}<br />
<br />
== Speedy Switch ==<br />
{| border=1<br />
|-<br />
! name || sequence || length<br />
|-<br />
|Theophylline Riboswitch FP ||gaattcgcggccgcttctagagggtgataccagcatcgtcttgatgcccttggcag||56<br />
|-<br />
|Theophylline Riboswitch RP ||ctgcagcggccgctactagtacttgttgtcttgcagcggggtgctgccaagggcatcaagac||62<br />
|}<br />
<br />
== Speedy Protein Degrader ==<br />
{| border=1<br />
|-<br />
! name || sequence || length || desc<br />
|-<br />
| GFPLVA_out_FP || gcttctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc || 52 ||<br />
|-<br />
| RFPLVA_out_FP || gcttctagagaaagaggagaaatactagatggct || 34<br />
|-<br />
| RFPLVA_in_RP || CTACTAAAGCGTAGTTTTCGTCGTTTGCAGCagcaccggtggagtga || 47<br />
|-<br />
| SspB_FP || gcttctagatgGATTTGTCACAGCTAACAC || 30<br />
|-<br />
| SspB_RP || ctgcagcggccgctactagtattaCTTCACAACGCGTAATGC || 41<br />
|-<br />
| RFP_FP || gcttctagatggcttcctccgaagac || 26<br />
|-<br />
| GFP_FP || gcttctagatgcgtaaaggagaagaacttttc || 32<br />
|-<br />
| xFP_LVA_Remover_FP || gagctgtacaagaggccttaataatactagagccaggcatca || 42 ||<br />
|-<br />
| xFP_LVA_Remover_RP || tgatgcctggctctagtattattaaggcctcttgtacagctc || 42 ||<br />
|-<br />
| Total || || 346 ||<br />
|}<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-28T01:12:53Z<p>Blackrabbit: /* Conclusion */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the normalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
* When the concentration of Theophylline is in the range 0.01mM to 2mM, the concentration of Theophylline and the resulting fluorescence (using the {{:Team:NYMU-Taipei/BBa|K411003}} construct) are directly proportional. As a result, we recommend the Theophylline riboswitch ({{:Team:NYMU-Taipei/BBa|K411001}}) to be used in that range to control the downstream translation.<br />
<br />
* The study by Suess ''et al'', adding more than 5mM of Theophylline would cause ''E. coli'' to die (Suess, 2004). In our experiments, we find that after adding more than 4mM, the Theophylline spectrum curve would be invalid. As a result, we do not recommend doing experiments with concentrations over 4mM as the ''E. coli'' cell would be unstable or the regulation of the riboswitch would not be accurate. <br />
<br />
* Our figures show that the sample fluorescence will disperse clearly after 80 minutes. As a result, we suggest that the protein expression of the downstream coding sequence will be more obvious after about 200 minutes of adding Theophylline.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-28T01:12:24Z<p>Blackrabbit: /* Conclusion */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the normalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
* When the concentration of Theophylline is in the range 0.01mM to 2mM, the concentration of Theophylline and the resulting fluorescence (using the {{:Team:NYMU-Taipei/BBa|K411003}} construct) are directly proportional. As a result, we recommend the Theophylline riboswitch ({{:Team:NYMU-Taipei/BBa|K411001}}) to be used in that range to control the downstream translation.<br />
<br />
* The study by Suess ''et al'', adding more than 5mM of Theophylline would cause ''E. coli'' to die (Beatrix, 2004). In our experiments, we find that after adding more than 4mM, the Theophylline spectrum curve would be invalid. As a result, we do not recommend doing experiments with concentrations over 4mM as the ''E. coli'' cell would be unstable or the regulation of the riboswitch would not be accurate. <br />
<br />
* Our figures show that the sample fluorescence will disperse clearly after 80 minutes. As a result, we suggest that the protein expression of the downstream coding sequence will be more obvious after about 200 minutes of adding Theophylline.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_protein_degraderTeam:NYMU-Taipei/Project/Speedy protein degrader2010-10-28T00:53:39Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
<div style="float:right;padding:10px;">__TOC__</div><br />
<br />
=<font color=blue>Abstract</font>=<br />
* We developed the fluorescent proteins with '''degradation tags''' which accelerate the reporter turnover. This provides '''better temporal resolution''' of gene expression profiling in single cells.<br />
<br />
<br />
<br />
A central goal of synthetic biology is to explore the design principles that embedded in the architecture and operation of biological systems. To understand how biological systems are genetically assembled, synthetic biologists need tools to quantitatively describe the gene expression in model organisms. Fluorescent proteins(FP), along with modern microscopes, allow real-time gene expression profiling at the level of individual living cells. Though the detection of FPs benefits from their stability, this advantage turns awkward when we are monitoring the dynamic cellular events which required measurements at higher temporal resolution. One approach to achieve such demand is specific and accelerated reporter degradation. Thus, we focus on the design of fusion proteins with degradation tags. Previous studies suggest the LVA tag has hitherto been most efficient tag to shorten the half-life of tagged protein in ''Escherichia coli''. We added LVA tags to the C-terminal of different fluorescent proteins. Our results indicate that the half-life of fluorophores are significantly reduced. Therefore, we improved the temporal resolution of reporter proteins. This provides a promising tool for studying transient gene expression in the future.<br />
<br />
=<font color=blue>Motivation</font>=<br />
<br />
*How can we '''improve the temporal sampling''' of biological assay? We applied '''destabilized fluorescent proteins''' to achieve this goal.<br />
<br />
<br />
<br />
Fluorescent proteins, for example, green fluorescent protein (GFP), are now widely used to visualize a protein’s distribution and dynamics in a subcellular compartment. The remarkable feature of the fluorescent proteins (FP) is that the fluorophore forms spontaneously (Chalfie et al., 1994) without the need of any substrate or cofactor (Heim et al., 1994). In addition, FP variants can be fused to virtually any protein of interest; thus, they can be used in many species for detection purposes within single living cells. FPs, together with modern microscopes, has become essential tools for studying spatial and temporal dynamics of cellular processes at high resolution.<br />
<br />
The biophysical characteristics of fluorescent probes provide opportunities and, set limitations for fusion-protein studies. The fluorophore of GFP and its variants is contained within a barrel of beta-sheet protein (Ormo et al., 1996). This compact structure renders FPs with high photostability under a variety of conditions, even under treatment with protease (Chalfie et al., 1994). Once stable FPs formed, they are cleared from the cells in tens of hours (Andersen et al., 1998). This property allows prolonged imaging of cells, and easier detection when FPs accumulated. However, the stability of FPs limits its application in some studies which needs fast reporter turnover, for example, studies of transient gene expression. This also impedes the measurements of temporal expression pattern and behavior of proteins, because proteins at different stages of their lifetime are being detected. To overcome this limitation, we tried to develop destablized FPs.<br />
<br />
There are several ways to generate FP variants with different spectral and expression properties. One approach is mutagenesis studies. Though this approach is fruitful (Delagrave et al., 1995; Heim et al., 1995; Zacharias et al., 2002), it seems impractical to screen possible mutations of each FP in ever-increasing FP libraries. Alternatively, we planed to control proteolysis by adding degradation tags to FPs (Andersen et al., 1998). This approach can be easily generalized to several FPs; thus, it provides extensibility to future applications.<br />
<br />
=<font color=blue>Design: Controlled protein degradation in bacteria</font>=<br />
*We added the '''degradation tag''' to each fluorescent protein. This approach effectively '''accelerates reporter turnover'''.<br />
<br />
<br />
<br />
The flow of genetic information can—and sometimes need to — depend not only on its controlled synthesis but also equally on its controlled degradation. Indeed, protein degradation in natural systems is essential for cellular functions. Previous study showed that 2.7% of proteins are degraded per generation in ''Escherichia coli'' (''E. coli.'') growing in logarithmic phase (Fox and Brown, 1961). Control of protein turnover is required for cell cycle progression, signal transduction, and rapid responses to environmental challenges (Grunenfelder et al., 2001; Hengge-Aronis, 2002; Neher et al., 2003). Therefore, regulated degradation is expected to be critical for the development of synthetic circuits.<br />
<br />
To control the half-life of specific proteins, we utilized the regulated proteolysis machineries naturally employed to bacterial systems. Regulated degradation is ubiquitous for prokaryotic and eukaryotic cells (Hershko and Ciechanover, 1998; Jenal and Hengge-Aronis, 2003), because they need to clear damaged or aberrant proteins while ignoring functional ones. A common strategy for substrate selection is adding degradation tags to target proteins. Then, certain proteases execute energy dependent degradation of those proteins. One prominent type of degradation tag in prokaryotes is the ssrA tag, a tmRNA encoded by ssrA gene. This tagging system is engaged in protein quality control throughout all eubacteria (Karzai et al., 2000). Though it was first described as a mechanism to clear obstructed ribosomes (Keiler et al., 1996), recent studies suggested ssrA-mediated tagging also plays a regulatory role in the expression of lac operon (Abo et al., 2000). This motivated us to control the protein expression via manipulating controlled proteolysis.<br />
<br />
===SsrA tag===<br />
SsrA tag, encoded by the ssrA RNA, is important for protein quality control in bacteria. SsrA RNA is recognized as tmRNA because it has characteristics of both tRNA and mRNA (Atkins and Gesteland, 1996; Keiler et al., 1996). When ''E. coli.'' ribosomes stall during translation due to absence of a proper stop codon, ssrA ribosome-rescue system mediates C-terminal modification by adding the sequence AANDENYALAA to the the incomplete peptide (Keiler et al., 1996). SsrA tagging frees these ribosomes for other mRNAs, and targets the defective polypeptides for degradation by ClpXP and other ATP-dependent proteases (Gottesman et al., 1998). Previous studies suggested that 0.5% of protein products in ''E. coli.''. receive ssrA tags (Lies and Maurizi, 2008). Bacterial strains lacking functional ssrA gene show slower growth (Oh and Apirion, 1991), reduction in motility (Komine et al., 1994), and subsided pathogenesis (Julio et al., 2000). These results indicate that ssrA tagging system play a major role in bacterial physiology.<br />
<br />
The SsrA tag contains binding sites for the SspB adaptor and ClpXP protease (Levchenko et al., 2000). The SspB adaptor enhances substrate delivery by tethering SsrA-tagged proteins to the ClpX, which unfolds the tagged protein, and then translocates the denatured polypeptide into ClpP for degradation (Fig.1)(Sauer et al., 2004). The binding affinity of the ssrA tag to the SspB and ClpX plays key role in modulating substrate choice (Flynn et al., 2004) and the efficiency of degradation (Hersch et al., 2004; McGinness et al., 2006). One of the mutants, called LVA tag, further accelerates the degradation of tagged proteins compared to the wild-type LAA tag (Andersen et al., 1998). LVA tag has been applied to construct a fast synthetic gene oscillator, because it decreases protein lifetime and increases temporal resolution (Stricker et al., 2008). Thus, we added the LVA tag to FPs to maximize the temporal resolution of these reporters.<br />
<br />
<br />
<br />
[[Image:SsrA 2.png.jpg|900px||frame|none|Fig.1 Molecular mechanism of SsrA-SspB system]]<br />
<br />
===Circuit Design===<br />
<br />
*We designed four fluorescence protein circuits. In each following panel, the upper one is the conrol, and the lower one is the one with LVA tag. <br />
<br />
[[Image:GFP&LVA.png|frame|none|Fig.2 GFP(BBa_K411233) and GFP with LVA tag(BBa_K411237)]]<br />
<br />
[[Image:RFP&LVA.png|frame|none|Fig.3 RFP(BBa_K411234) and RFP with LVA tag(BBa_K411238)]]<br />
<br />
[[Image:CFP&LVA.png|frame|none|Fig.4 CFP(BBa_K411231) and CFP with LVA tag(BBa_K411235)]]<br />
<br />
[[Image:YFP&LVA.png|frame|none|Fig.5 YFP(BBa_K411232) and YFP with LVA tag(BBa_K411236)]]<br />
<br />
<br />
For details of this part, please see: [[Team:NYMU-Taipei/Experiments#Parts|Designed Parts]], [[Team:NYMU-Taipei/Project/Speedy protein degrader/Sequences|Sequences]]<br />
<br />
=<font color=blue>Data analysis</font>=<br />
[[Team:NYMU-Taipei/Experiments/Speedy_degrader#Results|This page]] contains the experimental data gathered through reporting assays.<br />
<br />
=<font color=blue>Advantages</font>=<br />
<br />
1.'''Universal''': <br />
<br />
The SsrA-SspB system is employed in all eubacteria (Karzai et al., 2000) whose genomes have been sequenced. Thus, the ‘speedy degrader’ can be easily implemented in other prokaryotic systems, for example, ''Bacillus subtilis''. Actually, the components of SsrA system has been transplanted into a ''Saccharomyces cerevisiae'' strain that allows for tunable degradation of a tagged protein (Grilly et al., 2007). The striking instance suggested that it is plausible to apply the ‘speedy degrader’ even in eukaryotic systems.<br />
<br />
2.'''Less interference to the protein function''': <br />
<br />
Most fusion protein studies require an available functional assay. Because the peptide tag may be detrimental to the structure of target protein, it is critical to assure that the tagged protein behaves as the native protein. A nonfunctional FP-tagged protein will be uninformative in most, if not all, biological studies. Fortunately, ssrA tag does not affect the structure or thermodynamic stability of attached proteins (Gottesman et al., 1998). Therefore, the degradation tag will be a suitable component to integrate with other synthetic devices.<br />
<br />
=<font color=blue>Reference</font>=<br />
*Abo, T., Inada, T., Ogawa, K., and Aiba, H. (2000). SsrA-mediated tagging and proteolysis of LacI and its role in the regulation of lac operon. ''EMBO J'' 19, 3762-3769.<br />
<br />
*Andersen, J.B., Sternberg, C., Poulsen, L.K., Bjorn, S.P., Givskov, M., and Molin, S. (1998). New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. ''Appl Environ Microbiol'' 64, 2240-2246.<br />
<br />
*Atkins, J.F., and Gesteland, R.F. (1996). A case for trans translation. ''Nature'' 379, 769-771.<br />
<br />
*Chalfie, M., Tu, Y., Euskirchen, G., Ward, W.W., and Prasher, D.C. (1994). Green fluorescent protein as a marker for gene expression. ''Science'' 263, 802-805.<br />
<br />
*Delagrave, S., Hawtin, R.E., Silva, C.M., Yang, M.M., and Youvan, D.C. (1995). Red-shifted excitation mutants of the green fluorescent protein. ''Biotechnology (N Y)'' 13, 151-154.<br />
<br />
*Flynn, J.M., Levchenko, I., Sauer, R.T., and Baker, T.A. (2004). Modulating substrate choice: the SspB adaptor delivers a regulator of the extracytoplasmic-stress response to the AAA+ protease ClpXP for degradation. ''Genes Dev'' 18, 2292-2301.<br />
<br />
*Fox, G., and Brown, J.W. (1961). Protein degradation in Escherichia coli in the logarithmic phase of growth. ''Biochim Biophys Acta'' 46, 387-389.<br />
<br />
*Gottesman, S., Roche, E., Zhou, Y., and Sauer, R.T. (1998). The ClpXP and ClpAP proteases degrade proteins with carboxy-terminal peptide tails added by the SsrA-tagging system. ''Genes Dev'' 12, 1338-1347.<br />
<br />
*Grilly, C., Stricker, J., Pang, W.L., Bennett, M.R., and Hasty, J. (2007). A synthetic gene network for tuning protein degradation in Saccharomyces cerevisiae. ''Mol Syst Biol'' 3, 127.<br />
<br />
*Grunenfelder, B., Rummel, G., Vohradsky, J., Roder, D., Langen, H., and Jenal, U. (2001). Proteomic analysis of the bacterial cell cycle. ''Proc Natl Acad Sci U S A'' 98, 4681-4686.<br />
<br />
*Heim, R., Cubitt, A.B., and Tsien, R.Y. (1995). Improved green fluorescence. ''Nature'' 373, 663-664.<br />
<br />
*Heim, R., Prasher, D.C., and Tsien, R.Y. (1994). Wavelength mutations and posttranslational autoxidation of green fluorescent protein. ''Proc Natl Acad Sci U S A'' 91, 12501-12504.<br />
<br />
*Hengge-Aronis, R. (2002). Signal transduction and regulatory mechanisms involved in control of the sigma(S) (RpoS) subunit of RNA polymerase. ''Microbiol Mol Biol Rev'' 66, 373-395<br />
<br />
*Hersch, G.L., Baker, T.A., and Sauer, R.T. (2004). SspB delivery of substrates for ClpXP proteolysis probed by the design of improved degradation tags. ''Proc Natl Acad Sci U S A'' 101, 12136-12141.<br />
<br />
*Hershko, A., and Ciechanover, A. (1998). The ubiquitin system. ''Annu Rev Biochem'' 67, 425-479.<br />
<br />
*Jenal, U., and Hengge-Aronis, R. (2003). Regulation by proteolysis in bacterial cells. ''Curr Opin Microbiol'' 6, 163-172.<br />
<br />
*Julio, S.M., Heithoff, D.M., and Mahan, M.J. (2000). ssrA (tmRNA) plays a role in Salmonella enterica serovar Typhimurium pathogenesis. ''J Bacteriol'' 182, 1558-1563.<br />
<br />
*Karzai, A.W., Roche, E.D., and Sauer, R.T. (2000). The SsrA-SmpB system for protein tagging, directed degradation and ribosome rescue. ''Nat Struct Biol'' 7, 449-455.<br />
<br />
*Keiler, K.C., Waller, P.R., and Sauer, R.T. (1996). Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA. ''Science'' 271, 990-993.<br />
<br />
*Komine, Y., Kitabatake, M., Yokogawa, T., Nishikawa, K., and Inokuchi, H. (1994). A tRNA-like structure is present in 10Sa RNA, a small stable RNA from Escherichia coli. ''Proc Natl Acad Sci U S A'' 91, 9223-9227.<br />
<br />
*Levchenko, I., Seidel, M., Sauer, R.T., and Baker, T.A. (2000). A specificity-enhancing factor for the ClpXP degradation machine. ''Science'' 289, 2354-2356.<br />
<br />
*Lies, M., and Maurizi, M.R. (2008). Turnover of endogenous SsrA-tagged proteins mediated by ATP-dependent proteases in Escherichia coli. ''J Biol Chem'' 283, 22918-22929.<br />
<br />
*McGinness, K.E., Baker, T.A., and Sauer, R.T. (2006). Engineering controllable protein degradation. ''Mol Cell'' 22, 701-707.<br />
<br />
*Neher, S.B., Flynn, J.M., Sauer, R.T., and Baker, T.A. (2003). Latent ClpX-recognition signals ensure LexA destruction after DNA damage. ''Genes Dev'' 17, 1084-1089.<br />
<br />
*Oh, B.K., and Apirion, D. (1991). 10Sa RNA, a small stable RNA of Escherichia coli, is functional. ''Mol Gen Genet'' 229, 52-56.<br />
<br />
*Ormo, M., Cubitt, A.B., Kallio, K., Gross, L.A., Tsien, R.Y., and Remington, S.J. (1996). Crystal structure of the Aequorea victoria green fluorescent protein. ''Science'' 273, 1392-1395.<br />
<br />
*Sauer, R.T., Bolon, D.N., Burton, B.M., Burton, R.E., Flynn, J.M., Grant, R.A., Hersch, G.L., Joshi, S.A., Kenniston, J.A., Levchenko, I., et al. (2004). Sculpting the proteome with AAA(+) proteases and disassembly machines. ''Cell'' 119, 9-18.<br />
<br />
*Stricker, J., Cookson, S., Bennett, M.R., Mather, W.H., Tsimring, L.S., and Hasty, J. (2008). A fast, robust and tunable synthetic gene oscillator. ''Nature'' 456, 516-519.<br />
<br />
*Zacharias, D.A., Violin, J.D., Newton, A.C., and Tsien, R.Y. (2002). Partitioning of lipid-modified monomeric GFPs into membrane microdomains of live cells. ''Science'' 296, 913-916.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporterTeam:NYMU-Taipei/Project/Speedy reporter2010-10-28T00:49:45Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
<div style="float:left;padding:10px;">__TOC__</div><br />
<br />
=<font color=blue>Abstract</font>=<br />
* Our Speedy RNA+protein reporter effectively skips protein folding when reporting, thus reducing the time for a fluorescent response.<br />
More specific insights into molecular mechanisms and gene regulation are essential for improvement in synthetic biology. Understanding these mechanisms requires time. Our speedy reporter for reporting RNA and protein expression in a cell effectively skips protein folding when reporting -- the longest part of gene expression - thus reducing the time needed to get fluorescence. By speeding up the reporter, in both RNA and protein, we have also speed up the exploration for rules in the biological system. We can not only generate more novel circuits but also explore gene regulations in synthetic biology.<br />
<br />
=<font color=blue>Introduction</font> =<br />
Recent studies of mRNA localization show that a great part of mRNA localize in specific cytoplasm position (Martin and Ephrussi, 2009). For examples, ASH1 mRNA localize at bud tip of budding yeast to allow asymmetric segregation from mother to daughter cell (Paquin and Chartrand, 2008). In the ''Drosophila'' the localization of mRNA at anterior and posterior of oocyte play an important role in the developing embryo (Johnstone and Lasko, 2001). Local translation of mRNAs in axonal growth cones helps axon navigate to it synaptic partners (Lin and Holt, 2007). β-actins mRNA localize at sites of active actins polymerization, cytoskeletal-mediate motility need mRNA translation (Huttelmaier et al., 2005). All the examples above is studies on eukaryotic system. there are a few studies of mRNA location in prokaryotic system. And most of synthetic biology designs on prokaryotic bacteria. The more basic rule of prokaryotic system we know, the more successful and speedy experiments we will have.<br />
<br />
<br />
The common way to detect mRNA is RT-PCR, which can only be done in vitro but can’t in a real living cell. The common way to detect the protein is fusion a reporter protein such as GFP to report it, and the folding of GFP takes about four hours. In order to do both assay speedy and in vivo, we apply a novel technique Bimolecular Fluorescence Complementation, BiFC. In our design, we need not to wait four hours for folding of GFP to detect our protein fusion GFP. We can get our signal in few minute using this method. And it also can detect the mRNA both location and quantity (Demidov and Broude, 2006). We can use this method save about fours for protein assay and two hours for mRNA assay (Fig.1). <br />
<br />
{| border=0 <br />
| rowspan=10 | [[image:NYMU_Speedy_fig..png|frame|none|200px|Figure.1 compare to the traditional method of detecting mRNA and protein. our speedy reporter only need 3 min to obtain signal (Demidov and Broude, 2006).]]<br />
| BiFC is developed base on the technique Protein-fragment Complement Assay, PCA (Barnard et al., 2008; Demidov and Broude, 2006). Protein-protein interactions coupled to refolding of a pair of split enzymes in the PCA technique. The enzyme used in PCA has it activity only when two split parts reconstruct together. The activities of enzyme act as a detector of protein-protein interaction (Remy and Michnick, 2007). While the BiFC technique use split fluorescent protein instead of split enzyme in the PCA. The split form of fluorescent protein alone has no fluorescence. Fluorescence appears when two split parts reassembly together immediately in few minutes. For mRNA detection, we design a system differ from BiFC’s protein-protein interaction to RNA-protein interaction. Where a GFP is split into two inactive parts and fused with two parts of the split-eIF4A protein, a kind of RNA binding protein. On the other hand, we designed an mRNA aptamer that the eIF4A protein can bind to. EGFP will fluoresce through the interaction of split eIF4A and its corresponding aptamer. Using this method, we can immediately detect mRNA quantity and location in vivo. For protein detection, we design another system of BiFC which RFP is splits into two inactive parts and fused with two parts of antibody light chain and heavy chain. And then we fused the antigen to target protein. When target protein fusion antigen appears, the light chain and heavy chain combine with antigen. And then split RFPs reconstruct and fluoresce.<br />
|}<br />
<br />
=<font color=blue>Design</font>=<br />
*The speedy reporter contains two parts:.[[Image:NYMU reporter design.png|250px|right|NYMU reporter design.]]<br />
**Split fluorescent protein<br />
**Protein-aptamer binding pair<br />
*In the design,each fusion protein contains a split fluorescent protein fused with peptide linker and combines with aptamer binding protein.<br />
*Using split protein method to make a speedy reporter:<br />
**The formation of chromophore is the rate limitation step to get the fluorescence.In order to save the time for the chromophore folding and to get a immediate fluorescent signal report,we split the fluorescent proteins at particular residues to make it contain a preformed chromophore.When they are in a split form,they are not fluorescent.<br />
**We fused the split fluorescent protein with the split aptamer binding protein,the fusion proteins are constitutively expressed.<br />
**When the aptamer is expressed,the aptamer binding proteins bind on the aptamer due to strong affinity,the split fluorescent proteins will recombine and restore the fluorescence then become a functional fluorescent protein.So we can get a fluorescent signal immediately. <br />
<br />
<br />
== RNA reporter Design ==<br />
*Our circuit design:<br />
**EGFP-eIF4A system / RNA aptamer on plasmid pSB1C3.<br />
[[Image:RNA Binding 1 (1).png|500px|EGFP-eIF4A system on plasmid pSB1C3.]]<br />
[[Image:RNA Binding 2.png|400px|RNA aptamer on plasmid pSB1C3.]]<br />
===EGFP/ERFP + split eIF4A===<br />
*split GFP/RFP<br />
We split the EGFP/ERFP into two parts, the larger N-terminal part and the smaller C-terminal part. The N-terminal part contains performed chromophore and has a very weak fluorescence that is hard to detect. Only when it combines with the small C-terminal fragment, does the fluorescence become very bright. When both parts combine, we can detect the location of the mRNA and protein. The probability that these two split parts of EGFP/ERFP can fit together without an outside force is very low, thus ther are few false-positive signal (Demidov and Broude, 2006).<br />
*eIF4A<br />
eIF4A is an abbreviation for eukaryotic initiation factor 4A. It is a member of the DEAD-box RNA helicase protein family eIF4F (Oguro et al., 2003), and the DEAD-box is one of the largest subgroups of the RNA helicase protein family (Story et al., 2001). <br />
<br />
Eukaryotic translation initiation factor 4F (eIF4F) is a protein consists of eIF4A, eIF4E, and eIF4G. eIF4A is a helicase need ATP to unwind the secondary structure of mRNA untranslated region and make ribosome binds easier. eIF4E can binds to the cap structure of mRNA. eIF4G is like a scaffold of eIF4A and eIF4E helping them coordinate their functions. Without eIF4E and eIF4G the eIF4A alone exist much lower RNA helicase activity than complete eIF4F (Imataka and Sonenberg, 1997).<br />
<br />
===eIF4A binding aptamer===<br />
* What is the eIF4A binding aptamer? <br />
The eIF4A aptamer that we used has a high affinity for complete eIF4A protein. Its affinity is strong enough that it will combine the split eIF4A(described above) into a complete eIF4A protein. In the presence of eIF4A aptamer, ATP hydrolysis is inhibited and the RNA substrate which binds onto the eIF4A cannot unwind. <br />
<br />
It is proposed that the eIF4A structure is in a equilibrium between dumbbell-shaped structure and compact struction in solution. In the presence of ATP and absence of RNA aptamer, the equilibrium will be shifted into the dumbbell-shaped eIF4A (Fig.2). In the opposite condition, the equilibrium will be shifted into the compact one (Valencia-Burton et al., 2007).<br />
[[Image:NYMU_EIF4A.aptamer.png|frame|none|100px|Figure.2 Two domains and the structure equilibrium of eIF4A (Oguro et al., 2003)]]<br />
*eIF4A aptamer Secondary structure:<br />
** Structure predicted by RNAfold: [[Image:NYMU Aptamer Structure predicted by RNAfold.png|frame|none|Figure.3 Aptamer Structure predicted by RNAfold]]<br />
** Structure of eIF4A aptamer: [[Image:NYMU Aptamer Structure from Paper.png|frame|none|Figure.4 Aptamer Structure (Oguro et al., 2003)]]<br />
<br />
== Protein Reporter Design ==<br />
The basic principle of protein reporter device is the same as the RNA reporter. First, we fuse split RFP with anti-His tag antibody light chain and heavy chain. Second, we fuse His-tag sequence with our target protein sequence. Once our target protein sequence being tranlated the anti-His tag antibody will binding on the Histidine tag. And then with combining of the heavy chain and the light chain, The split ERFP reconstruct and make brightly fluorescence.<br />
[[image:NYMU_TAIPEI_His_tag_structure.png|frame|none|200px|Figure.5 The structure of anti-His tag antibody. Green stand for the heavy chain and the red stand for the light chain (PDB ID: 1KTR).]]<br />
<br />
=[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods| Material and Methods]]=<br />
We constructed two devices by using the parts below:<br />
*RNA reporter consists of : <br />
**EGFP<br />
**ERFP<br />
**eIF4A<br />
**fusion parts<br />
**aptamer<br />
*protein reporter consists of :<br />
**split RFP<br />
**split peptide adaptor<br />
==RNA reporter device==<br />
===[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP| GFP ]]===<br />
*Splitting the GFP({{:Team:NYMU-Taipei/BBa|E0040}}) at 157th and 158th amino acid which was generated by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715019}} and {{:Team:NYMU-Taipei/BBa|I715020}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715019}} , but the B-part is one base different from {{:Team:NYMU-Taipei/BBa|I715020}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP| RFP ]] ===<br />
*Splitting RFP ({{:Team:NYMU-Taipei/BBa|E1010}}) at 154th and 155th amino acid used by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715022}} and {{:Team:NYMU-Taipei/BBa|I715023}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715022}}, but the B-part has one base difference from {{:Team:NYMU-Taipei/BBa|I715023}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#eIF4A| eIF4A]] ===<br />
*We take the protein coding region from the [http://www.ncbi.nlm.nih.gov/nuccore/NM_144958 eIF4A mRNA transcript sequence from Mouse (from NCBI)] and found that it had 2 PstI cutting sites. For fear that our PstI cutting enzyme would cut the wrong place, we mutated the two PstI cutting sites.After mutation, we split eIF4A ({{:Team:NYMU-Taipei/BBa|K411100}}) at 215&216th amino acid.<br />
*The template of eIF4A on a [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/PGEX4T1.SEQ.html pGEX-4TI vector] was kindly provided by Pro.C.Proud.<br />
<br />
== Fusion parts ==<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP_fusion_part| GFP fusion system]] ===<br />
*We fused the split-GFP part with split-eIF4A part via PCR to get two sequences: split-GFP-A+linker+split-eIF4A-A([http://partsregistry.org/Part:BBa_K411101 BBa_K41111])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411102 BBa_K11102]) We then added terminators in the back of both sequences and inserted them into one plasmid.<br />
{| border=0 <br />
| rowspan=5 | [[Image:122.PNG|500px|EGFP-eIF4A system on plasmid pSB1C3.]] <br />
<br />
| <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The picture shows the templates of PCR potocol. The split-GFP part and split-eIF4A part both have complementary linker sequences, which will anneal during the PCR process. <br />
|}<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP__fusion_part| RFP fusion system]] ===<br />
<br />
*Similarly, we fused the split-RFP part with split-eIF4A part via PCR to get two sequences:split-RFP-A+linker+split-eIF4A-A ([http://partsregistry.org/Part:BBa_K411103 BBa_K411103])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411104 BBa_K411104])<br />
<br />
== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#Aptamer| aptamer]] ==<br />
*We performed PCR to get the required aptamer based on sequence showed in the paper (Valencia-Burton et al., 2007).<br />
We first designed primers by adding a prefix in the front of the aptamer sequence and a suffix at the end of the aptamer sequence. We digested the aptamer with Xbal&PstI cutting enzymes and the pLac with Spal&PstI cutting enzymes. We then used ligase to join them together.<br />
<br />
<br />
<br />
=<font color=blue>Advantages</font>=<br />
1.'''Tests the promotor strength in a speedy way.'''<br />
*Conventionally, inducible promoter strength is tested by a reporter gene (e.g. GFP) downstream from the promoter. To do know, one needs to wait for protein folding (four hours for GFP). In our design, we can test the promoter strength at the mRNA level and only needs 3 min for the split GFP to reconstitute into functional protein.<br />
*A strong promoter will result in more RNA aptamers. The more RNA aptamer, the more our split GFP will combine to emit a stronger fluorescence. With a weaker promoter, less RNA aptamers are created, and thus, less split GFP will combine to fluoresce. <br />
2.'''Locates specific genes or chemicals (such as heavy metals)'''<br />
*Similar to the promoter testing, we can use the inducible promoter whose inducers are heavy metals(e.g. As or Zn). When these heavy metals is present, the promoter will be induced and transcribed into mRNA aptamer. With our GFP reporter, it will bind to the RNA aptamer and emit fluorescence. With this we can know that the quantity of heavy metal pollution in that environment. <br />
3.'''Helps other teams test their biobricks.'''<br />
<br />
4.'''Shows mRNA positioning in a sigle cells.'''<br />
*By understanding the RNA localization in a cell, we can learm more about how gene regulation works in a cell. And by understanding more about the precise gene regulations, we can explore more about the design rules in synthetic biology.<br />
<br />
5.'''Measures the quantity of the mRNA.'''<br />
<br />
6.'''Can be used to view the temporal dynamics in a cell'''<br />
<br />
7.'''Speeds up the reporting progress.'''<br />
*With our reporting system, we can produce fluorescence in or RNA or protein assya in roughly 3 minutesWe can do a protein assay or mRNA assay in our speedy reporter system. It is faster than the conventional method RT-PCR for mRNA which needs about two hours and western blot for protein quantitative analysis which requires about 4.5 hours.<br />
*The split GFP is a constitutive protein in the cell. Once the RNA aptamer is transcribed, the split GFP linked with eIF4A will bind to the RNA aptamer due to its high affinity. We skip the translation process due to the already-generated GFP.<br />
<br />
=<font color=blue>References</font>=<br />
*Barnard, E., McFerran, N.V., Trudgett, A., Nelson, J., and Timson, D.J. (2008). Development and implementation of split-GFP-based bimolecular fluorescence complementation (BiFC) assays in yeast. ''Biochem Soc Trans'' 36, 479-482.<br />
<br />
*Demidov, V.V., and Broude, N.E. (2006). Profluorescent protein fragments for fast bimolecular fluorescence complementation in vitro. ''Nat Protoc'' 1, 714-719.<br />
<br />
*Huttelmaier, S., Zenklusen, D., Lederer, M., Dictenberg, J., Lorenz, M., Meng, X., Bassell, G.J., Condeelis, J., and Singer, R.H. (2005). Spatial regulation of beta-actin translation by Src-dependent phosphorylation of ZBP1. ''Nature'' 438, 512-515.<br />
<br />
*Imataka, H., and Sonenberg, N. (1997). Human eukaryotic translation initiation factor 4G (eIF4G) possesses two separate and independent binding sites for eIF4A. ''Mol Cell Biol'' 17, 6940-6947.<br />
<br />
*Johnstone, O., and Lasko, P. (2001). Translational regulation and RNA localization in Drosophila oocytes and embryos. ''Annu Rev Genet'' 35, 365-406.<br />
<br />
*Lin, A.C., and Holt, C.E. (2007). Local translation and directional steering in axons. ''EMBO J'' 26, 3729-3736.<br />
<br />
*Martin, K.C., and Ephrussi, A. (2009). mRNA localization: gene expression in the spatial dimension. ''Cell'' 136, 719-730.<br />
<br />
*Oguro, A., Ohtsu, T., Svitkin, Y.V., Sonenberg, N., and Nakamura, Y. (2003). RNA aptamers to initiation factor 4A helicase hinder cap-dependent translation by blocking ATP hydrolysis. ''RNA'' 9, 394-407.<br />
<br />
*Paquin, N., and Chartrand, P. (2008). Local regulation of mRNA translation: new insights from the bud. ''Trends Cell Biol'' 18, 105-111.<br />
<br />
*Remy, I., and Michnick, S.W. (2007). Application of protein-fragment complementation assays in cell biology. ''Biotechniques'' 42, 137, 139, 141 passim.<br />
<br />
*Story, R.M., Li, H., and Abelson, J.N. (2001). Crystal structure of a DEAD box protein from the hyperthermophile Methanococcus jannaschii. ''Proc Natl Acad Sci U S A'' 98, 1465-1470.<br />
<br />
*Valencia-Burton, M., McCullough, R.M., Cantor, C.R., and Broude, N.E. (2007). RNA visualization in live bacterial cells using fluorescent protein complementation. ''Nat Methods'' 4, 421-427.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/TeamTeam:NYMU-Taipei/Team2010-10-28T00:41:11Z<p>Blackrabbit: /* Subteams */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
{{:Team:NYMU-Taipei/PersonStyle}}<br />
<br />
<br />
<html><div class="unfloat"></html><br />
*Speedy NYMU!!<br />
[[Image:DSCF0086.JPG|500px]][[Image:IMG_2142.JPG|500px]]<br />
<br />
== The Team ==<br />
<html></div></html><br />
We are a team consisting of people from a wide range of fields and disciplines including: Bioinformatics, Biomedical Engineering, Chemistry, Information Sciences, Life Sciences, Neuroscience, Medicine and Radiology.<br />
<html><style>.unfloat{float:left;clear:both;width:100%;}</style></html><br />
<html><div class="unfloat"></html><br />
=== Faculty Advisors ===<br />
{{:Team:NYMU-Taipei/PPLDB|faculty}}<br />
<html></div></html><br />
<br />
<html><div class="unfloat"></html><br />
===Graduate Consultants===<br />
{{:Team:NYMU-Taipei/PPLDB|grad}}<br />
<html></div></html><br />
<br />
<html><div class="unfloat"></html><br />
<br />
===Undergraduate Students===<br />
{{:Team:NYMU-Taipei/PPLDB|ugrad}}<br />
<html></div></html><br />
<br />
<br />
<br />
<html><div class="unfloat"></html><br />
<br />
== Subteams ==<br />
Our Subteams! The red bordered boxed people are the leaders of each subteam.<br />
<html></div></html><br />
<br />
<html><div class="unfloat"></html><br />
=== Speedy Reporter ===<br />
Reporting speedily:<br />
{{:Team:NYMU-Taipei/PPLDB|mrna|b=mrna}}<br />
<html></div></html><br />
<br />
<html><div class="unfloat"></html><br />
=== Speedy Switch ===<br />
Switchin' them ribos'<br />
{{:Team:NYMU-Taipei/PPLDB|ribo|b=ribo}}<br />
<html></div></html><br />
<br />
<html><div class="unfloat"></html><br />
=== Speedy Protein Degradation ===<br />
Degradation and the like<br />
{{:Team:NYMU-Taipei/PPLDB|ssra|b=ssra}}<br />
<html></div></html><br />
<br />
<html><div class="unfloat"></html><br />
=== Other ===<br />
{{:Team:NYMU-Taipei/PPLDB|other|b=other}}<br />
<html></div></html><br />
<br />
<br />
<html><div class="unfloat" style="width:100%"></html><br />
{{:Team:NYMU-Taipei/Footer}}<br />
<html></div></html><br />
<br />
<!-- Disclamer: This page has excessive use of templates. XP --></div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-28T00:36:17Z<p>Blackrabbit: /* Attributions and Contributions */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><embed src="https://static.igem.org/mediawiki/2010/5/58/NYMU_SpeedyBac_ani.mov" width="640" height="480"></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Attributions and Contributions</font> =<br />
The idea SpeedyBac was chosen and designed by the students. The experiments were done all by the students. The advisors and instructors only instructed. The breakdown of who participated in which subteam is shown on our [[Team:NYMU-Taipei/Team|Team]] page.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-28T00:35:20Z<p>Blackrabbit: /* Attributions and Contributions */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><embed src="https://static.igem.org/mediawiki/2010/5/58/NYMU_SpeedyBac_ani.mov" width="640" height="480"></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= Attributions and Contributions =<br />
The idea SpeedyBac was chosen and designed by the students. The experiments were done all by the students. The advisors and instructors only instructed. The breakdown of who participated in which subteam is shown on our [[Team:NYMU-Taipei/Team|Team]] page.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-28T00:34:51Z<p>Blackrabbit: /* Attributions and Contributions */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><embed src="https://static.igem.org/mediawiki/2010/5/58/NYMU_SpeedyBac_ani.mov" width="640" height="480"></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= Attributions and Contributions =<br />
The idea SpeedyBac was chosen and designed by the students. The experiments were done all by the students. The advisors and instructors only instructed. The breakdown of who participated in which subteam is shown on our [[NYMU-Taipei/Team|Team]] page.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-28T00:24:17Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><embed src="https://static.igem.org/mediawiki/2010/5/58/NYMU_SpeedyBac_ani.mov" width="640" height="480"></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= Attributions and Contributions =<br />
The idea SpeedyBac was chosen by the students. The experiments were done all by the students. The advisors and instructors only instructed.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_switchTeam:NYMU-Taipei/Project/Speedy switch2010-10-27T23:51:18Z<p>Blackrabbit: /* Experiments */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=<font color=blue>Abstract</font>=<br />
[[Image:NYMU_Central_Dogma.png|thumb|250px|right|The Central Dogma (top) and the effective central dogma when using riboswitches (bottom). Transcription is effectively skipped when ready for use, since the mRNA will have already been expressed.]]<br />
<br />
'''Speedy Switch controls the "on/off " of RNA translation. We use "Riboswitch" as our speedy switch to pause central dogma at the mRNA level.'''<br />
<br />
<br />
In the past, translating proteins from DNA has followed the central dogma of molecular biology: DNA to RNA to Protein. Normally, after mRNA is transcribed from DNA, ribosomes will bind to the ribosome binding site(RBS) and begin translating mRNA into protein. During this process, we have no way of knowing the location, nor the quantity of mRNA; and after the process, mRNA is quickly degraded. As such, it is very hard to research the detailed roles and implications of mRNA in the central dogma. To resolve this problem, we placed a mRNA level based switch which can be used to control the translation of mRNA: riboswitch.<br />
<br />
=<font color=blue>Introduction</font>=<br />
[[Image:NYMU Pre-ribo2.jpg|thumb|right|250px|The riboswitch is turned off. The RBS is hidden by the secondary structure the riboswitch forms. The ribosome is unable to bind to the RBS, suspending translation of the downstream gene.]]<br />
[[Image:NYMU Ribo-2.jpg|thumb|right|250px|The riboswitch is turned on when a specific small molecule binds to it. The ribosome can then bind to the RBS, inducing translation of the downstream gene.]]<br />
<br />
'''Function of Speedy Switch: speed up the cycle from DNA to mRNA to protein and act as a switch between the mRNA and protein levels'''<br />
<br />
In our project, Speedy Switch serves two main roles. The first is to speed up the expression cycle from DNA to mRNA to protein. Using a riboswitch we can pretranscribe a DNA into an mRNA, ready to be translated at a moments notice. In essence, we can produce protein without having to wait for transcription. The second role the riboswitch serves is to act as a switch between the mRNA and protein levels. Using a riboswitch, we can regulate downstream mRNA and control the expression of proteins.<br />
<br />
Typically, since translation often occurs at the moment mRNA passed into the cytoplasm, protein and mRNA normally exist together. With a riboswitch control, we can study both the expression of mRNA and the expression of protein in the same cells, without protein-mRNA interference. <br />
<br />
<br />
'''We use "Riboswitch" as our speedy switch, which can control translation. It can be divided into two parts: a sensor and an actuator.'''<br />
<br />
Before the discovery of RNA regulatory system , the only way to induce reaction in a cell was through inducible promoters. By turning these promoters on or off, we could control the transcription of the downstream DNA into RNA thus also controlling the translation of RNA to Protein. However, with only promoters we traditionally skip the RNA system involved in the pathway of protein synthesis. By inserting a "switch" between the DNA and RNA system we can make a thorough inspection into the individual mechanism of both systems and the cross-effect between their regulatory factors. <br />
<br />
The discovery of the riboswitch was based on data which described conserved mRNA secondary structure found on 5’-untranslated regions and the creation of small-molecule binding mRNA, sensors. The function of these riboswitches is similar to the function of inducible promoters in that they both regulate downstream genetic data: their difference is that while promoters regulate transcription of DNA, riboswitches control translation of mRNA. <br />
<br />
A riboswitch is a part of mRNA molecule that can bind a small molecule. When it does, the riboswitch will change its structure to regulate the following gene's activity.<br />
<br />
A riboswitch has two parts: a sensor and an actuator. These two components work together to form a ‘switch’. The sensor binds to a small molecule inducer, and the actuator structurally changes to regulate gene expression.<br />
(Harbaugh et al.,2008)(Lynch et al., 2006)<br />
==Purpose==<br />
*Verification of protein function<br />
**We can perform RNA assay and protein assay in the same cell<br />
*Control of protein expression<br />
<br />
=<font color=blue>Experiments</font>=<br />
<br />
[[Team:NYMU-Taipei/Experiments/Speedy_switch|Reporter Gene Assay Experiment Data]] show that the Theophylline Riboswitch works and has an increased rate of transcription (up to a point) with an increased amount of Theophylline.<br />
<br />
==Design==<br />
In order for a suitable riboswitch to work in our experiments, it needs to have the following characteristics:<br />
* The inducer does not naturally exist or metabolize in the target organism.<br />
* The riboswitch does not exist naturally in the target organism.<br />
* The riboswitch does not have EcoRI, XbaI, SpeI, or PstI cutting sites.<br />
** Although we can modify the cutting sites of our riboswitch, this action may cause more problems: the cutting site may mutate the secondary structure and molecule binding sites causing it to cease function.<br />
<br />
===An example of our '''Speedy Switch'''===<br />
<br />
Because we were using ''Escherichia coli'' DH5alpha as our chassie organism, so we decided to use '''Theophylline Riboswitch''' which fits all these requirements for our circuit design and enginnering. <br />
<br />
Since most riboswitches already have Ribosome binding sites (RBSs) in their structures, we did not add other RBSs in front of downstream reporters.<br />
<br />
After transforming the whole structure,"promoter+ riboswitch+ GFP+ terminator in plasmid" into ''Escherichia coli,''<br />
the cells will express GFP when theophylline (the inducer) is introduced.<br />
<br />
==Composition of our circuit==<br />
[[Image:NYMU Ribo circuit.jpg|left|thumb|500px|This is our circuit of speedy switch. Theophylline Riboswitch sequence is after the promoter, inclusive of the ribosome binding site. And then we put GFP,next is the terminator. We just add Theophylline, GFP will emit green fluorescence.]]<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
To test our hyposthesis, we needed to construct a circuit that has a promoter, a riboswitch, a reporter, and a terminator. We chose to use the theophylline riboswitch as it suited our requirements.<br />
<br />
When the full sequence outlined above is transformed into the bacteria, it waits, inactivated, for the right small molecule inducer, in this case, theophylline. When theophylline is added, it will induce the riboswitch to fold differently to allow the translation of the downstream gene, without waiting for transcription. <br />
<br />
By comparing the flourescence intensity data (the speed of GFP production), we can determine the difference in time between the traditional method of inducing promoters, to our method of inducing mRNA.<br />
<br />
===Promoter===<br />
*We used '''pLac''' constitutive promoter from Biobrick Parts Registry{{:Team:NYMU-Taipei/BBa|R0010}}<br />
<br />
We used this constitutive promoter because it can keep working without additional stimulation. So we can get sufficient mRNA with Theophylline Riboswitch in ''Escherichia coli'' DH5alpha. We just need to add Theophylline and Theophylline Riboswitch will function rapidly.<br />
<!-- * Although we have the sequence for the theophylline riboswitch, without a template, we could not run PCR (Polymerase Chain Reaction) to produce the quantity of DNA we required. To create this template, we design forward and reverse primers that have a common region.<br />
--><br />
<br />
===Theophylline Riboswitch===<br />
Since the sequence length of this riboswitch is relatively short, we decided to synthesize the riboswitch directly using two primers (which also contain the biobrick prefix and suffix)<br />
*sequence<br />
ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaag<br />
forward primer : gaattcgcggccgcttctagag ggtgataccagcatcgtcttgatgcccttggcag<br />
reverse primer : ctgcagcggccgctactagtacttgttgtcttgcagcggggtgctgccaagggcatcaagac<br />
<br />
PCR expected result (99bp)<br />
gaattcgcggccgcttctagagggtgataccagcatcgtcttgatgcccttggcag<br />
gaattcgcggccgcttctagag<font color="red">ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaag</font>tactagtagcggccgctgcag<br />
gtcttgatgcccttggcagcaccccgctgcaagacaacaagtactagtagcggccgctgcag<br />
<br />
These two primers anneal at this common region.<br />
<br />
===GFP+terminator===<br />
*We used biobrick {{:Team:NYMU-Taipei/BBa|J04630}}<br />
We used Green fluorescent protein as our reporter for two main reasons. First, GFP makes a great reporter because it fluoresces when it is activated, making itself easy to detect. We can measure the activity of the promoter by the intensity of the fluorescence . The second reason is that the GFP used is a biobrick, thus if another team needs to use this riboswitch circuit, it would be easy for them to attach another biobrick. So we chose biobrick - {{:Team:NYMU-Taipei/BBa|J04630}} (GFP with terminator)<br />
<br />
==Whole Process==<br />
# First, two riboswitch primers will anneal together at the common region through PCR amplification. <br />
# We then digested the riboswitch PCR product and a plasmid containing the plasmid backbone pSB1A2 with the restriction enzymes XbaI and PstI.<br />
# After gel extraction/PCR purification of the relevant parts, we ligated them and produced the biobrick part {{:Team:NYMU-Taipei/BBa|K411101}}.<br />
# Performed a back insert of {{:Team:NYMU-Taipei/BBa|J04630|(GFP+terminator)}} (digested with XbaI and PstI) into {{:Team:NYMU-Taipei/BBa|K411101}} (digested with SpeI and PstI) and formed the biobrick {{:Team:NYMU-Taipei/BBa|K411102}}.<br />
# Performed another back insert of {{:Team:NYMU-Taipei/BBa|K411102}} (digested with XbaI and PstI) into {{:Team:NYMU-Taipei/BBa|R0010|(lac promoter)}} (digested with SpeI and PstI) and formed the biobrick {{:Team:NYMU-Taipei/BBa|K411103}}.<br />
# Finally we tested this kind of ''Escherichia coli''. We add Theophylline to induce riboswitch and and translate GFP.<br />
<br />
=<font color=blue>Result</font>=<br />
In theory, if we add more inducers to a cell, riboswitch will translate more GFPs. But theophylline is toxic for ''Escherichia coli.'' From paper, we know that if theophylline concentration is over 5 &mu;M, ''Escherichia coli'' will die.(Lynch et al., 2006)<br />
[[Image:20101025(org).png|800px|In this picture, it shows that when more Theophylline is added, more GFP is created and fluoresces.<br />
For more of our speedy switch experimental data, please check out our SpeedBac experimental result section.]]<br />
<br />
This figure shows the results of our experiments. Comparing to N (stands for the Negative control), we find GFP express when we add Theophylline. <br />
For more Speedy Switch experimental data, please check out our SpeedBac experimental results [[Team:NYMU-Taipei/Experiments/Speedy switch | here]].<br />
<br />
=<font color=blue>Reference</font>=<br />
*Desai, S.K., and Gallivan, J.P. (2004). Genetic screens and selections for small molecules based on a synthetic riboswitch that activates protein translation. ''J Am Chem Soc'' 126, 13247-13254.<br />
<br />
*Harbaugh S.V., Davidson M.E., Chushak Y.G., Kelley-Loughnane N., and Stone M.O.(2008) Riboswitch-based sensor in low optical background. ''Proc. of SPIE'' 7040, 70400C<br />
<br />
*Lynch, S.A., Desai, S.K., Sajja, H.K., and Gallivan, J.P. (2007). A high-throughput screen for synthetic riboswitches reveals mechanistic insights into their function. ''Chem Biol'' 14, 173-184.<br />
<br />
*Mandal, M., Boese, B., Barrick, J.E., Winkler, W.C., and Breaker, R.R. (2003). Riboswitches control fundamental biochemical pathways in Bacillus subtilis and other bacteria. ''Cell'' 113, 577-586.<br />
<br />
*Suess, B., Fink, B., Berens, C., Stentz, R., and Hillen, W. (2004). A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. ''Nucleic Acids Res'' 32, 1610-1614.<br />
<br />
*Topp, S., and Gallivan, J.P. (2007). Guiding bacteria with small molecules and RNA. ''J Am Chem Soc'' 129, 6807-6811.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_switchTeam:NYMU-Taipei/Project/Speedy switch2010-10-27T23:43:54Z<p>Blackrabbit: /* Experiments */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=<font color=blue>Abstract</font>=<br />
[[Image:NYMU_Central_Dogma.png|thumb|250px|right|The Central Dogma (top) and the effective central dogma when using riboswitches (bottom). Transcription is effectively skipped when ready for use, since the mRNA will have already been expressed.]]<br />
<br />
'''Speedy Switch controls the "on/off " of RNA translation. We use "Riboswitch" as our speedy switch to pause central dogma at the mRNA level.'''<br />
<br />
<br />
In the past, translating proteins from DNA has followed the central dogma of molecular biology: DNA to RNA to Protein. Normally, after mRNA is transcribed from DNA, ribosomes will bind to the ribosome binding site(RBS) and begin translating mRNA into protein. During this process, we have no way of knowing the location, nor the quantity of mRNA; and after the process, mRNA is quickly degraded. As such, it is very hard to research the detailed roles and implications of mRNA in the central dogma. To resolve this problem, we placed a mRNA level based switch which can be used to control the translation of mRNA: riboswitch.<br />
<br />
=<font color=blue>Introduction</font>=<br />
[[Image:NYMU Pre-ribo2.jpg|thumb|right|250px|The riboswitch is turned off. The RBS is hidden by the secondary structure the riboswitch forms. The ribosome is unable to bind to the RBS, suspending translation of the downstream gene.]]<br />
[[Image:NYMU Ribo-2.jpg|thumb|right|250px|The riboswitch is turned on when a specific small molecule binds to it. The ribosome can then bind to the RBS, inducing translation of the downstream gene.]]<br />
<br />
'''Function of Speedy Switch: speed up the cycle from DNA to mRNA to protein and act as a switch between the mRNA and protein levels'''<br />
<br />
In our project, Speedy Switch serves two main roles. The first is to speed up the expression cycle from DNA to mRNA to protein. Using a riboswitch we can pretranscribe a DNA into an mRNA, ready to be translated at a moments notice. In essence, we can produce protein without having to wait for transcription. The second role the riboswitch serves is to act as a switch between the mRNA and protein levels. Using a riboswitch, we can regulate downstream mRNA and control the expression of proteins.<br />
<br />
Typically, since translation often occurs at the moment mRNA passed into the cytoplasm, protein and mRNA normally exist together. With a riboswitch control, we can study both the expression of mRNA and the expression of protein in the same cells, without protein-mRNA interference. <br />
<br />
<br />
'''We use "Riboswitch" as our speedy switch, which can control translation. It can be divided into two parts: a sensor and an actuator.'''<br />
<br />
Before the discovery of RNA regulatory system , the only way to induce reaction in a cell was through inducible promoters. By turning these promoters on or off, we could control the transcription of the downstream DNA into RNA thus also controlling the translation of RNA to Protein. However, with only promoters we traditionally skip the RNA system involved in the pathway of protein synthesis. By inserting a "switch" between the DNA and RNA system we can make a thorough inspection into the individual mechanism of both systems and the cross-effect between their regulatory factors. <br />
<br />
The discovery of the riboswitch was based on data which described conserved mRNA secondary structure found on 5’-untranslated regions and the creation of small-molecule binding mRNA, sensors. The function of these riboswitches is similar to the function of inducible promoters in that they both regulate downstream genetic data: their difference is that while promoters regulate transcription of DNA, riboswitches control translation of mRNA. <br />
<br />
A riboswitch is a part of mRNA molecule that can bind a small molecule. When it does, the riboswitch will change its structure to regulate the following gene's activity.<br />
<br />
A riboswitch has two parts: a sensor and an actuator. These two components work together to form a ‘switch’. The sensor binds to a small molecule inducer, and the actuator structurally changes to regulate gene expression.<br />
(Harbaugh et al.,2008)(Lynch et al., 2006)<br />
==Purpose==<br />
*Verification of protein function<br />
**We can perform RNA assay and protein assay in the same cell<br />
*Control of protein expression<br />
<br />
=<font color=blue>Experiments</font>=<br />
<br />
[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switch|Reporter Gene Assay Experiment Data]] show that the Theophylline Riboswitch works.<br />
<br />
==Design==<br />
In order for a suitable riboswitch to work in our experiments, it needs to have the following characteristics:<br />
* The inducer does not naturally exist or metabolize in the target organism.<br />
* The riboswitch does not exist naturally in the target organism.<br />
* The riboswitch does not have EcoRI, XbaI, SpeI, or PstI cutting sites.<br />
** Although we can modify the cutting sites of our riboswitch, this action may cause more problems: the cutting site may mutate the secondary structure and molecule binding sites causing it to cease function.<br />
<br />
===An example of our '''Speedy Switch'''===<br />
<br />
Because we were using ''Escherichia coli'' DH5alpha as our chassie organism, so we decided to use '''Theophylline Riboswitch''' which fits all these requirements for our circuit design and enginnering. <br />
<br />
Since most riboswitches already have Ribosome binding sites (RBSs) in their structures, we did not add other RBSs in front of downstream reporters.<br />
<br />
After transforming the whole structure,"promoter+ riboswitch+ GFP+ terminator in plasmid" into ''Escherichia coli,''<br />
the cells will express GFP when theophylline (the inducer) is introduced.<br />
<br />
==Composition of our circuit==<br />
[[Image:NYMU Ribo circuit.jpg|left|thumb|500px|This is our circuit of speedy switch. Theophylline Riboswitch sequence is after the promoter, inclusive of the ribosome binding site. And then we put GFP,next is the terminator. We just add Theophylline, GFP will emit green fluorescence.]]<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
To test our hyposthesis, we needed to construct a circuit that has a promoter, a riboswitch, a reporter, and a terminator. We chose to use the theophylline riboswitch as it suited our requirements.<br />
<br />
When the full sequence outlined above is transformed into the bacteria, it waits, inactivated, for the right small molecule inducer, in this case, theophylline. When theophylline is added, it will induce the riboswitch to fold differently to allow the translation of the downstream gene, without waiting for transcription. <br />
<br />
By comparing the flourescence intensity data (the speed of GFP production), we can determine the difference in time between the traditional method of inducing promoters, to our method of inducing mRNA.<br />
<br />
===Promoter===<br />
*We used '''pLac''' constitutive promoter from Biobrick Parts Registry{{:Team:NYMU-Taipei/BBa|R0010}}<br />
<br />
We used this constitutive promoter because it can keep working without additional stimulation. So we can get sufficient mRNA with Theophylline Riboswitch in ''Escherichia coli'' DH5alpha. We just need to add Theophylline and Theophylline Riboswitch will function rapidly.<br />
<!-- * Although we have the sequence for the theophylline riboswitch, without a template, we could not run PCR (Polymerase Chain Reaction) to produce the quantity of DNA we required. To create this template, we design forward and reverse primers that have a common region.<br />
--><br />
<br />
===Theophylline Riboswitch===<br />
Since the sequence length of this riboswitch is relatively short, we decided to synthesize the riboswitch directly using two primers (which also contain the biobrick prefix and suffix)<br />
*sequence<br />
ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaag<br />
forward primer : gaattcgcggccgcttctagag ggtgataccagcatcgtcttgatgcccttggcag<br />
reverse primer : ctgcagcggccgctactagtacttgttgtcttgcagcggggtgctgccaagggcatcaagac<br />
<br />
PCR expected result (99bp)<br />
gaattcgcggccgcttctagagggtgataccagcatcgtcttgatgcccttggcag<br />
gaattcgcggccgcttctagag<font color="red">ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaag</font>tactagtagcggccgctgcag<br />
gtcttgatgcccttggcagcaccccgctgcaagacaacaagtactagtagcggccgctgcag<br />
<br />
These two primers anneal at this common region.<br />
<br />
===GFP+terminator===<br />
*We used biobrick {{:Team:NYMU-Taipei/BBa|J04630}}<br />
We used Green fluorescent protein as our reporter for two main reasons. First, GFP makes a great reporter because it fluoresces when it is activated, making itself easy to detect. We can measure the activity of the promoter by the intensity of the fluorescence . The second reason is that the GFP used is a biobrick, thus if another team needs to use this riboswitch circuit, it would be easy for them to attach another biobrick. So we chose biobrick - {{:Team:NYMU-Taipei/BBa|J04630}} (GFP with terminator)<br />
<br />
==Whole Process==<br />
# First, two riboswitch primers will anneal together at the common region through PCR amplification. <br />
# We then digested the riboswitch PCR product and a plasmid containing the plasmid backbone pSB1A2 with the restriction enzymes XbaI and PstI.<br />
# After gel extraction/PCR purification of the relevant parts, we ligated them and produced the biobrick part {{:Team:NYMU-Taipei/BBa|K411101}}.<br />
# Performed a back insert of {{:Team:NYMU-Taipei/BBa|J04630|(GFP+terminator)}} (digested with XbaI and PstI) into {{:Team:NYMU-Taipei/BBa|K411101}} (digested with SpeI and PstI) and formed the biobrick {{:Team:NYMU-Taipei/BBa|K411102}}.<br />
# Performed another back insert of {{:Team:NYMU-Taipei/BBa|K411102}} (digested with XbaI and PstI) into {{:Team:NYMU-Taipei/BBa|R0010|(lac promoter)}} (digested with SpeI and PstI) and formed the biobrick {{:Team:NYMU-Taipei/BBa|K411103}}.<br />
# Finally we tested this kind of ''Escherichia coli''. We add Theophylline to induce riboswitch and and translate GFP.<br />
<br />
=<font color=blue>Result</font>=<br />
In theory, if we add more inducers to a cell, riboswitch will translate more GFPs. But theophylline is toxic for ''Escherichia coli.'' From paper, we know that if theophylline concentration is over 5 &mu;M, ''Escherichia coli'' will die.(Lynch et al., 2006)<br />
[[Image:20101025(org).png|800px|In this picture, it shows that when more Theophylline is added, more GFP is created and fluoresces.<br />
For more of our speedy switch experimental data, please check out our SpeedBac experimental result section.]]<br />
<br />
This figure shows the results of our experiments. Comparing to N (stands for the Negative control), we find GFP express when we add Theophylline. <br />
For more Speedy Switch experimental data, please check out our SpeedBac experimental results [[Team:NYMU-Taipei/Experiments/Speedy switch | here]].<br />
<br />
=<font color=blue>Reference</font>=<br />
*Desai, S.K., and Gallivan, J.P. (2004). Genetic screens and selections for small molecules based on a synthetic riboswitch that activates protein translation. ''J Am Chem Soc'' 126, 13247-13254.<br />
<br />
*Harbaugh S.V., Davidson M.E., Chushak Y.G., Kelley-Loughnane N., and Stone M.O.(2008) Riboswitch-based sensor in low optical background. ''Proc. of SPIE'' 7040, 70400C<br />
<br />
*Lynch, S.A., Desai, S.K., Sajja, H.K., and Gallivan, J.P. (2007). A high-throughput screen for synthetic riboswitches reveals mechanistic insights into their function. ''Chem Biol'' 14, 173-184.<br />
<br />
*Mandal, M., Boese, B., Barrick, J.E., Winkler, W.C., and Breaker, R.R. (2003). Riboswitches control fundamental biochemical pathways in Bacillus subtilis and other bacteria. ''Cell'' 113, 577-586.<br />
<br />
*Suess, B., Fink, B., Berens, C., Stentz, R., and Hillen, W. (2004). A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. ''Nucleic Acids Res'' 32, 1610-1614.<br />
<br />
*Topp, S., and Gallivan, J.P. (2007). Guiding bacteria with small molecules and RNA. ''J Am Chem Soc'' 129, 6807-6811.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_protein_degraderTeam:NYMU-Taipei/Project/Speedy protein degrader2010-10-27T23:43:02Z<p>Blackrabbit: /* Data analysis */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=<font color=blue>Abstract</font>=<br />
* We developed the fluorescent proteins with '''degradation tags''' which accelerate the reporter turnover. This provides '''better temporal resolution''' of gene expression profiling in single cells.<br />
<br />
<br />
<br />
A central goal of synthetic biology is to explore the design principles that embedded in the architecture and operation of biological systems. To understand how biological systems are genetically assembled, synthetic biologists need tools to quantitatively describe the gene expression in model organisms. Fluorescent proteins(FP), along with modern microscopes, allow real-time gene expression profiling at the level of individual living cells. Though the detection of FPs benefits from their stability, this advantage turns awkward when we are monitoring the dynamic cellular events which required measurements at higher temporal resolution. One approach to achieve such demand is specific and accelerated reporter degradation. Thus, we focus on the design of fusion proteins with degradation tags. Previous studies suggest the LVA tag has hitherto been most efficient tag to shorten the half-life of tagged protein in ''Escherichia coli''. We added LVA tags to the C-terminal of different fluorescent proteins. Our results indicate that the half-life of fluorophores are significantly reduced. Therefore, we improved the temporal resolution of reporter proteins. This provides a promising tool for studying transient gene expression in the future.<br />
<br />
=<font color=blue>Motivation</font>=<br />
<br />
*How can we '''improve the temporal sampling''' of biological assay? We applied '''destabilized fluorescent proteins''' to achieve this goal.<br />
<br />
<br />
<br />
Fluorescent proteins, for example, green fluorescent protein (GFP), are now widely used to visualize a protein’s distribution and dynamics in a subcellular compartment. The remarkable feature of the fluorescent proteins (FP) is that the fluorophore forms spontaneously (Chalfie et al., 1994) without the need of any substrate or cofactor (Heim et al., 1994). In addition, FP variants can be fused to virtually any protein of interest; thus, they can be used in many species for detection purposes within single living cells. FPs, together with modern microscopes, has become essential tools for studying spatial and temporal dynamics of cellular processes at high resolution.<br />
<br />
The biophysical characteristics of fluorescent probes provide opportunities and, set limitations for fusion-protein studies. The fluorophore of GFP and its variants is contained within a barrel of beta-sheet protein (Ormo et al., 1996). This compact structure renders FPs with high photostability under a variety of conditions, even under treatment with protease (Chalfie et al., 1994). Once stable FPs formed, they are cleared from the cells in tens of hours (Andersen et al., 1998). This property allows prolonged imaging of cells, and easier detection when FPs accumulated. However, the stability of FPs limits its application in some studies which needs fast reporter turnover, for example, studies of transient gene expression. This also impedes the measurements of temporal expression pattern and behavior of proteins, because proteins at different stages of their lifetime are being detected. To overcome this limitation, we tried to develop destablized FPs.<br />
<br />
There are several ways to generate FP variants with different spectral and expression properties. One approach is mutagenesis studies. Though this approach is fruitful (Delagrave et al., 1995; Heim et al., 1995; Zacharias et al., 2002), it seems impractical to screen possible mutations of each FP in ever-increasing FP libraries. Alternatively, we planed to control proteolysis by adding degradation tags to FPs (Andersen et al., 1998). This approach can be easily generalized to several FPs; thus, it provides extensibility to future applications.<br />
<br />
=<font color=blue>Design: Controlled protein degradation in bacteria</font>=<br />
*We added the '''degradation tag''' to each fluorescent protein. This approach effectively '''accelerates reporter turnover'''.<br />
<br />
<br />
<br />
The flow of genetic information can—and sometimes need to — depend not only on its controlled synthesis but also equally on its controlled degradation. Indeed, protein degradation in natural systems is essential for cellular functions. Previous study showed that 2.7% of proteins are degraded per generation in ''Escherichia coli'' (''E. coli.'') growing in logarithmic phase (Fox and Brown, 1961). Control of protein turnover is required for cell cycle progression, signal transduction, and rapid responses to environmental challenges (Grunenfelder et al., 2001; Hengge-Aronis, 2002; Neher et al., 2003). Therefore, regulated degradation is expected to be critical for the development of synthetic circuits.<br />
<br />
To control the half-life of specific proteins, we utilized the regulated proteolysis machineries naturally employed to bacterial systems. Regulated degradation is ubiquitous for prokaryotic and eukaryotic cells (Hershko and Ciechanover, 1998; Jenal and Hengge-Aronis, 2003), because they need to clear damaged or aberrant proteins while ignoring functional ones. A common strategy for substrate selection is adding degradation tags to target proteins. Then, certain proteases execute energy dependent degradation of those proteins. One prominent type of degradation tag in prokaryotes is the ssrA tag, a tmRNA encoded by ssrA gene. This tagging system is engaged in protein quality control throughout all eubacteria (Karzai et al., 2000). Though it was first described as a mechanism to clear obstructed ribosomes (Keiler et al., 1996), recent studies suggested ssrA-mediated tagging also plays a regulatory role in the expression of lac operon (Abo et al., 2000). This motivated us to control the protein expression via manipulating controlled proteolysis.<br />
<br />
===SsrA tag===<br />
SsrA tag, encoded by the ssrA RNA, is important for protein quality control in bacteria. SsrA RNA is recognized as tmRNA because it has characteristics of both tRNA and mRNA (Atkins and Gesteland, 1996; Keiler et al., 1996). When ''E. coli.'' ribosomes stall during translation due to absence of a proper stop codon, ssrA ribosome-rescue system mediates C-terminal modification by adding the sequence AANDENYALAA to the the incomplete peptide (Keiler et al., 1996). SsrA tagging frees these ribosomes for other mRNAs, and targets the defective polypeptides for degradation by ClpXP and other ATP-dependent proteases (Gottesman et al., 1998). Previous studies suggested that 0.5% of protein products in ''E. coli.''. receive ssrA tags (Lies and Maurizi, 2008). Bacterial strains lacking functional ssrA gene show slower growth (Oh and Apirion, 1991), reduction in motility (Komine et al., 1994), and subsided pathogenesis (Julio et al., 2000). These results indicate that ssrA tagging system play a major role in bacterial physiology.<br />
<br />
The SsrA tag contains binding sites for the SspB adaptor and ClpXP protease (Levchenko et al., 2000). The SspB adaptor enhances substrate delivery by tethering SsrA-tagged proteins to the ClpX, which unfolds the tagged protein, and then translocates the denatured polypeptide into ClpP for degradation (Fig.1)(Sauer et al., 2004). The binding affinity of the ssrA tag to the SspB and ClpX plays key role in modulating substrate choice (Flynn et al., 2004) and the efficiency of degradation (Hersch et al., 2004; McGinness et al., 2006). One of the mutants, called LVA tag, further accelerates the degradation of tagged proteins compared to the wild-type LAA tag (Andersen et al., 1998). LVA tag has been applied to construct a fast synthetic gene oscillator, because it decreases protein lifetime and increases temporal resolution (Stricker et al., 2008). Thus, we added the LVA tag to FPs to maximize the temporal resolution of these reporters.<br />
<br />
<br />
<br />
[[Image:SsrA 2.png.jpg|900px||frame|none|Fig.1 Molecular mechanism of SsrA-SspB system]]<br />
<br />
===Circuit Design===<br />
<br />
*We designed four fluorescence protein circuits. In each following panel, the upper one is the conrol, and the lower one is the one with LVA tag. <br />
<br />
[[Image:GFP&LVA.png|frame|none|Fig.2 GFP(BBa_K411233) and GFP with LVA tag(BBa_K411237)]]<br />
<br />
[[Image:RFP&LVA.png|frame|none|Fig.3 RFP(BBa_K411234) and RFP with LVA tag(BBa_K411238)]]<br />
<br />
[[Image:CFP&LVA.png|frame|none|Fig.4 CFP(BBa_K411231) and CFP with LVA tag(BBa_K411235)]]<br />
<br />
[[Image:YFP&LVA.png|frame|none|Fig.5 YFP(BBa_K411232) and YFP with LVA tag(BBa_K411236)]]<br />
<br />
<br />
For details of this part, please see: [[Team:NYMU-Taipei/Experiments#Parts|Designed Parts]], [[Team:NYMU-Taipei/Project/Speedy protein degrader/Sequences|Sequences]]<br />
<br />
=<font color=blue>Data analysis</font>=<br />
[[Team:NYMU-Taipei/Experiments/Speedy_degrader#Results|This page]] contains the experimental data gathered through reporting assays.<br />
<br />
=<font color=blue>Advantages</font>=<br />
<br />
1.'''Universal''': <br />
<br />
The SsrA-SspB system is employed in all eubacteria (Karzai et al., 2000) whose genomes have been sequenced. Thus, the ‘speedy degrader’ can be easily implemented in other prokaryotic systems, for example, ''Bacillus subtilis''. Actually, the components of SsrA system has been transplanted into a ''Saccharomyces cerevisiae'' strain that allows for tunable degradation of a tagged protein (Grilly et al., 2007). The striking instance suggested that it is plausible to apply the ‘speedy degrader’ even in eukaryotic systems.<br />
<br />
2.'''Less interference to the protein function''': <br />
<br />
Most fusion protein studies require an available functional assay. Because the peptide tag may be detrimental to the structure of target protein, it is critical to assure that the tagged protein behaves as the native protein. A nonfunctional FP-tagged protein will be uninformative in most, if not all, biological studies. Fortunately, ssrA tag does not affect the structure or thermodynamic stability of attached proteins (Gottesman et al., 1998). Therefore, the degradation tag will be a suitable component to integrate with other synthetic devices.<br />
<br />
=<font color=blue>Reference</font>=<br />
*Abo, T., Inada, T., Ogawa, K., and Aiba, H. (2000). SsrA-mediated tagging and proteolysis of LacI and its role in the regulation of lac operon. ''EMBO J'' 19, 3762-3769.<br />
<br />
*Andersen, J.B., Sternberg, C., Poulsen, L.K., Bjorn, S.P., Givskov, M., and Molin, S. (1998). New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. ''Appl Environ Microbiol'' 64, 2240-2246.<br />
<br />
*Atkins, J.F., and Gesteland, R.F. (1996). A case for trans translation. ''Nature'' 379, 769-771.<br />
<br />
*Chalfie, M., Tu, Y., Euskirchen, G., Ward, W.W., and Prasher, D.C. (1994). Green fluorescent protein as a marker for gene expression. ''Science'' 263, 802-805.<br />
<br />
*Delagrave, S., Hawtin, R.E., Silva, C.M., Yang, M.M., and Youvan, D.C. (1995). Red-shifted excitation mutants of the green fluorescent protein. ''Biotechnology (N Y)'' 13, 151-154.<br />
<br />
*Flynn, J.M., Levchenko, I., Sauer, R.T., and Baker, T.A. (2004). Modulating substrate choice: the SspB adaptor delivers a regulator of the extracytoplasmic-stress response to the AAA+ protease ClpXP for degradation. ''Genes Dev'' 18, 2292-2301.<br />
<br />
*Fox, G., and Brown, J.W. (1961). Protein degradation in Escherichia coli in the logarithmic phase of growth. ''Biochim Biophys Acta'' 46, 387-389.<br />
<br />
*Gottesman, S., Roche, E., Zhou, Y., and Sauer, R.T. (1998). The ClpXP and ClpAP proteases degrade proteins with carboxy-terminal peptide tails added by the SsrA-tagging system. ''Genes Dev'' 12, 1338-1347.<br />
<br />
*Grilly, C., Stricker, J., Pang, W.L., Bennett, M.R., and Hasty, J. (2007). A synthetic gene network for tuning protein degradation in Saccharomyces cerevisiae. ''Mol Syst Biol'' 3, 127.<br />
<br />
*Grunenfelder, B., Rummel, G., Vohradsky, J., Roder, D., Langen, H., and Jenal, U. (2001). Proteomic analysis of the bacterial cell cycle. ''Proc Natl Acad Sci U S A'' 98, 4681-4686.<br />
<br />
*Heim, R., Cubitt, A.B., and Tsien, R.Y. (1995). Improved green fluorescence. ''Nature'' 373, 663-664.<br />
<br />
*Heim, R., Prasher, D.C., and Tsien, R.Y. (1994). Wavelength mutations and posttranslational autoxidation of green fluorescent protein. ''Proc Natl Acad Sci U S A'' 91, 12501-12504.<br />
<br />
*Hengge-Aronis, R. (2002). Signal transduction and regulatory mechanisms involved in control of the sigma(S) (RpoS) subunit of RNA polymerase. ''Microbiol Mol Biol Rev'' 66, 373-395<br />
<br />
*Hersch, G.L., Baker, T.A., and Sauer, R.T. (2004). SspB delivery of substrates for ClpXP proteolysis probed by the design of improved degradation tags. ''Proc Natl Acad Sci U S A'' 101, 12136-12141.<br />
<br />
*Hershko, A., and Ciechanover, A. (1998). The ubiquitin system. ''Annu Rev Biochem'' 67, 425-479.<br />
<br />
*Jenal, U., and Hengge-Aronis, R. (2003). Regulation by proteolysis in bacterial cells. ''Curr Opin Microbiol'' 6, 163-172.<br />
<br />
*Julio, S.M., Heithoff, D.M., and Mahan, M.J. (2000). ssrA (tmRNA) plays a role in Salmonella enterica serovar Typhimurium pathogenesis. ''J Bacteriol'' 182, 1558-1563.<br />
<br />
*Karzai, A.W., Roche, E.D., and Sauer, R.T. (2000). The SsrA-SmpB system for protein tagging, directed degradation and ribosome rescue. ''Nat Struct Biol'' 7, 449-455.<br />
<br />
*Keiler, K.C., Waller, P.R., and Sauer, R.T. (1996). Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA. ''Science'' 271, 990-993.<br />
<br />
*Komine, Y., Kitabatake, M., Yokogawa, T., Nishikawa, K., and Inokuchi, H. (1994). A tRNA-like structure is present in 10Sa RNA, a small stable RNA from Escherichia coli. ''Proc Natl Acad Sci U S A'' 91, 9223-9227.<br />
<br />
*Levchenko, I., Seidel, M., Sauer, R.T., and Baker, T.A. (2000). A specificity-enhancing factor for the ClpXP degradation machine. ''Science'' 289, 2354-2356.<br />
<br />
*Lies, M., and Maurizi, M.R. (2008). Turnover of endogenous SsrA-tagged proteins mediated by ATP-dependent proteases in Escherichia coli. ''J Biol Chem'' 283, 22918-22929.<br />
<br />
*McGinness, K.E., Baker, T.A., and Sauer, R.T. (2006). Engineering controllable protein degradation. ''Mol Cell'' 22, 701-707.<br />
<br />
*Neher, S.B., Flynn, J.M., Sauer, R.T., and Baker, T.A. (2003). Latent ClpX-recognition signals ensure LexA destruction after DNA damage. ''Genes Dev'' 17, 1084-1089.<br />
<br />
*Oh, B.K., and Apirion, D. (1991). 10Sa RNA, a small stable RNA of Escherichia coli, is functional. ''Mol Gen Genet'' 229, 52-56.<br />
<br />
*Ormo, M., Cubitt, A.B., Kallio, K., Gross, L.A., Tsien, R.Y., and Remington, S.J. (1996). Crystal structure of the Aequorea victoria green fluorescent protein. ''Science'' 273, 1392-1395.<br />
<br />
*Sauer, R.T., Bolon, D.N., Burton, B.M., Burton, R.E., Flynn, J.M., Grant, R.A., Hersch, G.L., Joshi, S.A., Kenniston, J.A., Levchenko, I., et al. (2004). Sculpting the proteome with AAA(+) proteases and disassembly machines. ''Cell'' 119, 9-18.<br />
<br />
*Stricker, J., Cookson, S., Bennett, M.R., Mather, W.H., Tsimring, L.S., and Hasty, J. (2008). A fast, robust and tunable synthetic gene oscillator. ''Nature'' 456, 516-519.<br />
<br />
*Zacharias, D.A., Violin, J.D., Newton, A.C., and Tsien, R.Y. (2002). Partitioning of lipid-modified monomeric GFPs into membrane microdomains of live cells. ''Science'' 296, 913-916.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T23:31:49Z<p>Blackrabbit: /* Reporting Assay 1 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
*We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
*According to the author Beatrix '' etal'',the paper said that after added more than 5mM theophylline the ''Escherichia coli'' would die(Beatrix,2004).<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporterTeam:NYMU-Taipei/Project/Speedy reporter2010-10-27T21:43:44Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=<font color=blue>Abstract</font>=<br />
* Our Speedy RNA+protein reporter effectively skips protein folding when reporting, thus reducing the time for a fluorescent response.<br />
More specific insights into molecular mechanisms and gene regulation are essential for improvement in synthetic biology. Understanding these mechanisms requires time. Our speedy reporter for reporting RNA and protein expression in a cell effectively skips protein folding when reporting -- the longest part of gene expression - thus reducing the time needed to get fluorescence. By speeding up the reporter, in both RNA and protein, we have also speed up the exploration for rules in the biological system. We can not only generate more novel circuits but also explore gene regulations in synthetic biology.<br />
<br />
=<font color=blue>Introduction</font> =<br />
Recent studies of mRNA localization show that a great part of mRNA localize in specific cytoplasm position (Martin and Ephrussi, 2009). For examples, ASH1 mRNA localize at bud tip of budding yeast to allow asymmetric segregation from mother to daughter cell (Paquin and Chartrand, 2008). In the ''Drosophila'' the localization of mRNA at anterior and posterior of oocyte play an important role in the developing embryo (Johnstone and Lasko, 2001). Local translation of mRNAs in axonal growth cones helps axon navigate to it synaptic partners (Lin and Holt, 2007). β-actins mRNA localize at sites of active actins polymerization, cytoskeletal-mediate motility need mRNA translation (Huttelmaier et al., 2005). All the examples above is studies on eukaryotic system. there are a few studies of mRNA location in prokaryotic system. And most of synthetic biology designs on prokaryotic bacteria. The more basic rule of prokaryotic system we know, the more successful and speedy experiments we will have.<br />
<br />
<br />
The common way to detect mRNA is RT-PCR, which can only be done in vitro but can’t in a real living cell. The common way to detect the protein is fusion a reporter protein such as GFP to report it, and the folding of GFP takes about four hours. In order to do both assay speedy and in vivo, we apply a novel technique Bimolecular Fluorescence Complementation, BiFC. In our design, we need not to wait four hours for folding of GFP to detect our protein fusion GFP. We can get our signal in few minute using this method. And it also can detect the mRNA both location and quantity (Demidov and Broude, 2006). We can use this method save about fours for protein assay and two hours for mRNA assay (Fig.1). <br />
<br />
{| border=0 <br />
| rowspan=10 | [[image:NYMU_Speedy_fig..png|frame|none|200px|Figure.1 compare to the traditional method of detecting mRNA and protein. our speedy reporter only need 3 min to obtain signal (Demidov and Broude, 2006).]]<br />
| BiFC is developed base on the technique Protein-fragment Complement Assay, PCA (Barnard et al., 2008; Demidov and Broude, 2006). Protein-protein interactions coupled to refolding of a pair of split enzymes in the PCA technique. The enzyme used in PCA has it activity only when two split parts reconstruct together. The activities of enzyme act as a detector of protein-protein interaction (Remy and Michnick, 2007). While the BiFC technique use split fluorescent protein instead of split enzyme in the PCA. The split form of fluorescent protein alone has no fluorescence. Fluorescence appears when two split parts reassembly together immediately in few minutes. For mRNA detection, we design a system differ from BiFC’s protein-protein interaction to RNA-protein interaction. Where a GFP is split into two inactive parts and fused with two parts of the split-eIF4A protein, a kind of RNA binding protein. On the other hand, we designed an mRNA aptamer that the eIF4A protein can bind to. EGFP will fluoresce through the interaction of split eIF4A and its corresponding aptamer. Using this method, we can immediately detect mRNA quantity and location in vivo. For protein detection, we design another system of BiFC which RFP is splits into two inactive parts and fused with two parts of antibody light chain and heavy chain. And then we fused the antigen to target protein. When target protein fusion antigen appears, the light chain and heavy chain combine with antigen. And then split RFPs reconstruct and fluoresce.<br />
|}<br />
<br />
=<font color=blue>Design</font>=<br />
<br />
<br />
== RNA reporter Design ==<br />
*Our circuit design:<br />
**EGFP-eIF4A system / RNA aptamer on plasmid pSB1C3.<br />
[[Image:RNA Binding 1 (1).png|500px|EGFP-eIF4A system on plasmid pSB1C3.]]<br />
[[Image:RNA Binding 2.png|400px|RNA aptamer on plasmid pSB1C3.]]<br />
===EGFP/ERFP + split eIF4A===<br />
*split GFP/RFP<br />
We split the EGFP/ERFP into two parts, the larger N-terminal part and the smaller C-terminal part. The N-terminal part contains performed chromophore and has a very weak fluorescence that is hard to detect. Only when it combines with the small C-terminal fragment, does the fluorescence become very bright. When both parts combine, we can detect the location of the mRNA and protein. The probability that these two split parts of EGFP/ERFP can fit together without an outside force is very low, thus ther are few false-positive signal (Demidov and Broude, 2006).<br />
*eIF4A<br />
eIF4A is an abbreviation for eukaryotic initiation factor 4A. It is a member of the DEAD-box RNA helicase protein family eIF4F (Oguro et al., 2003), and the DEAD-box is one of the largest subgroups of the RNA helicase protein family (Story et al., 2001). <br />
<br />
Eukaryotic translation initiation factor 4F (eIF4F) is a protein consists of eIF4A, eIF4E, and eIF4G. eIF4A is a helicase need ATP to unwind the secondary structure of mRNA untranslated region and make ribosome binds easier. eIF4E can binds to the cap structure of mRNA. eIF4G is like a scaffold of eIF4A and eIF4E helping them coordinate their functions. Without eIF4E and eIF4G the eIF4A alone exist much lower RNA helicase activity than complete eIF4F (Imataka and Sonenberg, 1997).<br />
<br />
===eIF4A binding aptamer===<br />
* What is the eIF4A binding aptamer? <br />
The eIF4A aptamer that we used has a high affinity for complete eIF4A protein. Its affinity is strong enough that it will combine the split eIF4A(described above) into a complete eIF4A protein. In the presence of eIF4A aptamer, ATP hydrolysis is inhibited and the RNA substrate which binds onto the eIF4A cannot unwind. <br />
<br />
It is proposed that the eIF4A structure is in a equilibrium between dumbbell-shaped structure and compact struction in solution. In the presence of ATP and absence of RNA aptamer, the equilibrium will be shifted into the dumbbell-shaped eIF4A (Fig.2). In the opposite condition, the equilibrium will be shifted into the compact one (Valencia-Burton et al., 2007).<br />
[[Image:NYMU_EIF4A.aptamer.png|frame|none|100px|Figure.2 Two domains and the structure equilibrium of eIF4A (Oguro et al., 2003)]]<br />
*eIF4A aptamer Secondary structure:<br />
** Structure predicted by RNAfold: [[Image:NYMU Aptamer Structure predicted by RNAfold.png|frame|none|Figure.3 Aptamer Structure predicted by RNAfold]]<br />
** Structure of eIF4A aptamer: [[Image:NYMU Aptamer Structure from Paper.png|frame|none|Figure.4 Aptamer Structure (Oguro et al., 2003)]]<br />
<br />
== Protein Reporter Design ==<br />
The basic principle of protein reporter device is the same as the RNA reporter. First, we fuse split RFP with anti-His tag antibody light chain and heavy chain. Second, we fuse His-tag sequence with our target protein sequence. Once our target protein sequence being tranlated the anti-His tag antibody will binding on the Histidine tag. And then with combining of the heavy chain and the light chain, The split ERFP reconstruct and make brightly fluorescence.<br />
[[image:NYMU_TAIPEI_His_tag_structure.png|frame|none|200px|Figure.5 The structure of anti-His tag antibody. Green stand for the heavy chain and the red stand for the light chain (PDB ID: 1KTR).]]<br />
<br />
<br />
=[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods| Material and Methods]]=<br />
We constructed two devices by using the parts below:<br />
*RNA reporter consists of : <br />
**EGFP<br />
**ERFP<br />
**eIF4A<br />
**fusion parts<br />
**aptamer<br />
*protein reporter consists of :<br />
**split RFP<br />
**split peptide adaptor<br />
==RNA reporter device==<br />
===[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP| GFP ]]===<br />
*Splitting the GFP({{:Team:NYMU-Taipei/BBa|E0040}}) at 157th and 158th amino acid which was generated by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715019}} and {{:Team:NYMU-Taipei/BBa|I715020}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715019}} , but the B-part is one base different from {{:Team:NYMU-Taipei/BBa|I715020}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP| RFP ]] ===<br />
*Splitting RFP ({{:Team:NYMU-Taipei/BBa|E1010}}) at 154th and 155th amino acid used by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715022}} and {{:Team:NYMU-Taipei/BBa|I715023}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715022}}, but the B-part has one base difference from {{:Team:NYMU-Taipei/BBa|I715023}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#eIF4A| eIF4A]] ===<br />
*We take the protein coding region from the [http://www.ncbi.nlm.nih.gov/nuccore/NM_144958 eIF4A mRNA transcript sequence from Mouse (from NCBI)] and found that it had 2 PstI cutting sites. For fear that our PstI cutting enzyme would cut the wrong place, we mutated the two PstI cutting sites.After mutation, we split eIF4A ({{:Team:NYMU-Taipei/BBa|K411100}}) at 215&216th amino acid.<br />
*The template of eIF4A on a [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/PGEX4T1.SEQ.html pGEX-4TI vector] was kindly provided by Pro.C.Proud.<br />
<br />
== Fusion parts ==<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP_fusion_part| GFP fusion system]] ===<br />
*We fused the split-GFP part with split-eIF4A part via PCR to get two sequences: split-GFP-A+linker+split-eIF4A-A([http://partsregistry.org/Part:BBa_K411101 BBa_K41111])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411102 BBa_K11102]) We then added terminators in the back of both sequences and inserted them into one plasmid.<br />
{| border=0 <br />
| rowspan=5 | [[Image:122.PNG|500px|EGFP-eIF4A system on plasmid pSB1C3.]] <br />
<br />
| <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The picture shows the templates of PCR potocol. The split-GFP part and split-eIF4A part both have complementary linker sequences, which will anneal during the PCR process. <br />
|}<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP__fusion_part| RFP fusion system]] ===<br />
<br />
*Similarly, we fused the split-RFP part with split-eIF4A part via PCR to get two sequences:split-RFP-A+linker+split-eIF4A-A ([http://partsregistry.org/Part:BBa_K411103 BBa_K411103])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411104 BBa_K411104])<br />
<br />
== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#Aptamer| aptamer]] ==<br />
*We performed PCR to get the required aptamer based on sequence showed in the paper (Valencia-Burton et al., 2007).<br />
We first designed primers by adding a prefix in the front of the aptamer sequence and a suffix at the end of the aptamer sequence. We digested the aptamer with Xbal&PstI cutting enzymes and the pLac with Spal&PstI cutting enzymes. We then used ligase to join them together.<br />
<br />
<br />
<br />
=<font color=blue>Advantages</font>=<br />
1.'''Tests the promotor strength in a speedy way.'''<br />
*Conventionally, inducible promoter strength is tested by a reporter gene (e.g. GFP) downstream from the promoter. To do know, one needs to wait for protein folding (four hours for GFP). In our design, we can test the promoter strength at the mRNA level and only needs 3 min for the split GFP to reconstitute into functional protein.<br />
*A strong promoter will result in more RNA aptamers. The more RNA aptamer, the more our split GFP will combine to emit a stronger fluorescence. With a weaker promoter, less RNA aptamers are created, and thus, less split GFP will combine to fluoresce. <br />
2.'''Locates specific genes or chemicals (such as heavy metals)'''<br />
*Similar to the promoter testing, we can use the inducible promoter whose inducers are heavy metals(e.g. As or Zn). When these heavy metals is present, the promoter will be induced and transcribed into mRNA aptamer. With our GFP reporter, it will bind to the RNA aptamer and emit fluorescence. With this we can know that the quantity of heavy metal pollution in that environment. <br />
3.'''Helps other teams test their biobricks.'''<br />
<br />
4.'''Shows mRNA positioning in a sigle cells.'''<br />
*By understanding the RNA localization in a cell, we can learm more about how gene regulation works in a cell. And by understanding more about the precise gene regulations, we can explore more about the design rules in synthetic biology.<br />
<br />
5.'''Measures the quantity of the mRNA.'''<br />
<br />
6.'''Can be used to view the temporal dynamics in a cell'''<br />
<br />
7.'''Speeds up the reporting progress.'''<br />
*With our reporting system, we can produce fluorescence in or RNA or protein assya in roughly 3 minutesWe can do a protein assay or mRNA assay in our speedy reporter system. It is faster than the conventional method RT-PCR for mRNA which needs about two hours and western blot for protein quantitative analysis which requires about 4.5 hours.<br />
*The split GFP is a constitutive protein in the cell. Once the RNA aptamer is transcribed, the split GFP linked with eIF4A will bind to the RNA aptamer due to its high affinity. We skip the translation process due to the already-generated GFP.<br />
<br />
=<font color=blue>References</font>=<br />
*Barnard, E., McFerran, N.V., Trudgett, A., Nelson, J., and Timson, D.J. (2008). Development and implementation of split-GFP-based bimolecular fluorescence complementation (BiFC) assays in yeast. ''Biochem Soc Trans'' 36, 479-482.<br />
<br />
*Demidov, V.V., and Broude, N.E. (2006). Profluorescent protein fragments for fast bimolecular fluorescence complementation in vitro. ''Nat Protoc'' 1, 714-719.<br />
<br />
*Huttelmaier, S., Zenklusen, D., Lederer, M., Dictenberg, J., Lorenz, M., Meng, X., Bassell, G.J., Condeelis, J., and Singer, R.H. (2005). Spatial regulation of beta-actin translation by Src-dependent phosphorylation of ZBP1. ''Nature'' 438, 512-515.<br />
<br />
*Imataka, H., and Sonenberg, N. (1997). Human eukaryotic translation initiation factor 4G (eIF4G) possesses two separate and independent binding sites for eIF4A. ''Mol Cell Biol'' 17, 6940-6947.<br />
<br />
*Johnstone, O., and Lasko, P. (2001). Translational regulation and RNA localization in Drosophila oocytes and embryos. ''Annu Rev Genet'' 35, 365-406.<br />
<br />
*Lin, A.C., and Holt, C.E. (2007). Local translation and directional steering in axons. ''EMBO J'' 26, 3729-3736.<br />
<br />
*Martin, K.C., and Ephrussi, A. (2009). mRNA localization: gene expression in the spatial dimension. ''Cell'' 136, 719-730.<br />
<br />
*Oguro, A., Ohtsu, T., Svitkin, Y.V., Sonenberg, N., and Nakamura, Y. (2003). RNA aptamers to initiation factor 4A helicase hinder cap-dependent translation by blocking ATP hydrolysis. ''RNA'' 9, 394-407.<br />
<br />
*Paquin, N., and Chartrand, P. (2008). Local regulation of mRNA translation: new insights from the bud. ''Trends Cell Biol'' 18, 105-111.<br />
<br />
*Remy, I., and Michnick, S.W. (2007). Application of protein-fragment complementation assays in cell biology. ''Biotechniques'' 42, 137, 139, 141 passim.<br />
<br />
*Story, R.M., Li, H., and Abelson, J.N. (2001). Crystal structure of a DEAD box protein from the hyperthermophile Methanococcus jannaschii. ''Proc Natl Acad Sci U S A'' 98, 1465-1470.<br />
<br />
*Valencia-Burton, M., McCullough, R.M., Cantor, C.R., and Broude, N.E. (2007). RNA visualization in live bacterial cells using fluorescent protein complementation. ''Nat Methods'' 4, 421-427.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporterTeam:NYMU-Taipei/Project/Speedy reporter2010-10-27T21:38:35Z<p>Blackrabbit: /* protein reporter device */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
<br />
=<font color=red>Overview design</font>=<br />
<html><embed src="https://static.igem.org/mediawiki/2010/6/62/NYMU_RNA_reporter.mov" width="640px" height="480px"></html><br />
<br />
=<font color=blue>Abstract</font>=<br />
* Our Speedy RNA+protein reporter effectively skips protein folding when reporting, thus reducing the time for a fluorescent response.<br />
More specific insights into molecular mechanisms and gene regulation are essential for improvement in synthetic biology. Understanding these mechanisms requires time. Our speedy reporter for reporting RNA and protein expression in a cell effectively skips protein folding when reporting -- the longest part of gene expression - thus reducing the time needed to get fluorescence. By speeding up the reporter, in both RNA and protein, we have also speed up the exploration for rules in the biological system. We can not only generate more novel circuits but also explore gene regulations in synthetic biology.<br />
<br />
=<font color=blue>Introduction</font> =<br />
Recent studies of mRNA localization show that a great part of mRNA localize in specific cytoplasm position (Martin and Ephrussi, 2009). For examples, ASH1 mRNA localize at bud tip of budding yeast to allow asymmetric segregation from mother to daughter cell (Paquin and Chartrand, 2008). In the ''Drosophila'' the localization of mRNA at anterior and posterior of oocyte play an important role in the developing embryo (Johnstone and Lasko, 2001). Local translation of mRNAs in axonal growth cones helps axon navigate to it synaptic partners (Lin and Holt, 2007). β-actins mRNA localize at sites of active actins polymerization, cytoskeletal-mediate motility need mRNA translation (Huttelmaier et al., 2005). All the examples above is studies on eukaryotic system. there are a few studies of mRNA location in prokaryotic system. And most of synthetic biology designs on prokaryotic bacteria. The more basic rule of prokaryotic system we know, the more successful and speedy experiments we will have.<br />
<br />
<br />
The common way to detect mRNA is RT-PCR, which can only be done in vitro but can’t in a real living cell. The common way to detect the protein is fusion a reporter protein such as GFP to report it, and the folding of GFP takes about four hours. In order to do both assay speedy and in vivo, we apply a novel technique Bimolecular Fluorescence Complementation, BiFC. In our design, we need not to wait four hours for folding of GFP to detect our protein fusion GFP. We can get our signal in few minute using this method. And it also can detect the mRNA both location and quantity (Demidov and Broude, 2006). We can use this method save about fours for protein assay and two hours for mRNA assay (Fig.1). <br />
<br />
{| border=0 <br />
| rowspan=10 | [[image:NYMU_Speedy_fig..png|frame|none|200px|Figure.1 compare to the traditional method of detecting mRNA and protein. our speedy reporter only need 3 min to obtain signal (Demidov and Broude, 2006).]]<br />
| BiFC is developed base on the technique Protein-fragment Complement Assay, PCA (Barnard et al., 2008; Demidov and Broude, 2006). Protein-protein interactions coupled to refolding of a pair of split enzymes in the PCA technique. The enzyme used in PCA has it activity only when two split parts reconstruct together. The activities of enzyme act as a detector of protein-protein interaction (Remy and Michnick, 2007). While the BiFC technique use split fluorescent protein instead of split enzyme in the PCA. The split form of fluorescent protein alone has no fluorescence. Fluorescence appears when two split parts reassembly together immediately in few minutes. For mRNA detection, we design a system differ from BiFC’s protein-protein interaction to RNA-protein interaction. Where a GFP is split into two inactive parts and fused with two parts of the split-eIF4A protein, a kind of RNA binding protein. On the other hand, we designed an mRNA aptamer that the eIF4A protein can bind to. EGFP will fluoresce through the interaction of split eIF4A and its corresponding aptamer. Using this method, we can immediately detect mRNA quantity and location in vivo. For protein detection, we design another system of BiFC which RFP is splits into two inactive parts and fused with two parts of antibody light chain and heavy chain. And then we fused the antigen to target protein. When target protein fusion antigen appears, the light chain and heavy chain combine with antigen. And then split RFPs reconstruct and fluoresce.<br />
|}<br />
<br />
=<font color=blue>Design</font>=<br />
<br />
<br />
<br />
== RNA reporter Design ==<br />
*Our circuit design:<br />
**EGFP-eIF4A system / RNA aptamer on plasmid pSB1C3.<br />
[[Image:RNA Binding 1 (1).png|500px|EGFP-eIF4A system on plasmid pSB1C3.]]<br />
[[Image:RNA Binding 2.png|400px|RNA aptamer on plasmid pSB1C3.]]<br />
==EGFP/ERFP + split eIF4A==<br />
*split GFP/RFP<br />
We split the EGFP/ERFP into two parts, the larger N-terminal part and the smaller C-terminal part. The N-terminal part contains performed chromophore and has a very weak fluorescence that is hard to detect. Only when it combines with the small C-terminal fragment, does the fluorescence become very bright. When both parts combine, we can detect the location of the mRNA and protein. The probability that these two split parts of EGFP/ERFP can fit together without an outside force is very low, thus ther are few false-positive signal (Demidov and Broude, 2006).<br />
*eIF4A<br />
eIF4A is an abbreviation for eukaryotic initiation factor 4A. It is a member of the DEAD-box RNA helicase protein family eIF4F (Oguro et al., 2003), and the DEAD-box is one of the largest subgroups of the RNA helicase protein family (Story et al., 2001). <br />
<br />
Eukaryotic translation initiation factor 4F (eIF4F) is a protein consists of eIF4A, eIF4E, and eIF4G. eIF4A is a helicase need ATP to unwind the secondary structure of mRNA untranslated region and make ribosome binds easier. eIF4E can binds to the cap structure of mRNA. eIF4G is like a scaffold of eIF4A and eIF4E helping them coordinate their functions. Without eIF4E and eIF4G the eIF4A alone exist much lower RNA helicase activity than complete eIF4F (Imataka and Sonenberg, 1997).<br />
<br />
==eIF4A binding aptamer==<br />
* What is the eIF4A binding aptamer? <br />
The eIF4A aptamer that we used has a high affinity for complete eIF4A protein. Its affinity is strong enough that it will combine the split eIF4A(described above) into a complete eIF4A protein. In the presence of eIF4A aptamer, ATP hydrolysis is inhibited and the RNA substrate which binds onto the eIF4A cannot unwind. <br />
<br />
It is proposed that the eIF4A structure is in a equilibrium between dumbbell-shaped structure and compact struction in solution. In the presence of ATP and absence of RNA aptamer, the equilibrium will be shifted into the dumbbell-shaped eIF4A (Fig.2). In the opposite condition, the equilibrium will be shifted into the compact one (Valencia-Burton et al., 2007).<br />
[[Image:NYMU_EIF4A.aptamer.png|frame|none|100px|Figure.2 Two domains and the structure equilibrium of eIF4A (Oguro et al., 2003)]]<br />
*eIF4A aptamer Secondary structure:<br />
** Structure predicted by RNAfold: [[Image:NYMU Aptamer Structure predicted by RNAfold.png|frame|none|Figure.3 Aptamer Structure predicted by RNAfold]]<br />
** Structure of eIF4A aptamer: [[Image:NYMU Aptamer Structure from Paper.png|frame|none|Figure.4 Aptamer Structure (Oguro et al., 2003)]]<br />
<br />
== Protein Reporter Design ==<br />
<br />
=[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods| Material and Methods]]=<br />
We constructed two devices by using the parts below:<br />
*RNA reporter consists of : <br />
**EGFP<br />
**ERFP<br />
**eIF4A<br />
**fusion parts<br />
**aptamer<br />
*protein reporter consists of :<br />
**split RFP<br />
**split peptide adaptor<br />
==RNA reporter device==<br />
===[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP| GFP ]]===<br />
*Splitting the GFP({{:Team:NYMU-Taipei/BBa|E0040}}) at 157th and 158th amino acid which was generated by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715019}} and {{:Team:NYMU-Taipei/BBa|I715020}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715019}} , but the B-part is one base different from {{:Team:NYMU-Taipei/BBa|I715020}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP| RFP ]] ===<br />
*Splitting RFP ({{:Team:NYMU-Taipei/BBa|E1010}}) at 154th and 155th amino acid used by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715022}} and {{:Team:NYMU-Taipei/BBa|I715023}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715022}}, but the B-part has one base difference from {{:Team:NYMU-Taipei/BBa|I715023}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#eIF4A| eIF4A]] ===<br />
*We take the protein coding region from the [http://www.ncbi.nlm.nih.gov/nuccore/NM_144958 eIF4A mRNA transcript sequence from Mouse (from NCBI)] and found that it had 2 PstI cutting sites. For fear that our PstI cutting enzyme would cut the wrong place, we mutated the two PstI cutting sites.After mutation, we split eIF4A ({{:Team:NYMU-Taipei/BBa|K411100}}) at 215&216th amino acid.<br />
*The template of eIF4A on a [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/PGEX4T1.SEQ.html pGEX-4TI vector] was kindly provided by Pro.C.Proud.<br />
<br />
== Fusion parts ==<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP_fusion_part| GFP fusion system]] ===<br />
*We fused the split-GFP part with split-eIF4A part via PCR to get two sequences: split-GFP-A+linker+split-eIF4A-A([http://partsregistry.org/Part:BBa_K411101 BBa_K41111])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411102 BBa_K11102]) We then added terminators in the back of both sequences and inserted them into one plasmid.<br />
{| border=0 <br />
| rowspan=5 | [[Image:122.PNG|500px|EGFP-eIF4A system on plasmid pSB1C3.]] <br />
<br />
| <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The picture shows the templates of PCR potocol. The split-GFP part and split-eIF4A part both have complementary linker sequences, which will anneal during the PCR process. <br />
|}<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP__fusion_part| RFP fusion system]] ===<br />
<br />
*Similarly, we fused the split-RFP part with split-eIF4A part via PCR to get two sequences:split-RFP-A+linker+split-eIF4A-A ([http://partsregistry.org/Part:BBa_K411103 BBa_K411103])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411104 BBa_K411104])<br />
<br />
== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#Aptamer| aptamer]] ==<br />
*We performed PCR to get the required aptamer based on sequence showed in the paper (Valencia-Burton et al., 2007).<br />
We first designed primers by adding a prefix in the front of the aptamer sequence and a suffix at the end of the aptamer sequence. We digested the aptamer with Xbal&PstI cutting enzymes and the pLac with Spal&PstI cutting enzymes. We then used ligase to join them together.<br />
<br />
<br />
<br />
=<font color=blue>Advantages</font>=<br />
1.'''Tests the promotor strength in a speedy way.'''<br />
*Conventionally, inducible promoter strength is tested by a reporter gene (e.g. GFP) downstream from the promoter. To do know, one needs to wait for protein folding (four hours for GFP). In our design, we can test the promoter strength at the mRNA level and only needs 3 min for the split GFP to reconstitute into functional protein.<br />
*A strong promoter will result in more RNA aptamers. The more RNA aptamer, the more our split GFP will combine to emit a stronger fluorescence. With a weaker promoter, less RNA aptamers are created, and thus, less split GFP will combine to fluoresce. <br />
2.'''Locates specific genes or chemicals (such as heavy metals)'''<br />
*Similar to the promoter testing, we can use the inducible promoter whose inducers are heavy metals(e.g. As or Zn). When these heavy metals is present, the promoter will be induced and transcribed into mRNA aptamer. With our GFP reporter, it will bind to the RNA aptamer and emit fluorescence. With this we can know that the quantity of heavy metal pollution in that environment. <br />
3.'''Helps other teams test their biobricks.'''<br />
<br />
4.'''Shows mRNA positioning in a sigle cells.'''<br />
*By understanding the RNA localization in a cell, we can learm more about how gene regulation works in a cell. And by understanding more about the precise gene regulations, we can explore more about the design rules in synthetic biology.<br />
<br />
5.'''Measures the quantity of the mRNA.'''<br />
<br />
6.'''Can be used to view the temporal dynamics in a cell'''<br />
<br />
7.'''Speeds up the reporting progress.'''<br />
*With our reporting system, we can produce fluorescence in or RNA or protein assya in roughly 3 minutesWe can do a protein assay or mRNA assay in our speedy reporter system. It is faster than the conventional method RT-PCR for mRNA which needs about two hours and western blot for protein quantitative analysis which requires about 4.5 hours.<br />
*The split GFP is a constitutive protein in the cell. Once the RNA aptamer is transcribed, the split GFP linked with eIF4A will bind to the RNA aptamer due to its high affinity. We skip the translation process due to the already-generated GFP.<br />
<br />
=<font color=blue>References</font>=<br />
*Barnard, E., McFerran, N.V., Trudgett, A., Nelson, J., and Timson, D.J. (2008). Development and implementation of split-GFP-based bimolecular fluorescence complementation (BiFC) assays in yeast. ''Biochem Soc Trans'' 36, 479-482.<br />
<br />
*Demidov, V.V., and Broude, N.E. (2006). Profluorescent protein fragments for fast bimolecular fluorescence complementation in vitro. ''Nat Protoc'' 1, 714-719.<br />
<br />
*Huttelmaier, S., Zenklusen, D., Lederer, M., Dictenberg, J., Lorenz, M., Meng, X., Bassell, G.J., Condeelis, J., and Singer, R.H. (2005). Spatial regulation of beta-actin translation by Src-dependent phosphorylation of ZBP1. ''Nature'' 438, 512-515.<br />
<br />
*Imataka, H., and Sonenberg, N. (1997). Human eukaryotic translation initiation factor 4G (eIF4G) possesses two separate and independent binding sites for eIF4A. ''Mol Cell Biol'' 17, 6940-6947.<br />
<br />
*Johnstone, O., and Lasko, P. (2001). Translational regulation and RNA localization in Drosophila oocytes and embryos. ''Annu Rev Genet'' 35, 365-406.<br />
<br />
*Lin, A.C., and Holt, C.E. (2007). Local translation and directional steering in axons. ''EMBO J'' 26, 3729-3736.<br />
<br />
*Martin, K.C., and Ephrussi, A. (2009). mRNA localization: gene expression in the spatial dimension. ''Cell'' 136, 719-730.<br />
<br />
*Oguro, A., Ohtsu, T., Svitkin, Y.V., Sonenberg, N., and Nakamura, Y. (2003). RNA aptamers to initiation factor 4A helicase hinder cap-dependent translation by blocking ATP hydrolysis. ''RNA'' 9, 394-407.<br />
<br />
*Paquin, N., and Chartrand, P. (2008). Local regulation of mRNA translation: new insights from the bud. ''Trends Cell Biol'' 18, 105-111.<br />
<br />
*Remy, I., and Michnick, S.W. (2007). Application of protein-fragment complementation assays in cell biology. ''Biotechniques'' 42, 137, 139, 141 passim.<br />
<br />
*Story, R.M., Li, H., and Abelson, J.N. (2001). Crystal structure of a DEAD box protein from the hyperthermophile Methanococcus jannaschii. ''Proc Natl Acad Sci U S A'' 98, 1465-1470.<br />
<br />
*Valencia-Burton, M., McCullough, R.M., Cantor, C.R., and Broude, N.E. (2007). RNA visualization in live bacterial cells using fluorescent protein complementation. ''Nat Methods'' 4, 421-427.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporterTeam:NYMU-Taipei/Project/Speedy reporter2010-10-27T21:37:52Z<p>Blackrabbit: /* Design */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
<br />
=<font color=red>Overview design</font>=<br />
<html><embed src="https://static.igem.org/mediawiki/2010/6/62/NYMU_RNA_reporter.mov" width="640px" height="480px"></html><br />
<br />
=<font color=blue>Abstract</font>=<br />
* Our Speedy RNA+protein reporter effectively skips protein folding when reporting, thus reducing the time for a fluorescent response.<br />
More specific insights into molecular mechanisms and gene regulation are essential for improvement in synthetic biology. Understanding these mechanisms requires time. Our speedy reporter for reporting RNA and protein expression in a cell effectively skips protein folding when reporting -- the longest part of gene expression - thus reducing the time needed to get fluorescence. By speeding up the reporter, in both RNA and protein, we have also speed up the exploration for rules in the biological system. We can not only generate more novel circuits but also explore gene regulations in synthetic biology.<br />
<br />
=<font color=blue>Introduction</font> =<br />
Recent studies of mRNA localization show that a great part of mRNA localize in specific cytoplasm position (Martin and Ephrussi, 2009). For examples, ASH1 mRNA localize at bud tip of budding yeast to allow asymmetric segregation from mother to daughter cell (Paquin and Chartrand, 2008). In the ''Drosophila'' the localization of mRNA at anterior and posterior of oocyte play an important role in the developing embryo (Johnstone and Lasko, 2001). Local translation of mRNAs in axonal growth cones helps axon navigate to it synaptic partners (Lin and Holt, 2007). β-actins mRNA localize at sites of active actins polymerization, cytoskeletal-mediate motility need mRNA translation (Huttelmaier et al., 2005). All the examples above is studies on eukaryotic system. there are a few studies of mRNA location in prokaryotic system. And most of synthetic biology designs on prokaryotic bacteria. The more basic rule of prokaryotic system we know, the more successful and speedy experiments we will have.<br />
<br />
<br />
The common way to detect mRNA is RT-PCR, which can only be done in vitro but can’t in a real living cell. The common way to detect the protein is fusion a reporter protein such as GFP to report it, and the folding of GFP takes about four hours. In order to do both assay speedy and in vivo, we apply a novel technique Bimolecular Fluorescence Complementation, BiFC. In our design, we need not to wait four hours for folding of GFP to detect our protein fusion GFP. We can get our signal in few minute using this method. And it also can detect the mRNA both location and quantity (Demidov and Broude, 2006). We can use this method save about fours for protein assay and two hours for mRNA assay (Fig.1). <br />
<br />
{| border=0 <br />
| rowspan=10 | [[image:NYMU_Speedy_fig..png|frame|none|200px|Figure.1 compare to the traditional method of detecting mRNA and protein. our speedy reporter only need 3 min to obtain signal (Demidov and Broude, 2006).]]<br />
| BiFC is developed base on the technique Protein-fragment Complement Assay, PCA (Barnard et al., 2008; Demidov and Broude, 2006). Protein-protein interactions coupled to refolding of a pair of split enzymes in the PCA technique. The enzyme used in PCA has it activity only when two split parts reconstruct together. The activities of enzyme act as a detector of protein-protein interaction (Remy and Michnick, 2007). While the BiFC technique use split fluorescent protein instead of split enzyme in the PCA. The split form of fluorescent protein alone has no fluorescence. Fluorescence appears when two split parts reassembly together immediately in few minutes. For mRNA detection, we design a system differ from BiFC’s protein-protein interaction to RNA-protein interaction. Where a GFP is split into two inactive parts and fused with two parts of the split-eIF4A protein, a kind of RNA binding protein. On the other hand, we designed an mRNA aptamer that the eIF4A protein can bind to. EGFP will fluoresce through the interaction of split eIF4A and its corresponding aptamer. Using this method, we can immediately detect mRNA quantity and location in vivo. For protein detection, we design another system of BiFC which RFP is splits into two inactive parts and fused with two parts of antibody light chain and heavy chain. And then we fused the antigen to target protein. When target protein fusion antigen appears, the light chain and heavy chain combine with antigen. And then split RFPs reconstruct and fluoresce.<br />
|}<br />
<br />
=<font color=blue>Design</font>=<br />
<br />
<br />
<br />
== RNA reporter Design ==<br />
*Our circuit design:<br />
**EGFP-eIF4A system / RNA aptamer on plasmid pSB1C3.<br />
[[Image:RNA Binding 1 (1).png|500px|EGFP-eIF4A system on plasmid pSB1C3.]]<br />
[[Image:RNA Binding 2.png|400px|RNA aptamer on plasmid pSB1C3.]]<br />
==EGFP/ERFP + split eIF4A==<br />
*split GFP/RFP<br />
We split the EGFP/ERFP into two parts, the larger N-terminal part and the smaller C-terminal part. The N-terminal part contains performed chromophore and has a very weak fluorescence that is hard to detect. Only when it combines with the small C-terminal fragment, does the fluorescence become very bright. When both parts combine, we can detect the location of the mRNA and protein. The probability that these two split parts of EGFP/ERFP can fit together without an outside force is very low, thus ther are few false-positive signal (Demidov and Broude, 2006).<br />
*eIF4A<br />
eIF4A is an abbreviation for eukaryotic initiation factor 4A. It is a member of the DEAD-box RNA helicase protein family eIF4F (Oguro et al., 2003), and the DEAD-box is one of the largest subgroups of the RNA helicase protein family (Story et al., 2001). <br />
<br />
Eukaryotic translation initiation factor 4F (eIF4F) is a protein consists of eIF4A, eIF4E, and eIF4G. eIF4A is a helicase need ATP to unwind the secondary structure of mRNA untranslated region and make ribosome binds easier. eIF4E can binds to the cap structure of mRNA. eIF4G is like a scaffold of eIF4A and eIF4E helping them coordinate their functions. Without eIF4E and eIF4G the eIF4A alone exist much lower RNA helicase activity than complete eIF4F (Imataka and Sonenberg, 1997).<br />
<br />
==eIF4A binding aptamer==<br />
* What is the eIF4A binding aptamer? <br />
The eIF4A aptamer that we used has a high affinity for complete eIF4A protein. Its affinity is strong enough that it will combine the split eIF4A(described above) into a complete eIF4A protein. In the presence of eIF4A aptamer, ATP hydrolysis is inhibited and the RNA substrate which binds onto the eIF4A cannot unwind. <br />
<br />
It is proposed that the eIF4A structure is in a equilibrium between dumbbell-shaped structure and compact struction in solution. In the presence of ATP and absence of RNA aptamer, the equilibrium will be shifted into the dumbbell-shaped eIF4A (Fig.2). In the opposite condition, the equilibrium will be shifted into the compact one (Valencia-Burton et al., 2007).<br />
[[Image:NYMU_EIF4A.aptamer.png|frame|none|100px|Figure.2 Two domains and the structure equilibrium of eIF4A (Oguro et al., 2003)]]<br />
*eIF4A aptamer Secondary structure:<br />
** Structure predicted by RNAfold: [[Image:NYMU Aptamer Structure predicted by RNAfold.png|frame|none|Figure.3 Aptamer Structure predicted by RNAfold]]<br />
** Structure of eIF4A aptamer: [[Image:NYMU Aptamer Structure from Paper.png|frame|none|Figure.4 Aptamer Structure (Oguro et al., 2003)]]<br />
<br />
== Protein Reporter Design ==<br />
<br />
=[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods| Material and Methods]]=<br />
We constructed two devices by using the parts below:<br />
*RNA reporter consists of : <br />
**EGFP<br />
**ERFP<br />
**eIF4A<br />
**fusion parts<br />
**aptamer<br />
*protein reporter consists of :<br />
**split RFP<br />
**split peptide adaptor<br />
==RNA reporter device==<br />
===[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP| GFP ]]===<br />
*Splitting the GFP({{:Team:NYMU-Taipei/BBa|E0040}}) at 157th and 158th amino acid which was generated by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715019}} and {{:Team:NYMU-Taipei/BBa|I715020}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715019}} , but the B-part is one base different from {{:Team:NYMU-Taipei/BBa|I715020}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP| RFP ]] ===<br />
*Splitting RFP ({{:Team:NYMU-Taipei/BBa|E1010}}) at 154th and 155th amino acid used by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715022}} and {{:Team:NYMU-Taipei/BBa|I715023}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715022}}, but the B-part has one base difference from {{:Team:NYMU-Taipei/BBa|I715023}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#eIF4A| eIF4A]] ===<br />
*We take the protein coding region from the [http://www.ncbi.nlm.nih.gov/nuccore/NM_144958 eIF4A mRNA transcript sequence from Mouse (from NCBI)] and found that it had 2 PstI cutting sites. For fear that our PstI cutting enzyme would cut the wrong place, we mutated the two PstI cutting sites.After mutation, we split eIF4A ({{:Team:NYMU-Taipei/BBa|K411100}}) at 215&216th amino acid.<br />
*The template of eIF4A on a [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/PGEX4T1.SEQ.html pGEX-4TI vector] was kindly provided by Pro.C.Proud.<br />
<br />
== Fusion parts ==<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP_fusion_part| GFP fusion system]] ===<br />
*We fused the split-GFP part with split-eIF4A part via PCR to get two sequences: split-GFP-A+linker+split-eIF4A-A([http://partsregistry.org/Part:BBa_K411101 BBa_K41111])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411102 BBa_K11102]) We then added terminators in the back of both sequences and inserted them into one plasmid.<br />
{| border=0 <br />
| rowspan=5 | [[Image:122.PNG|500px|EGFP-eIF4A system on plasmid pSB1C3.]] <br />
<br />
| <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The picture shows the templates of PCR potocol. The split-GFP part and split-eIF4A part both have complementary linker sequences, which will anneal during the PCR process. <br />
|}<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP__fusion_part| RFP fusion system]] ===<br />
<br />
*Similarly, we fused the split-RFP part with split-eIF4A part via PCR to get two sequences:split-RFP-A+linker+split-eIF4A-A ([http://partsregistry.org/Part:BBa_K411103 BBa_K411103])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411104 BBa_K411104])<br />
<br />
== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#Aptamer| aptamer]] ==<br />
*We performed PCR to get the required aptamer based on sequence showed in the paper (Valencia-Burton et al., 2007).<br />
We first designed primers by adding a prefix in the front of the aptamer sequence and a suffix at the end of the aptamer sequence. We digested the aptamer with Xbal&PstI cutting enzymes and the pLac with Spal&PstI cutting enzymes. We then used ligase to join them together.<br />
<br />
==protein reporter device==<br />
The basic principle of protein reporter device is the same as the RNA reporter. First, we fuse split RFP with anti-His tag antibody light chain and heavy chain. Second, we fuse His-tag sequence with our target protein sequence. Once our target protein sequence being tranlated the anti-His tag antibody will binding on the Histidine tag. And then with combining of the heavy chain and the light chain, The split ERFP reconstruct and make brightly fluorescence.<br />
[[image:NYMU_TAIPEI_His_tag_structure.png|frame|none|200px|Figure.5 The structure of anti-His tag antibody. Green stand for the heavy chain and the red stand for the light chain (PDB ID: 1KTR).]]<br />
<br />
=<font color=blue>Advantages</font>=<br />
1.'''Tests the promotor strength in a speedy way.'''<br />
*Conventionally, inducible promoter strength is tested by a reporter gene (e.g. GFP) downstream from the promoter. To do know, one needs to wait for protein folding (four hours for GFP). In our design, we can test the promoter strength at the mRNA level and only needs 3 min for the split GFP to reconstitute into functional protein.<br />
*A strong promoter will result in more RNA aptamers. The more RNA aptamer, the more our split GFP will combine to emit a stronger fluorescence. With a weaker promoter, less RNA aptamers are created, and thus, less split GFP will combine to fluoresce. <br />
2.'''Locates specific genes or chemicals (such as heavy metals)'''<br />
*Similar to the promoter testing, we can use the inducible promoter whose inducers are heavy metals(e.g. As or Zn). When these heavy metals is present, the promoter will be induced and transcribed into mRNA aptamer. With our GFP reporter, it will bind to the RNA aptamer and emit fluorescence. With this we can know that the quantity of heavy metal pollution in that environment. <br />
3.'''Helps other teams test their biobricks.'''<br />
<br />
4.'''Shows mRNA positioning in a sigle cells.'''<br />
*By understanding the RNA localization in a cell, we can learm more about how gene regulation works in a cell. And by understanding more about the precise gene regulations, we can explore more about the design rules in synthetic biology.<br />
<br />
5.'''Measures the quantity of the mRNA.'''<br />
<br />
6.'''Can be used to view the temporal dynamics in a cell'''<br />
<br />
7.'''Speeds up the reporting progress.'''<br />
*With our reporting system, we can produce fluorescence in or RNA or protein assya in roughly 3 minutesWe can do a protein assay or mRNA assay in our speedy reporter system. It is faster than the conventional method RT-PCR for mRNA which needs about two hours and western blot for protein quantitative analysis which requires about 4.5 hours.<br />
*The split GFP is a constitutive protein in the cell. Once the RNA aptamer is transcribed, the split GFP linked with eIF4A will bind to the RNA aptamer due to its high affinity. We skip the translation process due to the already-generated GFP.<br />
<br />
=<font color=blue>References</font>=<br />
*Barnard, E., McFerran, N.V., Trudgett, A., Nelson, J., and Timson, D.J. (2008). Development and implementation of split-GFP-based bimolecular fluorescence complementation (BiFC) assays in yeast. ''Biochem Soc Trans'' 36, 479-482.<br />
<br />
*Demidov, V.V., and Broude, N.E. (2006). Profluorescent protein fragments for fast bimolecular fluorescence complementation in vitro. ''Nat Protoc'' 1, 714-719.<br />
<br />
*Huttelmaier, S., Zenklusen, D., Lederer, M., Dictenberg, J., Lorenz, M., Meng, X., Bassell, G.J., Condeelis, J., and Singer, R.H. (2005). Spatial regulation of beta-actin translation by Src-dependent phosphorylation of ZBP1. ''Nature'' 438, 512-515.<br />
<br />
*Imataka, H., and Sonenberg, N. (1997). Human eukaryotic translation initiation factor 4G (eIF4G) possesses two separate and independent binding sites for eIF4A. ''Mol Cell Biol'' 17, 6940-6947.<br />
<br />
*Johnstone, O., and Lasko, P. (2001). Translational regulation and RNA localization in Drosophila oocytes and embryos. ''Annu Rev Genet'' 35, 365-406.<br />
<br />
*Lin, A.C., and Holt, C.E. (2007). Local translation and directional steering in axons. ''EMBO J'' 26, 3729-3736.<br />
<br />
*Martin, K.C., and Ephrussi, A. (2009). mRNA localization: gene expression in the spatial dimension. ''Cell'' 136, 719-730.<br />
<br />
*Oguro, A., Ohtsu, T., Svitkin, Y.V., Sonenberg, N., and Nakamura, Y. (2003). RNA aptamers to initiation factor 4A helicase hinder cap-dependent translation by blocking ATP hydrolysis. ''RNA'' 9, 394-407.<br />
<br />
*Paquin, N., and Chartrand, P. (2008). Local regulation of mRNA translation: new insights from the bud. ''Trends Cell Biol'' 18, 105-111.<br />
<br />
*Remy, I., and Michnick, S.W. (2007). Application of protein-fragment complementation assays in cell biology. ''Biotechniques'' 42, 137, 139, 141 passim.<br />
<br />
*Story, R.M., Li, H., and Abelson, J.N. (2001). Crystal structure of a DEAD box protein from the hyperthermophile Methanococcus jannaschii. ''Proc Natl Acad Sci U S A'' 98, 1465-1470.<br />
<br />
*Valencia-Burton, M., McCullough, R.M., Cantor, C.R., and Broude, N.E. (2007). RNA visualization in live bacterial cells using fluorescent protein complementation. ''Nat Methods'' 4, 421-427.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporterTeam:NYMU-Taipei/Project/Speedy reporter2010-10-27T21:30:53Z<p>Blackrabbit: /* Abstract */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
<br />
=<font color=red>Overview design</font>=<br />
<html><embed src="https://static.igem.org/mediawiki/2010/6/62/NYMU_RNA_reporter.mov" width="640px" height="480px"></html><br />
<br />
=<font color=blue>Abstract</font>=<br />
* Our Speedy RNA+protein reporter effectively skips protein folding when reporting, thus reducing the time for a fluorescent response.<br />
More specific insights into molecular mechanisms and gene regulation are essential for improvement in synthetic biology. Understanding these mechanisms requires time. Our speedy reporter for reporting RNA and protein expression in a cell effectively skips protein folding when reporting -- the longest part of gene expression - thus reducing the time needed to get fluorescence. By speeding up the reporter, in both RNA and protein, we have also speed up the exploration for rules in the biological system. We can not only generate more novel circuits but also explore gene regulations in synthetic biology.<br />
<br />
=<font color=blue>Introduction</font> =<br />
Recent studies of mRNA localization show that a great part of mRNA localize in specific cytoplasm position (Martin and Ephrussi, 2009). For examples, ASH1 mRNA localize at bud tip of budding yeast to allow asymmetric segregation from mother to daughter cell (Paquin and Chartrand, 2008). In the ''Drosophila'' the localization of mRNA at anterior and posterior of oocyte play an important role in the developing embryo (Johnstone and Lasko, 2001). Local translation of mRNAs in axonal growth cones helps axon navigate to it synaptic partners (Lin and Holt, 2007). β-actins mRNA localize at sites of active actins polymerization, cytoskeletal-mediate motility need mRNA translation (Huttelmaier et al., 2005). All the examples above is studies on eukaryotic system. there are a few studies of mRNA location in prokaryotic system. And most of synthetic biology designs on prokaryotic bacteria. The more basic rule of prokaryotic system we know, the more successful and speedy experiments we will have.<br />
<br />
<br />
The common way to detect mRNA is RT-PCR, which can only be done in vitro but can’t in a real living cell. The common way to detect the protein is fusion a reporter protein such as GFP to report it, and the folding of GFP takes about four hours. In order to do both assay speedy and in vivo, we apply a novel technique Bimolecular Fluorescence Complementation, BiFC. In our design, we need not to wait four hours for folding of GFP to detect our protein fusion GFP. We can get our signal in few minute using this method. And it also can detect the mRNA both location and quantity (Demidov and Broude, 2006). We can use this method save about fours for protein assay and two hours for mRNA assay (Fig.1). <br />
<br />
{| border=0 <br />
| rowspan=10 | [[image:NYMU_Speedy_fig..png|frame|none|200px|Figure.1 compare to the traditional method of detecting mRNA and protein. our speedy reporter only need 3 min to obtain signal (Demidov and Broude, 2006).]]<br />
| BiFC is developed base on the technique Protein-fragment Complement Assay, PCA (Barnard et al., 2008; Demidov and Broude, 2006). Protein-protein interactions coupled to refolding of a pair of split enzymes in the PCA technique. The enzyme used in PCA has it activity only when two split parts reconstruct together. The activities of enzyme act as a detector of protein-protein interaction (Remy and Michnick, 2007). While the BiFC technique use split fluorescent protein instead of split enzyme in the PCA. The split form of fluorescent protein alone has no fluorescence. Fluorescence appears when two split parts reassembly together immediately in few minutes. For mRNA detection, we design a system differ from BiFC’s protein-protein interaction to RNA-protein interaction. Where a GFP is split into two inactive parts and fused with two parts of the split-eIF4A protein, a kind of RNA binding protein. On the other hand, we designed an mRNA aptamer that the eIF4A protein can bind to. EGFP will fluoresce through the interaction of split eIF4A and its corresponding aptamer. Using this method, we can immediately detect mRNA quantity and location in vivo. For protein detection, we design another system of BiFC which RFP is splits into two inactive parts and fused with two parts of antibody light chain and heavy chain. And then we fused the antigen to target protein. When target protein fusion antigen appears, the light chain and heavy chain combine with antigen. And then split RFPs reconstruct and fluoresce.<br />
|}<br />
<br />
=<font color=blue>Design</font>=<br />
*Our circuit design:<br />
**EGFP-eIF4A system / RNA aptamer on plasmid pSB1C3.<br />
[[Image:RNA Binding 1 (1).png|500px|EGFP-eIF4A system on plasmid pSB1C3.]]<br />
[[Image:RNA Binding 2.png|400px|RNA aptamer on plasmid pSB1C3.]]<br />
==EGFP/ERFP + split eIF4A==<br />
*split GFP/RFP<br />
We split the EGFP/ERFP into two parts, the larger N-terminal part and the smaller C-terminal part. The N-terminal part contains performed chromophore and has a very weak fluorescence that is hard to detect. Only when it combines with the small C-terminal fragment, does the fluorescence become very bright. When both parts combine, we can detect the location of the mRNA and protein. The probability that these two split parts of EGFP/ERFP can fit together without an outside force is very low, thus ther are few false-positive signal (Demidov and Broude, 2006).<br />
*eIF4A<br />
eIF4A is an abbreviation for eukaryotic initiation factor 4A. It is a member of the DEAD-box RNA helicase protein family eIF4F (Oguro et al., 2003), and the DEAD-box is one of the largest subgroups of the RNA helicase protein family (Story et al., 2001). <br />
<br />
Eukaryotic translation initiation factor 4F (eIF4F) is a protein consists of eIF4A, eIF4E, and eIF4G. eIF4A is a helicase need ATP to unwind the secondary structure of mRNA untranslated region and make ribosome binds easier. eIF4E can binds to the cap structure of mRNA. eIF4G is like a scaffold of eIF4A and eIF4E helping them coordinate their functions. Without eIF4E and eIF4G the eIF4A alone exist much lower RNA helicase activity than complete eIF4F (Imataka and Sonenberg, 1997).<br />
<br />
==eIF4A aptamer==<br />
* What is eIF4A aptamer? <br />
The eIF4A aptamer that we used has a high affinity for complete eIF4A protein. Its affinity is strong enough that it will combine the split eIF4A(described above) into a complete eIF4A protein. In the presence of eIF4A aptamer, ATP hydrolysis is inhibited and the RNA substrate which binds onto the eIF4A cannot unwind. <br />
<br />
It is proposed that the eIF4A structure is in a equilibrium between dumbbell-shaped structure and compact struction in solution. In the presence of ATP and absence of RNA aptamer, the equilibrium will be shifted into the dumbbell-shaped eIF4A (Fig.2). In the opposite condition, the equilibrium will be shifted into the compact one (Valencia-Burton et al., 2007).<br />
[[Image:NYMU_EIF4A.aptamer.png|frame|none|100px|Figure.2 Two domains and the structure equilibrium of eIF4A (Oguro et al., 2003)]]<br />
*eIF4A aptamer Secondary structure:<br />
** Structure predicted by RNAfold: [[Image:NYMU Aptamer Structure predicted by RNAfold.png|frame|none|Figure.3 Aptamer Structure predicted by RNAfold]]<br />
** Structure of eIF4A aptamer: [[Image:NYMU Aptamer Structure from Paper.png|frame|none|Figure.4 Aptamer Structure (Oguro et al., 2003)]]<br />
<br />
=[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods| Material and Methods]]=<br />
We constructed two devices by using the parts below:<br />
*RNA reporter consists of : <br />
**EGFP<br />
**ERFP<br />
**eIF4A<br />
**fusion parts<br />
**aptamer<br />
*protein reporter consists of :<br />
**split RFP<br />
**split peptide adaptor<br />
==RNA reporter device==<br />
===[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP| GFP ]]===<br />
*Splitting the GFP({{:Team:NYMU-Taipei/BBa|E0040}}) at 157th and 158th amino acid which was generated by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715019}} and {{:Team:NYMU-Taipei/BBa|I715020}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715019}} , but the B-part is one base different from {{:Team:NYMU-Taipei/BBa|I715020}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP| RFP ]] ===<br />
*Splitting RFP ({{:Team:NYMU-Taipei/BBa|E1010}}) at 154th and 155th amino acid used by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715022}} and {{:Team:NYMU-Taipei/BBa|I715023}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715022}}, but the B-part has one base difference from {{:Team:NYMU-Taipei/BBa|I715023}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#eIF4A| eIF4A]] ===<br />
*We take the protein coding region from the [http://www.ncbi.nlm.nih.gov/nuccore/NM_144958 eIF4A mRNA transcript sequence from Mouse (from NCBI)] and found that it had 2 PstI cutting sites. For fear that our PstI cutting enzyme would cut the wrong place, we mutated the two PstI cutting sites.After mutation, we split eIF4A ({{:Team:NYMU-Taipei/BBa|K411100}}) at 215&216th amino acid.<br />
*The template of eIF4A on a [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/PGEX4T1.SEQ.html pGEX-4TI vector] was kindly provided by Pro.C.Proud.<br />
<br />
== Fusion parts ==<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP_fusion_part| GFP fusion system]] ===<br />
*We fused the split-GFP part with split-eIF4A part via PCR to get two sequences: split-GFP-A+linker+split-eIF4A-A([http://partsregistry.org/Part:BBa_K411101 BBa_K41111])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411102 BBa_K11102]) We then added terminators in the back of both sequences and inserted them into one plasmid.<br />
{| border=0 <br />
| rowspan=5 | [[Image:122.PNG|500px|EGFP-eIF4A system on plasmid pSB1C3.]] <br />
<br />
| <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The picture shows the templates of PCR potocol. The split-GFP part and split-eIF4A part both have complementary linker sequences, which will anneal during the PCR process. <br />
|}<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP__fusion_part| RFP fusion system]] ===<br />
<br />
*Similarly, we fused the split-RFP part with split-eIF4A part via PCR to get two sequences:split-RFP-A+linker+split-eIF4A-A ([http://partsregistry.org/Part:BBa_K411103 BBa_K411103])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411104 BBa_K411104])<br />
<br />
== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#Aptamer| aptamer]] ==<br />
*We performed PCR to get the required aptamer based on sequence showed in the paper (Valencia-Burton et al., 2007).<br />
We first designed primers by adding a prefix in the front of the aptamer sequence and a suffix at the end of the aptamer sequence. We digested the aptamer with Xbal&PstI cutting enzymes and the pLac with Spal&PstI cutting enzymes. We then used ligase to join them together.<br />
<br />
==protein reporter device==<br />
The basic principle of protein reporter device is the same as the RNA reporter. First, we fuse split RFP with anti-His tag antibody light chain and heavy chain. Second, we fuse His-tag sequence with our target protein sequence. Once our target protein sequence being tranlated the anti-His tag antibody will binding on the Histidine tag. And then with combining of the heavy chain and the light chain, The split ERFP reconstruct and make brightly fluorescence.<br />
[[image:NYMU_TAIPEI_His_tag_structure.png|frame|none|200px|Figure.5 The structure of anti-His tag antibody. Green stand for the heavy chain and the red stand for the light chain (PDB ID: 1KTR).]]<br />
<br />
=<font color=blue>Advantages</font>=<br />
1.'''Tests the promotor strength in a speedy way.'''<br />
*Conventionally, inducible promoter strength is tested by a reporter gene (e.g. GFP) downstream from the promoter. To do know, one needs to wait for protein folding (four hours for GFP). In our design, we can test the promoter strength at the mRNA level and only needs 3 min for the split GFP to reconstitute into functional protein.<br />
*A strong promoter will result in more RNA aptamers. The more RNA aptamer, the more our split GFP will combine to emit a stronger fluorescence. With a weaker promoter, less RNA aptamers are created, and thus, less split GFP will combine to fluoresce. <br />
2.'''Locates specific genes or chemicals (such as heavy metals)'''<br />
*Similar to the promoter testing, we can use the inducible promoter whose inducers are heavy metals(e.g. As or Zn). When these heavy metals is present, the promoter will be induced and transcribed into mRNA aptamer. With our GFP reporter, it will bind to the RNA aptamer and emit fluorescence. With this we can know that the quantity of heavy metal pollution in that environment. <br />
3.'''Helps other teams test their biobricks.'''<br />
<br />
4.'''Shows mRNA positioning in a sigle cells.'''<br />
*By understanding the RNA localization in a cell, we can learm more about how gene regulation works in a cell. And by understanding more about the precise gene regulations, we can explore more about the design rules in synthetic biology.<br />
<br />
5.'''Measures the quantity of the mRNA.'''<br />
<br />
6.'''Can be used to view the temporal dynamics in a cell'''<br />
<br />
7.'''Speeds up the reporting progress.'''<br />
*With our reporting system, we can produce fluorescence in or RNA or protein assya in roughly 3 minutesWe can do a protein assay or mRNA assay in our speedy reporter system. It is faster than the conventional method RT-PCR for mRNA which needs about two hours and western blot for protein quantitative analysis which requires about 4.5 hours.<br />
*The split GFP is a constitutive protein in the cell. Once the RNA aptamer is transcribed, the split GFP linked with eIF4A will bind to the RNA aptamer due to its high affinity. We skip the translation process due to the already-generated GFP.<br />
<br />
=<font color=blue>References</font>=<br />
*Barnard, E., McFerran, N.V., Trudgett, A., Nelson, J., and Timson, D.J. (2008). Development and implementation of split-GFP-based bimolecular fluorescence complementation (BiFC) assays in yeast. ''Biochem Soc Trans'' 36, 479-482.<br />
<br />
*Demidov, V.V., and Broude, N.E. (2006). Profluorescent protein fragments for fast bimolecular fluorescence complementation in vitro. ''Nat Protoc'' 1, 714-719.<br />
<br />
*Huttelmaier, S., Zenklusen, D., Lederer, M., Dictenberg, J., Lorenz, M., Meng, X., Bassell, G.J., Condeelis, J., and Singer, R.H. (2005). Spatial regulation of beta-actin translation by Src-dependent phosphorylation of ZBP1. ''Nature'' 438, 512-515.<br />
<br />
*Imataka, H., and Sonenberg, N. (1997). Human eukaryotic translation initiation factor 4G (eIF4G) possesses two separate and independent binding sites for eIF4A. ''Mol Cell Biol'' 17, 6940-6947.<br />
<br />
*Johnstone, O., and Lasko, P. (2001). Translational regulation and RNA localization in Drosophila oocytes and embryos. ''Annu Rev Genet'' 35, 365-406.<br />
<br />
*Lin, A.C., and Holt, C.E. (2007). Local translation and directional steering in axons. ''EMBO J'' 26, 3729-3736.<br />
<br />
*Martin, K.C., and Ephrussi, A. (2009). mRNA localization: gene expression in the spatial dimension. ''Cell'' 136, 719-730.<br />
<br />
*Oguro, A., Ohtsu, T., Svitkin, Y.V., Sonenberg, N., and Nakamura, Y. (2003). RNA aptamers to initiation factor 4A helicase hinder cap-dependent translation by blocking ATP hydrolysis. ''RNA'' 9, 394-407.<br />
<br />
*Paquin, N., and Chartrand, P. (2008). Local regulation of mRNA translation: new insights from the bud. ''Trends Cell Biol'' 18, 105-111.<br />
<br />
*Remy, I., and Michnick, S.W. (2007). Application of protein-fragment complementation assays in cell biology. ''Biotechniques'' 42, 137, 139, 141 passim.<br />
<br />
*Story, R.M., Li, H., and Abelson, J.N. (2001). Crystal structure of a DEAD box protein from the hyperthermophile Methanococcus jannaschii. ''Proc Natl Acad Sci U S A'' 98, 1465-1470.<br />
<br />
*Valencia-Burton, M., McCullough, R.M., Cantor, C.R., and Broude, N.E. (2007). RNA visualization in live bacterial cells using fluorescent protein complementation. ''Nat Methods'' 4, 421-427.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-27T21:06:13Z<p>Blackrabbit: /* Animated Project Overview */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><embed src="https://static.igem.org/mediawiki/2010/5/58/NYMU_SpeedyBac_ani.mov" width="640" height="480"></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporterTeam:NYMU-Taipei/Project/Speedy reporter2010-10-27T21:05:41Z<p>Blackrabbit: /* Overview design by figure */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=<font color=red>Overview design</font>=<br />
<html><embed src="https://static.igem.org/mediawiki/2010/6/62/NYMU_RNA_reporter.mov" width="640px" height="480px"></html><br />
<br />
=<font color=blue>Abstract</font>=<br />
* Our Speedy RNA+protein reporter effectively skips protein folding when reporting, thus reducing the time for a fluorescent response.<br />
More specific insights into molecular mechanisms and gene regulation are essential for improvement in synthetic biology. Understanding these mechanisms requires time. Our speedy reporter for reporting RNA and protein expression in a cell effectively skips protein folding when reporting -- the longest part of gene expression - thus reducing the time needed to get a fluorescence. By speeding up the reporter, in both RNA and protein, we have also speed up the exploration for rules in the biological system. We can not only generate more novel circuits but also explore gene regulations in synthetic biology.<br />
<br />
=<font color=blue>Introduction</font> =<br />
Recent studies of mRNA localization show that a great part of mRNA localize in specific cytoplasm position (Martin and Ephrussi, 2009). For examples, ASH1 mRNA localize at bud tip of budding yeast to allow asymmetric segregation from mother to daughter cell (Paquin and Chartrand, 2008). In the ''Drosophila'' the localization of mRNA at anterior and posterior of oocyte play an important role in the developing embryo (Johnstone and Lasko, 2001). Local translation of mRNAs in axonal growth cones helps axon navigate to it synaptic partners (Lin and Holt, 2007). β-actins mRNA localize at sites of active actins polymerization, cytoskeletal-mediate motility need mRNA translation (Huttelmaier et al., 2005). All the examples above is studies on eukaryotic system. there are a few studies of mRNA location in prokaryotic system. And most of synthetic biology designs on prokaryotic bacteria. The more basic rule of prokaryotic system we know, the more successful and speedy experiments we will have.<br />
<br />
<br />
The common way to detect mRNA is RT-PCR, which can only be done in vitro but can’t in a real living cell. The common way to detect the protein is fusion a reporter protein such as GFP to report it, and the folding of GFP takes about four hours. In order to do both assay speedy and in vivo, we apply a novel technique Bimolecular Fluorescence Complementation, BiFC. In our design, we need not to wait four hours for folding of GFP to detect our protein fusion GFP. We can get our signal in few minute using this method. And it also can detect the mRNA both location and quantity (Demidov and Broude, 2006). We can use this method save about fours for protein assay and two hours for mRNA assay (Fig.1). <br />
<br />
{| border=0 <br />
| rowspan=10 | [[image:NYMU_Speedy_fig..png|frame|none|200px|Figure.1 compare to the traditional method of detecting mRNA and protein. our speedy reporter only need 3 min to obtain signal (Demidov and Broude, 2006).]]<br />
| BiFC is developed base on the technique Protein-fragment Complement Assay, PCA (Barnard et al., 2008; Demidov and Broude, 2006). Protein-protein interactions coupled to refolding of a pair of split enzymes in the PCA technique. The enzyme used in PCA has it activity only when two split parts reconstruct together. The activities of enzyme act as a detector of protein-protein interaction (Remy and Michnick, 2007). While the BiFC technique use split fluorescent protein instead of split enzyme in the PCA. The split form of fluorescent protein alone has no fluorescence. Fluorescence appears when two split parts reassembly together immediately in few minutes. For mRNA detection, we design a system differ from BiFC’s protein-protein interaction to RNA-protein interaction. Where a GFP is split into two inactive parts and fused with two parts of the split-eIF4A protein, a kind of RNA binding protein. On the other hand, we designed an mRNA aptamer that the eIF4A protein can bind to. EGFP will fluoresce through the interaction of split eIF4A and its corresponding aptamer. Using this method, we can immediately detect mRNA quantity and location in vivo. For protein detection, we design another system of BiFC which RFP is splits into two inactive parts and fused with two parts of antibody light chain and heavy chain. And then we fused the antigen to target protein. When target protein fusion antigen appears, the light chain and heavy chain combine with antigen. And then split RFPs reconstruct and fluoresce.<br />
|}<br />
<br />
=<font color=blue>Design</font>=<br />
*Our circuit design:<br />
**EGFP-eIF4A system / RNA aptamer on plasmid pSB1C3.<br />
[[Image:RNA Binding 1 (1).png|500px|EGFP-eIF4A system on plasmid pSB1C3.]]<br />
[[Image:RNA Binding 2.png|400px|RNA aptamer on plasmid pSB1C3.]]<br />
==EGFP/ERFP + split eIF4A==<br />
*split GFP/RFP<br />
We split the EGFP/ERFP into two parts, the larger N-terminal part and the smaller C-terminal part. The N-terminal part contains performed chromophore and has a very weak fluorescence that is hard to detect. Only when it combines with the small C-terminal fragment, does the fluorescence become very bright. When both parts combine, we can detect the location of the mRNA and protein. The probability that these two split parts of EGFP/ERFP can fit together without an outside force is very low, thus ther are few false-positive signal (Demidov and Broude, 2006).<br />
*eIF4A<br />
eIF4A is an abbreviation for eukaryotic initiation factor 4A. It is a member of the DEAD-box RNA helicase protein family eIF4F (Oguro et al., 2003), and the DEAD-box is one of the largest subgroups of the RNA helicase protein family (Story et al., 2001). <br />
<br />
Eukaryotic translation initiation factor 4F (eIF4F) is a protein consists of eIF4A, eIF4E, and eIF4G. eIF4A is a helicase need ATP to unwind the secondary structure of mRNA untranslated region and make ribosome binds easier. eIF4E can binds to the cap structure of mRNA. eIF4G is like a scaffold of eIF4A and eIF4E helping them coordinate their functions. Without eIF4E and eIF4G the eIF4A alone exist much lower RNA helicase activity than complete eIF4F (Imataka and Sonenberg, 1997).<br />
<br />
==eIF4A aptamer==<br />
* What is eIF4A aptamer? <br />
The eIF4A aptamer that we used has a high affinity for complete eIF4A protein. Its affinity is strong enough that it will combine the split eIF4A(described above) into a complete eIF4A protein. In the presence of eIF4A aptamer, ATP hydrolysis is inhibited and the RNA substrate which binds onto the eIF4A cannot unwind. <br />
<br />
It is proposed that the eIF4A structure is in a equilibrium between dumbbell-shaped structure and compact struction in solution. In the presence of ATP and absence of RNA aptamer, the equilibrium will be shifted into the dumbbell-shaped eIF4A (Fig.2). In the opposite condition, the equilibrium will be shifted into the compact one (Valencia-Burton et al., 2007).<br />
[[Image:NYMU_EIF4A.aptamer.png|frame|none|100px|Figure.2 Two domains and the structure equilibrium of eIF4A (Oguro et al., 2003)]]<br />
*eIF4A aptamer Secondary structure:<br />
** Structure predicted by RNAfold: [[Image:NYMU Aptamer Structure predicted by RNAfold.png|frame|none|Figure.3 Aptamer Structure predicted by RNAfold]]<br />
** Structure of eIF4A aptamer: [[Image:NYMU Aptamer Structure from Paper.png|frame|none|Figure.4 Aptamer Structure (Oguro et al., 2003)]]<br />
<br />
=[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods| Material and Methods]]=<br />
We constructed two devices by using the parts below:<br />
*RNA reporter consists of : <br />
**EGFP<br />
**ERFP<br />
**eIF4A<br />
**fusion parts<br />
**aptamer<br />
*protein reporter consists of :<br />
**split RFP<br />
**split peptide adaptor<br />
==RNA reporter device==<br />
===[[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP| GFP ]]===<br />
*Splitting the GFP({{:Team:NYMU-Taipei/BBa|E0040}}) at 157th and 158th amino acid which was generated by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715019}} and {{:Team:NYMU-Taipei/BBa|I715020}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715019}} , but the B-part is one base different from {{:Team:NYMU-Taipei/BBa|I715020}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP| RFP ]] ===<br />
*Splitting RFP ({{:Team:NYMU-Taipei/BBa|E1010}}) at 154th and 155th amino acid used by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715022}} and {{:Team:NYMU-Taipei/BBa|I715023}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715022}}, but the B-part has one base difference from {{:Team:NYMU-Taipei/BBa|I715023}}. After the splitting, we both add linkers in back of A-part split and B-part split via PCR. By doing so, we can get well-prepared for the next step.<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#eIF4A| eIF4A]] ===<br />
*We take the protein coding region from the [http://www.ncbi.nlm.nih.gov/nuccore/NM_144958 eIF4A mRNA transcript sequence from Mouse (from NCBI)] and found that it had 2 PstI cutting sites. For fear that our PstI cutting enzyme would cut the wrong place, we mutated the two PstI cutting sites.After mutation, we split eIF4A ({{:Team:NYMU-Taipei/BBa|K411100}}) at 215&216th amino acid.<br />
*The template of eIF4A on a [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/PGEX4T1.SEQ.html pGEX-4TI vector] was kindly provided by Pro.C.Proud.<br />
<br />
== Fusion parts ==<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#GFP_fusion_part| GFP fusion system]] ===<br />
*We fused the split-GFP part with split-eIF4A part via PCR to get two sequences: split-GFP-A+linker+split-eIF4A-A([http://partsregistry.org/Part:BBa_K411101 BBa_K41111])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411102 BBa_K11102]) We then added terminators in the back of both sequences and inserted them into one plasmid.<br />
{| border=0 <br />
| rowspan=5 | [[Image:122.PNG|500px|EGFP-eIF4A system on plasmid pSB1C3.]] <br />
<br />
| <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The picture shows the templates of PCR potocol. The split-GFP part and split-eIF4A part both have complementary linker sequences, which will anneal during the PCR process. <br />
|}<br />
<br />
=== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#RFP__fusion_part| RFP fusion system]] ===<br />
<br />
*Similarly, we fused the split-RFP part with split-eIF4A part via PCR to get two sequences:split-RFP-A+linker+split-eIF4A-A ([http://partsregistry.org/Part:BBa_K411103 BBa_K411103])and split-GFP-B+linker+split-eIF4A-B([http://partsregistry.org/Part:BBa_K411104 BBa_K411104])<br />
<br />
== [[Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods#Aptamer| aptamer]] ==<br />
*We performed PCR to get the required aptamer based on sequence showed in the paper (Valencia-Burton et al., 2007).<br />
We first designed primers by adding a prefix in the front of the aptamer sequence and a suffix at the end of the aptamer sequence. We digested the aptamer with Xbal&PstI cutting enzymes and the pLac with Spal&PstI cutting enzymes. We then used ligase to join them together.<br />
<br />
==protein reporter device==<br />
The basic principle of protein reporter device is the same as the RNA reporter. First, we fuse split RFP with anti-His tag antibody light chain and heavy chain. Second, we fuse His-tag sequence with our target protein sequence. Once our target protein sequence being tranlated the anti-His tag antibody will binding on the Histidine tag. And then with combining of the heavy chain and the light chain, The split ERFP reconstruct and make brightly fluorescence.<br />
[[image:NYMU_TAIPEI_His_tag_structure.png|frame|none|200px|Figure.5 The structure of anti-His tag antibody. Green stand for the heavy chain and the red stand for the light chain (PDB ID: 1KTR).]]<br />
<br />
=<font color=blue>Advantages</font>=<br />
1.'''Tests the promotor strength in a speedy way.'''<br />
*Conventionally, inducible promoter strength is tested by a reporter gene (e.g. GFP) downstream from the promoter. To do know, one needs to wait for protein folding (four hours for GFP). In our design, we can test the promoter strength at the mRNA level and only needs 3 min for the split GFP to reconstitute into functional protein.<br />
*A strong promoter will result in more RNA aptamers. The more RNA aptamer, the more our split GFP will combine to emit a stronger fluorescence. With a weaker promoter, less RNA aptamers are created, and thus, less split GFP will combine to fluoresce. <br />
2.'''Locates specific genes or chemicals (such as heavy metals)'''<br />
*Similar to the promoter testing, we can use the inducible promoter whose inducers are heavy metals(e.g. As or Zn). When these heavy metals is present, the promoter will be induced and transcribed into mRNA aptamer. With our GFP reporter, it will bind to the RNA aptamer and emit fluorescence. With this we can know that the quantity of heavy metal pollution in that environment. <br />
3.'''Helps other teams test their biobricks.'''<br />
<br />
4.'''Shows mRNA positioning in a sigle cells.'''<br />
*By understanding the RNA localization in a cell, we can learm more about how gene regulation works in a cell. And by understanding more about the precise gene regulations, we can explore more about the design rules in synthetic biology.<br />
<br />
5.'''Measures the quantity of the mRNA.'''<br />
<br />
6.'''Can be used to view the temporal dynamics in a cell'''<br />
<br />
7.'''Speeds up the reporting progress.'''<br />
*With our reporting system, we can produce fluorescence in or RNA or protein assya in roughly 3 minutesWe can do a protein assay or mRNA assay in our speedy reporter system. It is faster than the conventional method RT-PCR for mRNA which needs about two hours and western blot for protein quantitative analysis which requires about 4.5 hours.<br />
*The split GFP is a constitutive protein in the cell. Once the RNA aptamer is transcribed, the split GFP linked with eIF4A will bind to the RNA aptamer due to its high affinity. We skip the translation process due to the already-generated GFP.<br />
<br />
=<font color=blue>References</font>=<br />
*Barnard, E., McFerran, N.V., Trudgett, A., Nelson, J., and Timson, D.J. (2008). Development and implementation of split-GFP-based bimolecular fluorescence complementation (BiFC) assays in yeast. ''Biochem Soc Trans'' 36, 479-482.<br />
<br />
*Demidov, V.V., and Broude, N.E. (2006). Profluorescent protein fragments for fast bimolecular fluorescence complementation in vitro. ''Nat Protoc'' 1, 714-719.<br />
<br />
*Huttelmaier, S., Zenklusen, D., Lederer, M., Dictenberg, J., Lorenz, M., Meng, X., Bassell, G.J., Condeelis, J., and Singer, R.H. (2005). Spatial regulation of beta-actin translation by Src-dependent phosphorylation of ZBP1. ''Nature'' 438, 512-515.<br />
<br />
*Imataka, H., and Sonenberg, N. (1997). Human eukaryotic translation initiation factor 4G (eIF4G) possesses two separate and independent binding sites for eIF4A. ''Mol Cell Biol'' 17, 6940-6947.<br />
<br />
*Johnstone, O., and Lasko, P. (2001). Translational regulation and RNA localization in Drosophila oocytes and embryos. ''Annu Rev Genet'' 35, 365-406.<br />
<br />
*Lin, A.C., and Holt, C.E. (2007). Local translation and directional steering in axons. ''EMBO J'' 26, 3729-3736.<br />
<br />
*Martin, K.C., and Ephrussi, A. (2009). mRNA localization: gene expression in the spatial dimension. ''Cell'' 136, 719-730.<br />
<br />
*Oguro, A., Ohtsu, T., Svitkin, Y.V., Sonenberg, N., and Nakamura, Y. (2003). RNA aptamers to initiation factor 4A helicase hinder cap-dependent translation by blocking ATP hydrolysis. ''RNA'' 9, 394-407.<br />
<br />
*Paquin, N., and Chartrand, P. (2008). Local regulation of mRNA translation: new insights from the bud. ''Trends Cell Biol'' 18, 105-111.<br />
<br />
*Remy, I., and Michnick, S.W. (2007). Application of protein-fragment complementation assays in cell biology. ''Biotechniques'' 42, 137, 139, 141 passim.<br />
<br />
*Story, R.M., Li, H., and Abelson, J.N. (2001). Crystal structure of a DEAD box protein from the hyperthermophile Methanococcus jannaschii. ''Proc Natl Acad Sci U S A'' 98, 1465-1470.<br />
<br />
*Valencia-Burton, M., McCullough, R.M., Cantor, C.R., and Broude, N.E. (2007). RNA visualization in live bacterial cells using fluorescent protein complementation. ''Nat Methods'' 4, 421-427.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-27T21:03:31Z<p>Blackrabbit: /* Animation Project Overview */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animated Project Overview</font> =<br />
<html><embed src="https://2010.igem.org/Image:NYMU_SpeedyBac_ani.mov" width="640" height="480"></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-27T21:03:07Z<p>Blackrabbit: /* Animation Project Overview */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animation Project Overview</font> =<br />
<html><embed src="https://2010.igem.org/Image:NYMU_SpeedyBac_ani.mov" width="640" height="480"></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-27T21:02:32Z<p>Blackrabbit: /* Animation Project Overview */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animation Project Overview</font> =<br />
<html><embed src="https://2010.igem.org/Image:NYMU_SpeedyBac_ani.mov" width="640px"></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-27T21:01:08Z<p>Blackrabbit: /* Animation Project Overview */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animation Project Overview</font> =<br />
<html><embed src="https://2010.igem.org/Image:NYMU_SpeedyBac_ani.mov"></html><br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-27T20:55:12Z<p>Blackrabbit: /* Project overview by animation */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
= <font color=red>Animation Project Overview</font> =<br />
<br />
= <font color=blue>Motivation</font> =<br />
Our motivation arised from the following emergent needs in the development of synthetic biology:<br />
*Detailed design rules for large-scale genetic circuit design.<br />
*Comprehensive information of the interactions among genetic parts in ''vivo''.<br />
*Exploring gene expression mechanisms using traditional methods takes too much time.<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit.<br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology, but they often ends as only ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other.<br />
<br />
Just like we know the design rules that tell us how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. <br />
<br />
Current research uses the expression of reporter genes to tell when a circuit is working.We want to quantify gene expression in both space and time, so that we can better study the interaction between different biological parts ''in vivo''. However, studying these gene expression mechanisms using current methods takes far too much time.<br />
<br />
With these problems in mind, we created SpeedyBac.<br />
<br />
= <font color=blue>Overview</font> =<br />
For iGEM2010, the NYMU-Taipei team has created a novel assaying system ("'''SpeedyBac'''") that can <br />
* speed up the expression detection of a gene flow. <br />
* reveal the location and quantity of both mRNAs and Proteins. <br />
** Between the mRNA level and protein level of our gene expression cycle, we have integrated a riboswitch that allows us to stop, start and control the translation of proteins. Using this switch, we can study mRNA and its protein(s) in one cycle without the interference of one on the other. <br />
* the speedy degradation device we built can stop the gene expression quickly and cleanly. <br />
== Design ==<br />
To achieve our goal, our '''SpeedyBac''' system is designed with the following three devices:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Controls and speeds up mRNA translation into protein via a riboswitch between mRNA and protein level of gene expression. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to quickly outperform promoter-only activity.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
= <font color=blue>Safety Issues</font>=<br />
Here we detail how we approached possible issues of biological safety associated with our project.<br />
<br />
Specifically, the following four questions were considered:<br />
<br />
#Would any of our project ideas raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety?<br />
#Is there a local biosafety group, committee, or review board at our institution?<br />
#What does our local biosafety group think about our project?<br />
#Do any of the new BioBrick parts that we made this year raise any safety issues? <br />
#*If yes, did we document these issues in the Registry?<br />
<br />
<font color="red">'''Our answers to these four questions'''</font>:<br />
#For iGEM 2010 project, our goal is to design and engineer bacteria (called "SpeedyBac") to provide a faster assay system for exploring the design rules of synthetic biology. However, due to potential safety issues of using pathogenic bacteria in our experiments, we only used ''Escherichia coli'' model organism in our experiments to prove the concept. E. coli is widely used as a model organism in biological studies and also in synthetic biology research. It can be handled with few safety measures. No special safety equipment required. We also did not use any proteins that are toxic or pathogenic by themselves. Therefore, these should not raise safety issues in terms of:<br />
#*researcher safety, <br />
#*public safety, or <br />
#*environmental safety.<br />
#At NYMU, we do have a biosafety committee to review all biosafety and biosecurity issues at our university.<br />
#We had presented our SpeedyBac project to many of our school professors including many of the members of our biosafety committee. Since we were not using toxic or pathogenic bacteria or proteins in any of our experiments, they did not think our SpeedyBac project would raise any biosafety issues.<br />
#None of the new BioBrick parts that we made this year raise any safety issues. All the parts clones we shipped as new BioBrick parts have no safety issues.<br />
<br />
We also documented all our answers to these safety questions in our presentation, wiki presentation, and poster.<br />
<br />
= <font color=blue>Acknowledgements</font> =<br />
We are grateful for the kind support and help of <br />
* [http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud] for providing us with the pGEX-eIF4A of his lab for our experimental use. Dr. Christopher Proud is currently a Professor of Cellular Regulation & Deputy Head of School, Research School of Biological Sciences Life Sciences Building University of Southampton Southampton, UK.<br />
* We thank the campus faculty and students for their suggestions and for their comments on this iGEM project.<br />
* National Yang Ming University and Ministry of Education, Taiwan. This iGEM project is fully supported by them. We wish to acknowledge and thank their supports of this project.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-TaipeiTeam:NYMU-Taipei2010-10-27T20:29:52Z<p>Blackrabbit: </p>
<hr />
<div><html><br />
<script><br />
function haxbackground(){<br />
document.getElementById('soikit').style.backgroundImage='url(https://static.igem.org/mediawiki/2010/f/fc/NYMU_main_circuit_bw.png)';<br />
}<br />
function unhaxbackground(){<br />
document.getElementById('soikit').style.backgroundImage="url('https://static.igem.org/mediawiki/2010/a/af/NYMU_main_circuit.png')";<br />
}<br />
</script><br />
<style><br />
dl#soikit{<br />
background:url('https://static.igem.org/mediawiki/2010/a/af/NYMU_main_circuit.png') transparent top left no-repeat;<br />
display:block;<br />
position:relative;<br />
width:965px;<br />
height:509px;<br />
margin:0px;<br />
<br />
border:4px solid darkblue;<br />
}<br />
dl#soikit dd a span{<br />
display:none;<br />
}<br />
<br />
/* link positions (x,y,w,h) */<br />
dl#soikit dd#ypm a{ left:10px; bottom:20px; width:170px; height:220px; z-index:200;}<br />
dl#soikit dd#smr a{ left:180px; bottom:20px; width:200px; height:400px; z-index:200;}<br />
dl#soikit dd#sw a{ left:380px; bottom:20px; width:180px; height:275px; z-index:200;}<br />
dl#soikit dd#spr a{ left:560px; bottom:20px; width:270px; height:480px; z-index:200;}<br />
dl#soikit dd#ypt a{ left:560px; bottom:20px; width:120px; height:150px; z-index:300;}<br />
dl#soikit dd#spd a{ left:9px; top:5px; width:160px; height:150px; z-index:100;}<br />
<br />
<br />
dl#soikit dt{<br />
display:none;<br />
}<br />
<br />
/* Common stuff between links */<br />
dl#soikit dd a{<br />
position:absolute;<br />
<br />
border:1px dashed silver;<br />
text-decoration: none;<br />
}<br />
/* link hover doings */<br />
dl#soikit dd a:hover{<br />
border-style:solid;<br />
border-width:3px;<br />
background:url('https://static.igem.org/mediawiki/2010/a/af/NYMU_main_circuit.png') transparent top left no-repeat;<br />
}<br />
/* colored borders! */<br />
dl#soikit dd#ypm a:hover, dl#soikit dd#ypm a:hover span, dl#soikit dd#ypm a:hover span div.first{ border-color:violet; }<br />
dl#soikit dd#ypt a:hover, dl#soikit dd#ypt a:hover span, dl#soikit dd#ypt a:hover span div.first{ border-color:orange; }<br />
dl#soikit dd#smr a:hover, dl#soikit dd#smr a:hover span, dl#soikit dd#smr a:hover span div.first{ border-color:red; }<br />
dl#soikit dd#spr a:hover, dl#soikit dd#spr a:hover span, dl#soikit dd#spr a:hover span div.first{ border-color:red; }<br />
dl#soikit dd#sw a:hover, dl#soikit dd#sw a:hover span, dl#soikit dd#sw a:hover span div.first{ border-color:green; }<br />
dl#soikit dd#spd a:hover, dl#soikit dd#spd a:hover span, dl#soikit dd#spd a:hover span div.first{ border-color:lightblue; }<br />
<br />
dl#soikit dd#ypm a:hover span div.first {background:#ecf; color:#333;}<br />
dl#soikit dd#ypt a:hover span div.first {background:#fc3; color:#333;}<br />
dl#soikit dd#smr a:hover span div.first {background:#fcc; color:#333;}<br />
dl#soikit dd#spr a:hover span div.first {background:#ffa; color:#333;}<br />
dl#soikit dd#sw a:hover span div.first {background:#cfc; color:#333;}<br />
dl#soikit dd#spd a:hover span div.first {background:lightblue; color:#333;}<br />
<br />
/* subsequent hover positions (change when link positions change) (-left,h-imgH+bot|-top) */<br />
dl#soikit dd#ypm a:hover{ background-position:-10px -269px; }<br />
dl#soikit dd#smr a:hover{ background-position:-180px -89px; }<br />
dl#soikit dd#sw a:hover{ background-position:-380px -214px; }<br />
dl#soikit dd#spr a:hover{ background-position:-560px -4px; }<br />
dl#soikit dd#ypt a:hover{ background-position:-560px -339px; }<br />
dl#soikit dd#spd a:hover{ background-position:-9px -7px; }<br />
<br />
/*<br />
link hover spans place everything at (360,40)<br />
put=new-old puttop=new-(imageheight-(bottom+height))<br />
*/<br />
dl#soikit dd a:hover span{<br />
display:block;<br />
position:absolute;<br />
<br />
width:220px;<br />
height:0px;<br />
<br />
border-width:0px;<br />
border-style:solid;<br />
<br />
color:black;<br />
background-color:white;<br />
<br />
text-align:center;<br />
vertical-align:center;<br />
font-size:28pt;<br />
font-weight:bold;<br />
font-family:"Kristen ITC","Bradley Hand ITC","Calibri","Arial Unicode MS";<br />
line-height:1;<br />
}<br />
/*dl#soikit dd a:hover span div.first{<br />
display:block;<br />
font-size:120%;<br />
font-weight:bold;<br />
padding:2px;<br />
text-align:center;<br />
border-bottom:1px dashed;<br />
}<br />
dl#soikit dd a:hover span div.rest{<br />
font-size:12pt;<br />
font-face:Arial;<br />
margin-left:1em;<br />
}*/<br />
dl#soikit dd#ypm a:hover span{<br />
left:350px;<br />
top:-229px;<br />
}<br />
dl#soikit dd#smr a:hover span{<br />
left:180px;<br />
top:-49px;<br />
}<br />
dl#soikit dd#sw a:hover span{<br />
left:-20px;<br />
top:-174px;<br />
}<br />
dl#soikit dd#spr a:hover span{<br />
left:-200px;<br />
top:36px;<br />
}<br />
dl#soikit dd#ypt a:hover span{<br />
left:-200px;<br />
top:-299px;<br />
}<br />
dl#soikit dd#spd a:hover span{<br />
left:351px;<br />
top:33px;<br />
}<br />
<br />
/* Others that don't fit into a pattern */<br />
dl#soikit dd#banner span img{<br />
position:absolute;<br />
/*left:283px;<br />
right:10px;<br />
top:13px;<br />
width:700px;<br />
height:233px;*/<br />
top:40px;<br />
left:360px;<br />
<br />
/* For preloading purposes only */<br />
background:url('https://static.igem.org/mediawiki/2010/f/fc/NYMU_main_circuit_bw.png') transparent no-repeat;<br />
background-position:-965px -965px;<br />
}<br />
<br />
</style><br />
<dl id="soikit"><br />
<dt>Default display</dt><br />
</dd><br />
<br />
<dt>Your Promoter</dt><br />
<dd id="ypm"><a href="https://2010.igem.org/Team:NYMU-Taipei/Applications#Your_promoter_and_Your_protein" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Your Promoter</span><br />
</a></dd><br />
<br />
<dt>Your Protein</dt><br />
<dd id="ypt"><a href="https://2010.igem.org/Team:NYMU-Taipei/Applications#Your_promoter_and_Your_protein" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Your Protein</span><br />
</a></dd><br />
<br />
<dt>Speedy mRNA Reporter</dt><br />
<dd id="smr"><a href="https://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporter" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Speedy mRNA Reporter</span><br />
</a></dd><br />
<br />
<dt>Speedy Protein Reporter</dt><br />
<dd id="spr"><a href="https://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporter#protein_reporter_device" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Speedy Protein Reporter</span><br />
</a></dd><br />
<br />
<dt>Speedy Switch</dt><br />
<dd id="sw"><a href="https://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_switch" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Speedy Switch</span><br />
</a></dd><br />
<br />
<dt>Speedy Protein Degrader</dt><br />
<dd id="spd"><a href="https://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_protein_degrader" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Speedy Protein Degrader</span><br />
</a></dd><br />
</dl><br />
</html><br />
<br />
{{:Team:NYMU-Taipei/Links}}<br />
<br />
{| style="width:965px;border:1px solid gray;"<br />
|-<br />
| style="vertical-align:top;width:50%;border-right:1px solid gray;" | <br />
<br />
<font size=5>'''SpeedyBac'''</font><br><br />
<br><br />
*'''<font size=3>Goal</font>'''<br><br />
Provide a faster assay system for exploring the design rules of synthetic biology.<br />
*'''<font size=3>Why do we want to do that?</font><br><br />
There are already many genetic parts in the Biobrick Parts Registry and the numbers are growing fast. Every year every igem teams will build genetic circuits based on the parts at partsregistry. But where are the design rules to put these parts into circuits of devices and systems? Apparently, the "Assembly Standards" listed at the partsregistry are only used to connect compatible restriction enzyme cutting sites. They are NOT designing principles. Our iGEM team is very interested in the detailed design rules played in the central dogma; especially those principles for connecting mRNA translation to protein folding. Traditionally, we know about the circuits we made are working or not mostly through the expression of reporter genes. However, it would be much helpful if we could have information of quantitative description of gene expression in both space and time. For these reasons and for the future development of synthetic biology, we just have to speed up the experimental explorations of design rules. <br><br />
*'''<font size=3>Specific aims</font>'''<br><br />
** detect gene expression quantitatively in both space and time.<br />
** specific insight into the flow of genetic information.<br />
** provide speedy ways to report and stop gene expression.<br />
----<br />
[[Image:Nymusyb.png|500px]]<br />
<br />
| style="vertical-align:top;" |<br />
{{:Team:NYMU-Taipei/Our institute}}<br />
|}<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-TaipeiTeam:NYMU-Taipei2010-10-27T20:28:10Z<p>Blackrabbit: </p>
<hr />
<div><html><br />
<script><br />
function haxbackground(){<br />
document.getElementById('soikit').style.backgroundImage='url(https://static.igem.org/mediawiki/2010/f/fc/NYMU_main_circuit_bw.png)';<br />
}<br />
function unhaxbackground(){<br />
document.getElementById('soikit').style.backgroundImage="url('https://static.igem.org/mediawiki/2010/a/af/NYMU_main_circuit.png')";<br />
}<br />
</script><br />
<style><br />
dl#soikit{<br />
background:url('https://static.igem.org/mediawiki/2010/a/af/NYMU_main_circuit.png') transparent top left no-repeat;<br />
display:block;<br />
position:relative;<br />
width:965px;<br />
height:509px;<br />
margin:0px;<br />
<br />
border:4px solid darkblue;<br />
}<br />
dl#soikit dd a span{<br />
display:none;<br />
}<br />
<br />
/* link positions (x,y,w,h) */<br />
dl#soikit dd#ypm a{ left:10px; bottom:20px; width:170px; height:220px; z-index:200;}<br />
dl#soikit dd#smr a{ left:180px; bottom:20px; width:200px; height:400px; z-index:200;}<br />
dl#soikit dd#sw a{ left:380px; bottom:20px; width:180px; height:275px; z-index:200;}<br />
dl#soikit dd#spr a{ left:560px; bottom:20px; width:270px; height:480px; z-index:200;}<br />
dl#soikit dd#ypt a{ left:560px; bottom:20px; width:120px; height:150px; z-index:300;}<br />
dl#soikit dd#spd a{ left:9px; top:5px; width:160px; height:150px; z-index:100;}<br />
<br />
<br />
dl#soikit dt{<br />
display:none;<br />
}<br />
<br />
/* Common stuff between links */<br />
dl#soikit dd a{<br />
position:absolute;<br />
<br />
border:1px dashed silver;<br />
text-decoration: none;<br />
}<br />
/* link hover doings */<br />
dl#soikit dd a:hover{<br />
border-style:solid;<br />
border-width:3px;<br />
background:url('https://static.igem.org/mediawiki/2010/a/af/NYMU_main_circuit.png') transparent top left no-repeat;<br />
}<br />
/* colored borders! */<br />
dl#soikit dd#ypm a:hover, dl#soikit dd#ypm a:hover span, dl#soikit dd#ypm a:hover span div.first{ border-color:violet; }<br />
dl#soikit dd#ypt a:hover, dl#soikit dd#ypt a:hover span, dl#soikit dd#ypt a:hover span div.first{ border-color:orange; }<br />
dl#soikit dd#smr a:hover, dl#soikit dd#smr a:hover span, dl#soikit dd#smr a:hover span div.first{ border-color:red; }<br />
dl#soikit dd#spr a:hover, dl#soikit dd#spr a:hover span, dl#soikit dd#spr a:hover span div.first{ border-color:red; }<br />
dl#soikit dd#sw a:hover, dl#soikit dd#sw a:hover span, dl#soikit dd#sw a:hover span div.first{ border-color:green; }<br />
dl#soikit dd#spd a:hover, dl#soikit dd#spd a:hover span, dl#soikit dd#spd a:hover span div.first{ border-color:lightblue; }<br />
<br />
dl#soikit dd#ypm a:hover span div.first {background:#ecf; color:#333;}<br />
dl#soikit dd#ypt a:hover span div.first {background:#fc3; color:#333;}<br />
dl#soikit dd#smr a:hover span div.first {background:#fcc; color:#333;}<br />
dl#soikit dd#spr a:hover span div.first {background:#ffa; color:#333;}<br />
dl#soikit dd#sw a:hover span div.first {background:#cfc; color:#333;}<br />
dl#soikit dd#spd a:hover span div.first {background:lightblue; color:#333;}<br />
<br />
/* subsequent hover positions (change when link positions change) (-left,h-imgH+bot|-top) */<br />
dl#soikit dd#ypm a:hover{ background-position:-10px -269px; }<br />
dl#soikit dd#smr a:hover{ background-position:-180px -89px; }<br />
dl#soikit dd#sw a:hover{ background-position:-380px -214px; }<br />
dl#soikit dd#spr a:hover{ background-position:-560px -4px; }<br />
dl#soikit dd#ypt a:hover{ background-position:-560px -339px; }<br />
dl#soikit dd#spd a:hover{ background-position:-9px -7px; }<br />
<br />
/*<br />
link hover spans place everything at (360,40)<br />
put=new-old puttop=new-(imageheight-(bottom+height))<br />
*/<br />
dl#soikit dd a:hover span{<br />
display:block;<br />
position:absolute;<br />
<br />
width:220px;<br />
height:0px;<br />
<br />
border-width:0px;<br />
border-style:solid;<br />
<br />
color:black;<br />
background-color:white;<br />
<br />
text-align:center;<br />
vertical-align:center;<br />
font-size:28pt;<br />
font-weight:bold;<br />
font-family:"Kristen ITC","Bradley Hand ITC","Calibri","Arial Unicode MS";<br />
line-height:1;<br />
}<br />
/*dl#soikit dd a:hover span div.first{<br />
display:block;<br />
font-size:120%;<br />
font-weight:bold;<br />
padding:2px;<br />
text-align:center;<br />
border-bottom:1px dashed;<br />
}<br />
dl#soikit dd a:hover span div.rest{<br />
font-size:12pt;<br />
font-face:Arial;<br />
margin-left:1em;<br />
}*/<br />
dl#soikit dd#ypm a:hover span{<br />
left:350px;<br />
top:-229px;<br />
}<br />
dl#soikit dd#smr a:hover span{<br />
left:180px;<br />
top:-49px;<br />
}<br />
dl#soikit dd#sw a:hover span{<br />
left:-20px;<br />
top:-174px;<br />
}<br />
dl#soikit dd#spr a:hover span{<br />
left:-200px;<br />
top:36px;<br />
}<br />
dl#soikit dd#ypt a:hover span{<br />
left:-200px;<br />
top:-299px;<br />
}<br />
dl#soikit dd#spd a:hover span{<br />
left:351px;<br />
top:33px;<br />
}<br />
<br />
/* Others that don't fit into a pattern */<br />
dl#soikit dd#banner span img{<br />
position:absolute;<br />
/*left:283px;<br />
right:10px;<br />
top:13px;<br />
width:700px;<br />
height:233px;*/<br />
top:40px;<br />
left:360px;<br />
<br />
/* For preloading purposes only */<br />
background:url('https://static.igem.org/mediawiki/2010/f/fc/NYMU_main_circuit_bw.png') transparent no-repeat;<br />
background-position:-965px -965px;<br />
}<br />
<br />
</style><br />
<dl id="soikit"><br />
<dt>Default display</dt><br />
</dd><br />
<br />
<dt>Your Promoter</dt><br />
<dd id="ypm"><a href="https://2010.igem.org/Team:NYMU-Taipei/Applications#Your_promoter_and_Your_protein" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Your Promoter</span><br />
</a></dd><br />
<br />
<dt>Your Protein</dt><br />
<dd id="ypt"><a href="https://2010.igem.org/Team:NYMU-Taipei/Applications#Your_promoter_and_Your_protein" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Your Protein</span><br />
</a></dd><br />
<br />
<dt>Speedy mRNA Reporter</dt><br />
<dd id="smr"><a href="https://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporter" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Speedy mRNA Reporter</span><br />
</a></dd><br />
<br />
<dt>Speedy Protein Reporter</dt><br />
<dd id="spr"><a href="https://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporter#Protein_reporter" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Speedy Protein Reporter</span><br />
</a></dd><br />
<br />
<dt>Speedy Switch</dt><br />
<dd id="sw"><a href="https://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_switch" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Speedy Switch</span><br />
</a></dd><br />
<br />
<dt>Speedy Protein Degrader</dt><br />
<dd id="spd"><a href="https://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_protein_degrader" onmouseover="haxbackground();" onmouseout="unhaxbackground();"><br />
<span>Speedy Protein Degrader</span><br />
</a></dd><br />
</dl><br />
</html><br />
<br />
{{:Team:NYMU-Taipei/Links}}<br />
<br />
{| style="width:965px;border:1px solid gray;"<br />
|-<br />
| style="vertical-align:top;width:50%;border-right:1px solid gray;" | <br />
<br />
<font size=5>'''SpeedyBac'''</font><br><br />
<br><br />
*'''<font size=3>Goal</font>'''<br><br />
Provide a faster assay system for exploring the design rules of synthetic biology.<br />
*'''<font size=3>Why do we want to do that?</font><br><br />
There are already many genetic parts in the Biobrick Parts Registry and the numbers are growing fast. Every year every igem teams will build genetic circuits based on the parts at partsregistry. But where are the design rules to put these parts into circuits of devices and systems? Apparently, the "Assembly Standards" listed at the partsregistry are only used to connect compatible restriction enzyme cutting sites. They are NOT designing principles. Our iGEM team is very interested in the detailed design rules played in the central dogma; especially those principles for connecting mRNA translation to protein folding. Traditionally, we know about the circuits we made are working or not mostly through the expression of reporter genes. However, it would be much helpful if we could have information of quantitative description of gene expression in both space and time. For these reasons and for the future development of synthetic biology, we just have to speed up the experimental explorations of design rules. <br><br />
*'''<font size=3>Specific aims</font>'''<br><br />
** detect gene expression quantitatively in both space and time.<br />
** specific insight into the flow of genetic information.<br />
** provide speedy ways to report and stop gene expression.<br />
----<br />
[[Image:Nymusyb.png|500px]]<br />
<br />
| style="vertical-align:top;" |<br />
{{:Team:NYMU-Taipei/Our institute}}<br />
|}<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/LinksTeam:NYMU-Taipei/Links2010-10-27T16:44:21Z<p>Blackrabbit: </p>
<hr />
<div><html><br />
<style><br />
#nav .left, #nav .right, #nav .both{<br />
border-color: gray;<br />
border-style:solid;<br />
}<br />
#nav .left{<br />
border-width:0px 0px 0px 1px;<br />
}<br />
#nav .right{<br />
border-width:0px 1px 0px 0px;<br />
}<br />
#nav .both{<br />
border-width:0px 1px;<br />
}<br />
#nav td{<br />
width:88px;<br />
text-align:center;<br />
}<br />
#nav a{<br />
display:block;<br />
}<br />
#nav a:hover{<br />
background:gray;<br />
color:white;<br />
text-decoration:none;<br />
}<br />
.navsmall{<br />
display:none;<br />
}<br />
</style><br />
</html><br />
{| id="nav" style="border:1px solid gray;width:965px"<br />
| class="right" | [[Team:NYMU-Taipei | Home]]<br />
| class="left" style="width:120px;" | [[Team:NYMU-Taipei/Project| Project Overview]]<br />
| class="left" | [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
| class="left" | [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
| class="left" style="width:120px;" | [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
| class="both" style="width:180px;" | [[Team:NYMU-Taipei/Experiments| Experiments and Parts]]<br />
| class="both" | [[Team:NYMU-Taipei/Applications| Applications]]<br />
| class="both" | [[Team:NYMU-Taipei/FAQ| F.A.Q]]<br />
| class="left" | [[Team:NYMU-Taipei/Team | About Us]]<br />
|}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-TaipeiTeam:NYMU-Taipei2010-10-27T16:43:31Z<p>Blackrabbit: </p>
<hr />
<div><!--[[Image:NYMU main circuit.png|975px]]--><br />
<html><br />
<script><br />
function haxbackground(){<br />
document.getElementById('soikit').style.backgroundImage='url(https://static.igem.org/mediawiki/2010/a/af/NYMU_main_circuit.png)';<br />
}<br />
function unhaxbackground(){<br />
document.getElementById('soikit').style.backgroundImage="url('https://static.igem.org/mediawiki/2010/f/fc/NYMU_main_circuit_bw.png')";<br />
}<br />
</script><br />
<style><br />
#soikit{<br />
background:url('https://static.igem.org/mediawiki/2010/a/af/NYMU_main_circuit.png') transparent top left no-repeat;<br />
border:1px solid gray;<br />
display:block;<br />
height:509px;<br />
width:965px;<br />
}<br />
</style><br />
<div id="soikit" onmouseover="unhaxbackground();" onmouseout="haxbackground();"><br />
</div><br />
</html><br />
<br />
{{:Team:NYMU-Taipei/Links}}<br />
<br />
{| style="width:965px;border:1px solid gray;"<br />
|-<br />
| style="vertical-align:top;width:50%;border-right:1px solid gray;" | <br />
<br />
<font size=5>SpeedyBac</font><br>-<br />
''It’s not what you make, It’s not only how you make it. It’s how FAST you can make it!''<br />
*'''<font size=3>Goal</font>:'''<br><br />
Provide a faster assay for studying the combination rules on synthetic biology.<br />
*'''<font size=3>Why do we want to do that?</font><br><br />
There are more and more parts in partsregistry. Every igem teams try to build one or more circuits from partsregistry. But what are the design rules in a big circuit system. We are very interesting what the more detail rules are in the central dogma; especially between the mRNA translations to protein folding. Previously, we know about the circuits we done are work or none by the expression of reporter genes. But now we want to quantitative description of gene expression in both space and time. For the above reasons, we must to be speed up the experiment for researching the more rules. <br><br />
*'''<font size=3>Specific aims:</font>'''<br><br />
**Quantitative description of gene expression in both space and time.<br />
**Specific insight into the flow of genetic information.<br />
**Speedy ways to report and stop gene expression.<br />
*'''<font size=3>Our design:</font>'''<br><br />
For achieve our specific aim, we design a novel reporting assay [[Team:NYMU-Taipei/Project/Speedy reporter|(Speedy reporter)]] for quickly detect and measure the mRNA location and quantity, it can be also use for protein detection. And we design a novel switch [[Team:NYMU-Taipei/Project/Speedy switch|(Speedy switch)]] for control the translation in gene expression. We have also designed a faster degradation system [[Team:NYMU-Taipei/Project/Speedy protein degrader |(Speedy protein degrader)]]; it allows us to regulate the degradation time for study the mRNA without the interference from translation and quickly stop the gene expression.<br><br />
'''The parts our project is made up of''':<br><br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Faster production of protein by inducing the translation of pre-transcribed RNA molecules. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to show promoter activity faster.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA <br />
| style="vertical-align:top;" |<br />
{{:Team:NYMU-Taipei/Our institute}}<br />
|}<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/LinksTeam:NYMU-Taipei/Links2010-10-27T16:25:37Z<p>Blackrabbit: </p>
<hr />
<div><html><br />
<style><br />
#nav .left, #nav .right, #nav .both{<br />
border-color: gray;<br />
border-style:solid;<br />
}<br />
#nav .left{<br />
border-width:0px 0px 0px 1px;<br />
}<br />
#nav .right{<br />
border-width:0px 1px 0px 0px;<br />
}<br />
#nav .both{<br />
border-width:0px 1px;<br />
}<br />
#nav td{<br />
width:88px;<br />
text-align:center;<br />
}<br />
#nav a{<br />
display:block;<br />
}<br />
#nav a:hover{<br />
background:gray;<br />
color:white;<br />
text-decoration:none;<br />
}<br />
.navsmall{<br />
display:none;<br />
}<br />
</style><br />
</html><br />
{{:Team:NYMU-Taipei/jQuery}}<br />
{| id="nav" style="border:1px solid gray;width:965px"<br />
| class="right" | [[Team:NYMU-Taipei | Home]]<br />
| class="left" style="width:120px;" | [[Team:NYMU-Taipei/Project| Project Overview]]<br />
| class="left" | [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
| class="left" | [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
| class="left" style="width:120px;" | [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
| class="both" style="width:180px;" | [[Team:NYMU-Taipei/Experiments| Experiments and Parts]]<br />
| class="both" | [[Team:NYMU-Taipei/Applications| Applications]]<br />
| class="both" | [[Team:NYMU-Taipei/FAQ| F.A.Q]]<br />
| class="left" | [[Team:NYMU-Taipei/Team | About Us]]<br />
|}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-TaipeiTeam:NYMU-Taipei2010-10-27T14:45:16Z<p>Blackrabbit: </p>
<hr />
<div><!--[[Image:NYMU main circuit.png|975px]]--><br />
<html><br />
<script><br />
function haxbackground(){<br />
document.getElementById('soikit').style.backgroundImage='url(https://static.igem.org/mediawiki/2010/a/af/NYMU_main_circuit.png)';<br />
}<br />
function unhaxbackground(){<br />
document.getElementById('soikit').style.backgroundImage="url('https://static.igem.org/mediawiki/2010/f/fc/NYMU_main_circuit_bw.png')";<br />
}<br />
</script><br />
<style><br />
#soikit{<br />
background:url('https://static.igem.org/mediawiki/2010/a/af/NYMU_main_circuit.png') transparent top left no-repeat;<br />
border:1px solid gray;<br />
display:block;<br />
height:509px;<br />
width:965px;<br />
}<br />
</style><br />
<div id="soikit" onmouseover="unhaxbackground();" onmouseout="haxbackground();"><br />
</div><br />
</html><br />
<br />
{{:Team:NYMU-Taipei/Links}}<br />
<br />
{| style="width:965px;border:1px solid gray;"<br />
|-<br />
| style="vertical-align:top;width:50%;border-right:1px solid gray;" | <br />
<br />
<font size=5>SpeedyBac</font><br>-<br />
''It’s not what you do, It’s not only how you do it. It’s how FAST you can do it!''<br />
*'''<font size=3>Goal</font>:'''<br><br />
Provide a faster assay for studying the combination rules on synthetic biology.<br />
*'''<font size=3>Why do we want to do that?</font><br><br />
There are more and more parts in partsregistry. Every igem teams try to build one or more circuits from partsregistry. But what are the design rules in a big circuit system. We are very interesting what the more detail rules are in the central dogma; especially between the mRNA translations to protein folding. Previously, we know about the circuits we done are work or none by the expression of reporter genes. But now we want to quantitative description of gene expression in both space and time. For the above reasons, we must to be speed up the experiment for researching the more rules. <br><br />
*'''<font size=3>Specific aims:</font>'''<br><br />
**Quantitative description of gene expression in both space and time.<br />
**Specific insight into the flow of genetic information.<br />
**Speedy ways to report and stop gene expression.<br />
*'''<font size=3>Our design:</font>'''<br><br />
For achieve our specific aim, we design a novel reporting assay [[Team:NYMU-Taipei/Project/Speedy reporter|(Speedy reporter)]] for quickly detect and measure the mRNA location and quantity, it can be also use for protein detection. And we design a novel switch [[Team:NYMU-Taipei/Project/Speedy switch|(Speedy switch)]] for control the translation in gene expression. We have also designed a faster degradation system [[Team:NYMU-Taipei/Project/Speedy protein degrader |(Speedy protein degrader)]]; it allows us to regulate the degradation time for study the mRNA without the interference from translation and quickly stop the gene expression.<br><br />
'''The parts our project is made up of''':<br><br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Faster production of protein by inducing the translation of pre-transcribed RNA molecules. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to show promoter activity faster.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA <br />
| style="vertical-align:top;" |<br />
{{:Team:NYMU-Taipei/Our institute}}<br />
{{:Team:NYMU-Taipei/News}}<br />
|}<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/File:NYMU_main_circuit.pngFile:NYMU main circuit.png2010-10-27T14:43:49Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2010.igem.org/File:NYMU_main_circuit_bw.pngFile:NYMU main circuit bw.png2010-10-27T14:43:25Z<p>Blackrabbit: </p>
<hr />
<div></div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/LinksTeam:NYMU-Taipei/Links2010-10-27T11:21:10Z<p>Blackrabbit: </p>
<hr />
<div><html><br />
<style><br />
#nav .left, #nav .right, #nav .both{<br />
border-color: gray;<br />
border-style:solid;<br />
}<br />
#nav .left{<br />
border-width:0px 0px 0px 1px;<br />
}<br />
#nav .right{<br />
border-width:0px 1px 0px 0px;<br />
}<br />
#nav .both{<br />
border-width:0px 1px;<br />
}<br />
#nav td{<br />
width:88px;<br />
text-align:center;<br />
}<br />
#nav a{<br />
display:block;<br />
}<br />
#nav a:hover{<br />
background:gray;<br />
color:white;<br />
text-decoration:none;<br />
}<br />
.navsmall{<br />
display:none;<br />
}<br />
</style><br />
</html><br />
{{:Team:NYMU-Taipei/jQuery}}<br />
{| id="nav" style="border:1px solid gray;width:965px"<br />
| class="right" | [[Team:NYMU-Taipei | Home]]<br />
| class="left" style="width:120px;" | [[Team:NYMU-Taipei/Project| Project Overview:]]<br />
| class="left" | [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
| class="left" | [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
| class="left" style="width:120px;" | [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
| class="both exp" style="width:180px;" | [[Team:NYMU-Taipei/Experiments| Experiments and Parts]]<br />
| class="both" | [[Team:NYMU-Taipei/FAQ| F.A.Q]]<br />
| class="left" | [[Team:NYMU-Taipei/Team | About Us]]<br />
|}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/LinksTeam:NYMU-Taipei/Links2010-10-27T11:11:11Z<p>Blackrabbit: </p>
<hr />
<div><html><br />
<style><br />
#nav .left, #nav .right, #nav .both{<br />
border-color: gray;<br />
border-style:solid;<br />
}<br />
#nav .left{<br />
border-width:0px 0px 0px 1px;<br />
}<br />
#nav .right{<br />
border-width:0px 1px 0px 0px;<br />
}<br />
#nav .both{<br />
border-width:0px 1px;<br />
}<br />
#nav td{<br />
width:88px;<br />
text-align:center;<br />
}<br />
#nav a{<br />
display:block;<br />
}<br />
#nav a:hover{<br />
background:gray;<br />
color:white;<br />
text-decoration:none;<br />
}<br />
.navsmall{<br />
display:none;<br />
}<br />
</style><br />
</html><br />
{{:Team:NYMU-Taipei/jQuery}}<br />
{| id="nav" style="border:1px solid gray;width:965px"<br />
| class="right" | [[Team:NYMU-Taipei | Home]]<br />
| class="left" style="width:120px;" | [[Team:NYMU-Taipei/Project| Project Overview:]]<br />
| class="left" | [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
| class="left" | [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
| class="left" style="width:120px;" | [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
| class="both exp" style="width:180px;" | [[Team:NYMU-Taipei/Experiments| Experiments and Parts]]<br />
| class="both" | [[Team:NYMU-Taipei/FAQ| F.A.Q]]<br />
| class="left" | [[Team:NYMU-Taipei/Team | About Us]]<br />
|}<br />
<br />
<html><div class="menus"></html><br />
{| border=1 class="navsmall exp" style="position:absolute;"<br />
|-<br />
| Experiments<br />
|-<br />
| Parts<br />
|}<br />
<html></div></html><br />
<br />
<html><script><br />
$(document).ready(function(){<br />
$("#nav td").mouseover(function(){<br />
$(this).stop(); <br />
//$(this).animate({fontSize:"400%"},500);<br />
<br />
//animate a submenu if one exists.<br />
menu=$(this).attr("class");<br />
if(menu.indexOf(" ")!=-1) menu=menu.substring(menu.lastIndexOf(" ")+1);<br />
$(".menus ."+menu).stop();<br />
var offset=$(this).offset();<br />
//var offset2=$(".menus ."+menu).offset();<br />
$(".menus ."+menu).offset({left:offset.left});<br />
$(".menus ."+menu).css("background","green");<br />
$(".menus ."+menu).animate({height:200},"slow");<br />
//$(".menus ."+menu).show(50);<br />
//$(".menus ."+menu).slideDown("slow");<br />
});<br />
$("#nav td").mouseout(function(){<br />
$(this).stop();<br />
$(this).animate({fontSize:"100%"},"fast");<br />
//$(".navsmall").stop();<br />
//$(".navsmall").slideUp("slow");<br />
<br />
//animate a submenu if one exists.<br />
menu=$(this).attr("class");<br />
if(menu.indexOf(" ")!=-1) menu=menu.substring(menu.lastIndexOf(" ")+1);<br />
$(".menus ."+menu).stop();<br />
$(".menus ."+menu).css("background","red");<br />
$(".menus ."+menu).animate({height:0},"slow");<br />
//$(".menus ."+menu).slideUp("slow");<br />
//$(".menus ."+menu).hide(50);<br />
});<br />
});<br />
<br />
</script></html></div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/BBaTeam:NYMU-Taipei/BBa2010-10-26T17:31:29Z<p>Blackrabbit: </p>
<hr />
<div>[http://partsregistry.org/Part:BBa_{{{1}}} BBa_{{{1}}}{{{2|}}}]</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporter/Material_and_MethodsTeam:NYMU-Taipei/Project/Speedy reporter/Material and Methods2010-10-26T17:13:24Z<p>Blackrabbit: Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods moved to Team:NYMU-Taipei/Project/Speedy reporter/Materials and Methods</p>
<hr />
<div>#REDIRECT [[Team:NYMU-Taipei/Project/Speedy reporter/Materials and Methods]]</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporter/Materials_and_MethodsTeam:NYMU-Taipei/Project/Speedy reporter/Materials and Methods2010-10-26T17:13:24Z<p>Blackrabbit: Team:NYMU-Taipei/Project/Speedy reporter/Material and Methods moved to Team:NYMU-Taipei/Project/Speedy reporter/Materials and Methods</p>
<hr />
<div>== Fusion Protein ==<br />
We need to fusion protein blah blah blah<br />
<br />
{{:Team:NYMU-Taipei/NStyle}}<br />
<br />
=== GFP ===<br />
<br />
We based splitting GFP ({{:Team:NYMU-Taipei/BBa|E0040}}) based on the split point at 157&158aa used by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715019}} and {{:Team:NYMU-Taipei/BBa|I715020}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715019}}, but the B-part has one base difference from {{:Team:NYMU-Taipei/BBa|I715020}}.<br />
<br />
{{:Team:NYMU-Taipei/Seq|GFP ({{:Team:NYMU-Taipei/BBa|E0040}})|720|<br />
atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggaga<br />
gggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactt<br />
tcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaa<br />
agaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaagg<br />
tattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaaga<br />
atggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgat<br />
ggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttga<br />
gtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa<br />
}}<br />
<br />
{{:Team:NYMU-Taipei/Seq|GFP_A ({{:Team:NYMU-Taipei/BBa|I175019}})|471|<br />
{{:Team:NYMU-Taipei/N|FP|atgcgtaaaggagaagaacttttc}}actggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggaga<br />
gggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactt<br />
tcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaa<br />
agaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaagg<br />
tattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaat{{:Team:NYMU-Taipei/N|RP|gtatacatcatggcagacaaacaa}}<br />
}}<br />
FP (including start codon): atgcgtaaaggagaagaacttttc (55c,24bp,38gc)<br />
RP: ttgtttgtctgccatgatgtatac (55c,24bp,38gc)<br />
<br />
{{:Team:NYMU-Taipei/Seq|GFP_B|249|<br />
{{:Team:NYMU-Taipei/N|FP|aagaatggaatcaaagttaacttcaaaa}}ttagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattg<br />
gcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt<br />
cttgagtttgtaacagctgctgggattaca{{:Team:NYMU-Taipei/N|RP|catggcatggatgaactatacaaa}}taataa<br />
}}<br />
FP: aagaatggaatcaaagttaacttcaaaa (55c,28bp,25gc)<br />
RP (excluding stop codon): tttgtatagttcatccatgccatg (55c,24bp,38gc)<br />
<br />
=== RFP ===<br />
We based splitting RFP ({{:Team:NYMU-Taipei/BBa|E1010}}) based on the split point at 154&155aa used by iGEM07_Davidson_Missouri's {{:Team:NYMU-Taipei/BBa|I715022}} and {{:Team:NYMU-Taipei/BBa|I715023}}. The A-part split is the same as {{:Team:NYMU-Taipei/BBa|I715022}}, but the B-part has one base difference from {{:Team:NYMU-Taipei/BBa|I715023}}.<br />
<br />
{{:Team:NYMU-Taipei/Seq|RFP ({{:Team:NYMU-Taipei/BBa|E1010}})|681|<br />
atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtg<br />
aaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagta<br />
cggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaa<br />
gacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc<br />
cggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaact<br />
gaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggac<br />
atcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa<br />
}}<br />
<br />
{{:Team:NYMU-Taipei/Seq|RFP_A ({{:Team:NYMU-Taipei/BBa|I715022}})|462|<br />
{{:Team:NYMU-Taipei/N|FP|atggcttcctccgaagac}}gttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtg<br />
aaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagta<br />
cggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaa<br />
gacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc<br />
cggttatgcagaaaaaaaccatgggttgggaagcttccaccg{{:Team:NYMU-Taipei/N|RP|aacgtatgtacccggaagac}}<br />
}}<br />
FP (including start codon): atggcttcctccgaagac (55C,18bp,56%)<br />
RP: gtcttccgggtacatacgtt (55C,20bp,50%)<br />
<br />
{{:Team:NYMU-Taipei/Seq|RFP_B|219|<br />
{{:Team:NYMU-Taipei/N|FP|ggtgctctgaaaggtgaaatc}}aaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttc<br />
agctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcg{{:Team:NYMU-Taipei/N|RP|tca<br />
ctccaccggtgct}}taataa<br />
}}<br />
FP: ggtgctctgaaaggtgaaatc (55C,21bp,48%)<br />
RP (excluding stop codon): agcaccggtggagtga (56C,16bp,63%)<br />
<br />
=== eIF4A ===<br />
We split eIF4A ({{:Team:NYMU-Taipei/BBa|K411100}}) at 215&216aa based on [http://igem.ym.edu.tw/pv2010/images/b/be/File:NYMU_Nmeth1023-S5.pdf 2.protocol file from Natalia E. Broude]. But first we needed to mutate the two PstI cutting sites.<br />
<br />
We took the protein coding region from the [http://www.ncbi.nlm.nih.gov/nuccore/NM_144958 eIF4A mRNA transcript sequence from Mouse (from NCBI)] and found it had 2 PstI cutting sites:<br />
<br />
{{:Team:NYMU-Taipei/Seq|eIF4A_original([http://partsregistry.org/Part:BBa_K411100 BBa_K411100])|1173|<br />
atggagccggaaggcgtcatcgagagtaactggaacgagattgtggatagctttgatgacatgaatctctcagagtccctcctccgtggtatttatgcct<br />
atggttttgagaagccctctgccatccagcagcgagctattcttccttgtatcaagggttatgatgtgattgctcaagcccagtctgggactgggaaaac<br />
agctacatttgccatatcaatt{{:Team:NYMU-Taipei/N|cut|ctgcag}}cagattgaattagatctaaaggccactcaggctttggttctggcacccacacgtgaattggctcagcagata<br />
caaaaggtggttatggcattaggagactacatgggtgcctcttgtcatgcctgcattgggggcaccaatgtgcgtgctgaggtgcagaag{{:Team:NYMU-Taipei/N|cut|ctgcag}}atgg<br />
aagctccccatatcatcgtgggtacccctggccgggtgtttgacatgcttaaccggagatacctgtcccccaaatacatcaagatgttcgtactggatga<br />
agcagatgaaatgttaagccgagggttcaaggatcagatctatgacatattccagaagctcaacagcaacacacaggtagttttgttgtctgctacaatg<br />
ccttctgatgtccttgaggtgaccaagaaatttatgagagaccctattcggattcttgtcaagaaggaagaattgaccctggagggtatccgccaattct<br />
acatcaatgtggaacgagaggagtggaagcttgacacattgtgtgacttgtatgagacgctgaccatcacccaggcagtcatctttatcaacaccagaag<br />
gaaggtggactggctcaccgagaagatgcatgcccgagatttcactgtttctgccatgcacggagatatggaccaaaaggaacgagatgtgatcatgagg<br />
gagttccggtctggctctagcagagtattaattaccactgacctgttggccagaggcattgatgtgcagcaggtctccttagtcatcaactatgaccttc<br />
ccaccaacagggaaaactacatccacagaatcggtcgaggtggtcggtttggtcgtaagggtgtggctattaacatggtgaccgaagaagacaagaggac<br />
tcttcgagacattgagactttctacaacacctccattgaagagatgcccctcaacgttgctgacctcatttga<br />
}}<br />
<br />
We need to mutate out the two PstI cutting sites. The template of eIF4A on a [http://genome-www.stanford.edu/vectordb/vector_descrip/COMPLETE/PGEX4T1.SEQ.html pGEX-4TI vector] was kindly provided by <font color="red">C.Proud</font>. We used these primers to mutate the cutting site:<br />
<font color="blue">2 of pstI cutting site</font><br />
mut1(24bp,55C,42%)<br />
FP: ccatatcaatt<font color="red">ctccag</font>cagattga<br />
RP: caatctg<font color="red">ctggag</font>aattgatatggc<br />
mut2(18bp,55C,56%)<br />
FP: gcagaag<font color="red">ctccag</font>atggaa<br />
RP: tccat<font color="red">ctggag</font>cttctgca<br />
<br />
<br />
<br />
The new sequence after mutation:<br />
{{:Team:NYMU-Taipei/Seq|eIF4A ({{:Team:NYMU-Taipei/BBa|K411100}})|1173|<br />
atggagccggaaggcgtcatcgagagtaactggaacgagattgtggatagctttgatgacatgaatctctcagagtccctcctccgtggtatttatgcct<br />
atggttttgagaagccctctgccatccagcagcgagctattcttccttgtatcaagggttatgatgtgattgctcaagcccagtctgggactgggaaaac<br />
agctacatttg{{:Team:NYMU-Taipei/N|OP|ccatatcaatt{{:Team:NYMU-Taipei/N|cutmut|ctccag}}cagattga}}attagatctaaaggccactcaggctttggttctggcacccacacgtgaattggctcagcagata<br />
caaaaggtggttatggcattaggagactacatgggtgcctcttgtcatgcctgcattgggggcaccaatgtgcgtgctgaggt{{:Team:NYMU-Taipei/N|OP|gcagaag{{:Team:NYMU-Taipei/N|cutmut|ctccag}}atgg<br />
aa}}gctccccatatcatcgtgggtacccctggccgggtgtttgacatgcttaaccggagatacctgtcccccaaatacatcaagatgttcgtactggatga<br />
agcagatgaaatgttaagccgagggttcaaggatcagatctatgacatattccagaagctcaacagcaacacacaggtagttttgttgtctgctacaatg<br />
ccttctgatgtccttgaggtgaccaagaaatttatgagagaccctattcggattcttgtcaagaaggaagaattgaccctggagggtatccgccaattct<br />
acatcaatgtggaacgagaggagtggaagcttgacacattgtgtgacttgtatgagacgctgaccatcacccaggcagtcatctttatcaacaccagaag<br />
gaaggtggactggctcaccgagaagatgcatgcccgagatttcactgtttctgccatgcacggagatatggaccaaaaggaacgagatgtgatcatgagg<br />
gagttccggtctggctctagcagagtattaattaccactgacctgttggccagaggcattgatgtgcagcaggtctccttagtcatcaactatgaccttc<br />
ccaccaacagggaaaactacatccacagaatcggtcgaggtggtcggtttggtcgtaagggtgtggctattaacatggtgaccgaagaagacaagaggac<br />
tcttcgagacattgagactttctacaacacctccattgaagagatgcccctcaacgttgctgacctcatttga<br />
}}<br />
<br />
<br />
{{:Team:NYMU-Taipei/Seq|eIF4A_A|645|<br />
{{:Team:NYMU-Taipei/N|FP|atggagccggaaggcgtcatcga}}gagtaactggaacgagattgtggatagctttgatgacatgaatctctcagagtccctcctccgtggtatttatgcct<br />
atggttttgagaagccctctgccatccagcagcgagctattcttccttgtatcaagggttatgatgtgattgctcaagcccagtctgggactgggaaaac<br />
agctacatttgccatatcaattctccagcagattgaattagatctaaaggccactcaggctttggttctggcacccacacgtgaattggctcagcagata<br />
caaaaggtggttatggcattaggagactacatgggtgcctcttgtcatgcctgcattgggggcaccaatgtgcgtgctgaggtgcagaagctccagatgg<br />
aagctccccatatcatcgtgggtacccctggccgggtgtttgacatgcttaaccggagatacctgtcccccaaatacatcaagatgttcgtactggatga<br />
agcagatgaaatgttaagccgagggttcaaggatcagatctatgacatattccagaagctcaacagcaacacacaggtagttttgttgtctgctacaatg<br />
ccttctgatgtccttgaggtga{{:Team:NYMU-Taipei/N|RP|ccaagaaatttatgagagaccct}}<br />
}}<br />
FP: atggagccggaaggcgtcatcga (66c,24bp,61gc) [design error -- was suppose to design it to be 55c]<br />
RP: agggtctctcataaatttcttgg (54C,23bp,39%)<br />
<br />
{{:Team:NYMU-Taipei/Seq|eIF4A_B|528|<br />
{{:Team:NYMU-Taipei/N|FP|attcggattcttgtcaagaagg}}aagaattgaccctggagggtatccgccaattct<br />
acatcaatgtggaacgagaggagtggaagcttgacacattgtgtgacttgtatgagacgctgaccatcacccaggcagtcatctttatcaacaccagaag<br />
gaaggtggactggctcaccgagaagatgcatgcccgagatttcactgtttctgccatgcacggagatatggaccaaaaggaacgagatgtgatcatgagg<br />
gagttccggtctggctctagcagagtattaattaccactgacctgttggccagaggcattgatgtgcagcaggtctccttagtcatcaactatgaccttc<br />
ccaccaacagggaaaactacatccacagaatcggtcgaggtggtcggtttggtcgtaagggtgtggctattaacatggtgaccgaagaagacaagaggac<br />
tcttcgagacattgagactttctacaacacctccattgaagagatgccc{{:Team:NYMU-Taipei/N|RP|ctcaacgttgctgacctcatttga}}<br />
}}<br />
FP: attcggattcttgtcaagaagg (54C,22bp,41%)<br />
RP (including stop codon): tcaaatgaggtcagcaacgttgag (59c,24bp,46gc) [design error -- was suppose to design it to be 55c]<br />
<br />
=== Linker ===<br />
We took the linker from 2.protocol file from Natalia E. Broude:[http://igem.ym.edu.tw/pv2010/images/b/be/File:NYMU_Nmeth1023-S5.pdf ]<br />
<br />
{{:Team:NYMU-Taipei/Seq|linker GSSGSSGSGS|30|<br />
ggcagcagcggcagcagcggcagcggcagc<br />
}}<br />
<br />
<br />
We decided to use primers to create the linker:<br />
cggcagcagcggcagcggcagc<br />
ggcagcagcggcagcagcggcagcggcagc<br />
ggcagcagcggcagcagcggcagc<br />
overlapping region: cggcagcagcggcagc (63c,16bp,81gc)<br />
FP: cggcagcagcggcagcggcagc (22bp)<br />
RP: gctgccgctgctgccgctgctgcc (24bp)<br />
<br />
=== Fusioning it together ===<br />
<br />
==== GFP fusion part ====<br />
(note the extra taa stop codon at the end)<br />
<br />
{{:Team:NYMU-Taipei/Seq|GFP-linker-eIF4A_A ({{:Team:NYMU-Taipei/BBa|K411101}})|1149|<br />
{{:Team:NYMU-Taipei/N|FP|atgcgtaaaggagaagaacttttc}}actggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtg<br />
aaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatgg<br />
tgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc<br />
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatg<br />
gaaacattcttggacacaaattggaatacaactataactcacacaat{{:Team:NYMU-Taipei/N|RP|gtatacatcatggcagacaaacaa}}{{:Team:NYMU-Taipei/N|S|{{:Team:NYMU-Taipei/N|RP|ggcagcag}}{{:Team:NYMU-Taipei/N|OP|cggcagcagcggcagc}}{{:Team:NYMU-Taipei/N|FP|ggcag<br />
c}}}}{{:Team:NYMU-Taipei/N|FP|atggagccggaaggcgtcatcga}}gagtaactggaacgagattgtggatagctttgatgacatgaatctctcagagtccctcctccgtggtatttatgcc<br />
tatggttttgagaagccctctgccatccagcagcgagctattcttccttgtatcaagggttatgatgtgattgctcaagcccagtctgggactgggaaaa<br />
cagctacatttgccatatcaattctccagcagattgaattagatctaaaggccactcaggctttggttctggcacccacacgtgaattggctcagcagat<br />
acaaaaggtggttatggcattaggagactacatgggtgcctcttgtcatgcctgcattgggggcaccaatgtgcgtgctgaggtgcagaagctccagatg<br />
gaagctccccatatcatcgtgggtacccctggccgggtgtttgacatgcttaaccggagatacctgtcccccaaatacatcaagatgttcgtactggatg<br />
aagcagatgaaatgttaagccgagggttcaaggatcagatctatgacatattccagaagctcaacagcaacacacaggtagttttgttgtctgctacaat<br />
gccttctgatgtccttgaggtga{{:Team:NYMU-Taipei/N|RP|ccaagaaatttatgagagacccttga}}<br />
}}<br />
GFP_split_A_FP: gaattcgcggccgcttctagag atgcgtaaaggagaagaacttttc (46bp) OK<br />
GFP_split_A_RP: gctgccgctgctgccgctgctgcc ttgtttgtctgccatgatgtatac (48bp) RE DING<br />
eIF4A_split_A_FP: cggcagcagcggcagcggcagc atggagccggaaggcgtcatcga (45bp) OK<br />
eIF4A_split_A_RP: ctgcagcggccgctactagta tca agggtctctcataaatttcttgg (47bp) OK<br />
<br />
(note that we added as start codon and removed the stop codon of GFP_B)<br />
{{:Team:NYMU-Taipei/Seq|GFP-linker-eIF4A_B ({{:Team:NYMU-Taipei/BBa|K411102}})|804|<br />
{{:Team:NYMU-Taipei/N|FP|atgaagaatggaatcaaagttaacttcaaaa}}ttagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcg<br />
atggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtt<br />
tgtaacagctgctgggattaca{{:Team:NYMU-Taipei/N|RP|catggcatggatgaactatacaaa}}{{:Team:NYMU-Taipei/N|S|{{:Team:NYMU-Taipei/N|RP|ggcagcag}}{{:Team:NYMU-Taipei/N|OP|cggcagcagcggcagc}}{{:Team:NYMU-Taipei/N|FP|ggcagc}}}}{{:Team:NYMU-Taipei/N|FP|attcggattcttgtcaagaagg}}aa<br />
gaattgaccctggagggtatccgccaattctacatcaatgtggaacgagaggagtggaagcttgacacattgtgtgacttgtatgagacgctgaccatca<br />
cccaggcagtcatctttatcaacaccagaaggaaggtggactggctcaccgagaagatgcatgcccgagatttcactgtttctgccatgcacggagatat<br />
ggaccaaaaggaacgagatgtgatcatgagggagttccggtctggctctagcagagtattaattaccactgacctgttggccagaggcattgatgtgcag<br />
caggtctccttagtcatcaactatgaccttcccaccaacagggaaaactacatccacagaatcggtcgaggtggtcggtttggtcgtaagggtgtggcta<br />
ttaacatggtgaccgaagaagacaagaggactcttcgagacattgagactttctacaacacctccattgaagagatgccc{{:Team:NYMU-Taipei/N|RP|ctcaacgttgctgacctcat<br />
ttga}}<br />
}}<br />
GFP_split_B_FP: gaattcgcggccgcttctagag atg aagaatggaatcaaagttaacttcaaaa (53bp)<br />
GFP_split_B_RP: gctgccgctgctgccgctgctgcc tttgtatagttcatccatgccatg (48bp)<br />
eIF4A_split_B_FP: cggcagcagcggcagcggcagc attcggattcttgtcaagaagg (44bp)<br />
eIF4A_split_B_RP: ctgcagcggccgctactagta tcaaatgaggtcagcaacgttgag (45bp)<br />
<br />
==== RFP fusion part ====<br />
(note the extra taa stop codon at the end)<br />
{{:Team:NYMU-Taipei/Seq|RFP-linker-eIF4A_A ({{:Team:NYMU-Taipei/BBa|K411103}})|1140|<br />
{{:Team:NYMU-Taipei/N|FP|atggcttcctccgaagac}}gttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtg<br />
aaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagta<br />
cggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaa<br />
gacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtc<br />
cggttatgcagaaaaaaaccatgggttgggaagcttccaccg{{:Team:NYMU-Taipei/N|RP|aacgtatgtacccggaagac}}{{:Team:NYMU-Taipei/N|S|{{:Team:NYMU-Taipei/N|RP|ggcagcag}}{{:Team:NYMU-Taipei/N|OP|cggcagcagcggcagc}}{{:Team:NYMU-Taipei/N|FP|ggcagc}}}}{{:Team:NYMU-Taipei/N|FP|atggagcc<br />
ggaaggcgtcatcga}}gagtaactggaacgagattgtggatagctttgatgacatgaatctctcagagtccctcctccgtggtatttatgcctatggtttt<br />
gagaagccctctgccatccagcagcgagctattcttccttgtatcaagggttatgatgtgattgctcaagcccagtctgggactgggaaaacagctacat<br />
ttgccatatcaattctccagcagattgaattagatctaaaggccactcaggctttggttctggcacccacacgtgaattggctcagcagatacaaaaggt<br />
ggttatggcattaggagactacatgggtgcctcttgtcatgcctgcattgggggcaccaatgtgcgtgctgaggtgcagaagctccagatggaagctccc<br />
catatcatcgtgggtacccctggccgggtgtttgacatgcttaaccggagatacctgtcccccaaatacatcaagatgttcgtactggatgaagcagatg<br />
aaatgttaagccgagggttcaaggatcagatctatgacatattccagaagctcaacagcaacacacaggtagttttgttgtctgctacaatgccttctga<br />
tgtccttgaggtga{{:Team:NYMU-Taipei/N|RP|ccaagaaatttatgagagacccttga}}<br />
}}<br />
RFP_split_A_FP: gaattcgcggccgcttctag atggcttcctccgaagac (38bp)<br />
RFP_split_A_RP: gctgccgctgctgccgctgctgcc gtcttccgggtacatacgtt (44bp)<br />
eIF4A_split_A_FP and RP are the same as the GFP part above.<br />
<br />
(note that we added as start codon and removed the stop codon of RFP_B)<br />
{{:Team:NYMU-Taipei/Seq|RFP-linker-eIF4A_B ({{:Team:NYMU-Taipei/BBa|K411104}})|774|<br />
{{:Team:NYMU-Taipei/N|FP|atgggtgctctgaaaggtgaaatc}}aaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccgg<br />
ttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcg<br />
{{:Team:NYMU-Taipei/N|RP|tcactccaccggtgct}}{{:Team:NYMU-Taipei/N|S|{{:Team:NYMU-Taipei/N|RP|ggcagcag}}{{:Team:NYMU-Taipei/N|OP|cggcagcagcggcagc}}{{:Team:NYMU-Taipei/N|FP|ggcagc}}}}{{:Team:NYMU-Taipei/N|FP|attcggattcttgtcaagaagg}}aagaattgaccctggagggtatccgccaattc<br />
tacatcaatgtggaacgagaggagtggaagcttgacacattgtgtgacttgtatgagacgctgaccatcacccaggcagtcatctttatcaacaccagaa<br />
ggaaggtggactggctcaccgagaagatgcatgcccgagatttcactgtttctgccatgcacggagatatggaccaaaaggaacgagatgtgatcatgag<br />
ggagttccggtctggctctagcagagtattaattaccactgacctgttggccagaggcattgatgtgcagcaggtctccttagtcatcaactatgacctt<br />
cccaccaacagggaaaactacatccacagaatcggtcgaggtggtcggtttggtcgtaagggtgtggctattaacatggtgaccgaagaagacaagagga<br />
ctcttcgagacattgagactttctacaacacctccattgaagagatgccc{{:Team:NYMU-Taipei/N|RP|ctcaacgttgctgacctcatttga}}<br />
}}<br />
RFP_split_B_FP: gaattcgcggccgcttctag atg ggtgctctgaaaggtgaaatc (44bp)<br />
RFP_split_B_RP: gctgccgctgctgccgctgctgcc agcaccggtggagtga (40bp)<br />
eIF4A_split_B_FP and RP are the same as the GFP part above.<br />
<br />
== Aptamer ==<br />
* Aptamer in front of non-coding sequence:<br />
** [[Image:NYMU Aptamer Structure with bb scars non-coding predicted by RNAfold.png|frame|none|RNAfold prediction of Aptamer Structure with Biobrick scars in front of a non-coding region. The scars bond together, but the overall structure does not change.]]<br />
* Check to see if the addition of the biobrick scars affect the secondary structure in front of coding sequence:<br />
** [[Image:NYMU Aptamer Structure with bb scars coding predicted by RNAfold.png|frame|none|RNAfold prediction of Aptamer Structure with Biobrick scars in front of a coding region. The scars bond together, but the overall structure does not change.]]<br />
* Structure interacting with the split proteins: [[Image:NYMU Aptamer Structure interacting with split protein from Paper.png|frame|none| Aptamer Structure interacting with split protein [6]]]<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/SitemapTeam:NYMU-Taipei/Sitemap2010-10-26T16:50:57Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
* [[Team:NYMU-Taipei|Main Page]]<br />
** [[Team:NYMU-Taipei/Project|Project Overview]]<br />
*** Speedy Reporter: [[Team:NYMU-Taipei/Project/Speedy reporter|Design]], [[Team:NYMU-Taipei/Project/Speedy_reporter/Materials_and_Methods|Materials and methods]], [[Team:NYMU-Taipei/Project/Speedy reporter/Results|Experimental Results]]<br />
*** Speedy switch: [[Team:NYMU-Taipei/Project/Speedy switch|Design, materials and methods]], [[Team:NYMU-Taipei/Project/Speedy switch/Results|Experimental Results]]<br />
*** Speedy protein degrader: [[Team:NYMU-Taipei/Project/Speedy protein degrader|Design, materials and methods]], [[Team:NYMU-Taipei/Project/Speedy protein degrader/Results|Experimental Results]]<br />
** [[Team:NYMU-Taipei/Experiments|Experiments and Parts]]<br />
*** Lab notebooks: [[Team:NYMU-Taipei/Project/Speedy reporter/Experiments|Speedy reporter]], [[Team:NYMU-Taipei/Project/Speedy switch/Experiments|Speedy switch]], [[Team:NYMU-Taipei/Project/Speedy protein degrader/Experiments|Speedy protein degrader]]<br />
*** Experimental Results: [[Team:NYMU-Taipei/Project/Speedy reporter/Results|Speedy reporter]], [[Team:NYMU-Taipei/Project/Speedy switch/Results|Speedy switch]], [[Team:NYMU-Taipei/Project/Speedy protein degrader/Results|Speedy protein degrader]]<br />
*** Protocols: [[Team:NYMU-Taipei/Experiments/Protocols|Basic cloning]], [[Team:NYMU-Taipei/Experiments/Protocols|Gene reporter assay]], [[Team:NYMU-Taipei/Experiments/pSB1C3|pSB1C3 preparation]]<br />
** [[Team:NYMU-Taipei/FAQ|FAQ]]<br />
** [[Team:NYMU-Taipei/Team:NYMU-Taipei/Project#Acknowledgements|Acknowledgements]]<br />
** [[Team:NYMU-Taipei/Safety|Safety]]<br />
** [[Team:NYMU-Taipei/Team|About Us]]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ProjectTeam:NYMU-Taipei/Project2010-10-26T16:50:14Z<p>Blackrabbit: /* Acknowledgements */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
== Project overview by animation ==<br />
== Motivation ==<br />
The Biobrick Parts Registry is beginning to overflow with parts. At last count, there are over 14000 parts in the registry. With this many parts, the registry has made it a very easy to design experiments, but for its complexness it has made it very hard to complete experiments. We design experients, order the parts, receive the parts, and ligate them together, only to find failed results. Even if we follow the correct arrangement of parts (i.e. regulator-RBS-coding sequence-terminator), some parts still don't fit together in a circuit; and we can't tell without spending time finding out through experimentation. <br />
<br />
Yet, the current iGEM trend is to create larger and larger circuits, circuits that have less and less chance of working together. We've seen iGEM teams get more creative with bacteria, with more ideas that can enhance synthetic biology. But it often ends as ideas and designs. Rather than spending time hoping that the parts we want will fit together, we need to find out how parts interact so that we know which parts work with each other. <br />
<br />
Just like we know how IC components work with each other to create a working circuit, we need to find similar design rules in synthetic biology. The lack of these rules creates limitations in the development of synthetic biology. However, another problem arises when we try to find these rules. With current technology, it takes to much to culture cells, much less be able to discover the intricacies of a cell, even one as simple as bacteria<br />
<br />
Current research focuses on using genes as reporters to find out the inner workings of transcription control: “What will happen when a promoter is turned on?” In our case, rather than focusing on transcription, we wish to concentrate on gene expression with regards to space and time. With more detail and information on gene expression, we can explore the interaction between parts in vivo.<br />
<br />
So with these problems in mind, we created '''SpeedyBac'''.<br />
<br />
== Overview ==<br />
For iGEM2010, the NYMU-Taipei team has created a novel assay that speeds up the expression cycle of a gene. We have designed reporting assays that are faster than conventional methods while revealing the amount and location of mRNA. We have also integrated a faster inducible switch which can switch on/off of protein translation. Finally, we build a speedy degradation system for stop the signal from gene expression specificity and quickly. Combined, these allow us to study mRNA quicker, and better, while reducing the interference of protein translation.<br />
<br />
=== Design ===<br />
To achieve our goals, our design can split into three parts:<br />
* [[Team:NYMU-Taipei/Project/Speedy switch | Speedy switch]]<br />
** Faster production of protein by inducing the translation of pre-transcribed RNA molecules. <br />
* [[Team:NYMU-Taipei/Project/Speedy reporter| Speedy reporter]]<br />
** Using mRNA aptamers and split GFP-eIF4A reporter systems to show promoter activity faster.<br />
* [[Team:NYMU-Taipei/Project/Speedy protein degrader | Speedy protein degrader]]<br />
** Fast, specific, and constitutive proteolysis achieved by engineering fluorescent proteins with LVA tags.<br />
<br />
== Acknowledgements ==<br />
[http://www.southampton.ac.uk/biosci/about/staff/cgp1x07.page Dr. Chris Proud], for providing us pGEX-eIF4A for experiment.<br />
<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/ExperimentsTeam:NYMU-Taipei/Experiments2010-10-26T16:47:46Z<p>Blackrabbit: /* Speedy Reporter */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
= Experiments =<br />
Lab notebooks:<br />
* [[Team:NYMU-Taipei/Experiments/Riboswitch|Speedy switch lab notebook]]<br />
* [[mRNA Binding Experiments|Speedy reporter lab notebook]]<br />
** [[speedy reporter protocol]]<br />
* [[SsrA Experiment|Speedy protein degrader lab notebook]]<br />
<br />
'''<font style="background:yellow;">Experimental results</font>''':<br />
* [[Team:NYMU-Taipei/Experiments/Speedy switch#Results|Speedy switch results]]: Several reporter gene assay results for testing the Theophylline riboswitch.<br />
* [[Team:NYMU-Taipei/Experiments/Speedy degrader#Results|Speedy degrader results]]: Several reporter gene assay results for testing the half life of various ssrA tagged and untagged fluorescent proteins.<br />
*<br />
<br />
== Protocols, preparation and other stuff ==<br />
* [[Team:NYMU-Taipei/Experiments/Protocols|Basic cloning protocols]]. Optimised protocols developed and kept current over the past few years.<br />
* [[Team:NYMU-Taipei/Experiments/Protocols#Gene_Reporter_Assay|Gene reporter assay protocols]]<br />
<br />
* [[Team:NYMU-Taipei/Experiments/pSB1C3|pSB1C3 preparation]]<br />
* [[Team:NYMU-Taipei/Experiments/dddddH2O|dddddH2O preparation]] (fun :P)<br />
<br />
= Parts =<br />
The range given to each group for this years' parts was divided as follows:<br />
* Speedy Switch: K411000-K411099<br />
* Speedy Reporter: K411100-K411199<br />
* Speedy Protein degrader: K411200-K411299<br />
<br />
The designed parts:<br />
<groupparts>iGEM010 NYMU-Taipei</groupparts><br />
<br />
<br />
<br />
= Primers =<br />
A list of all the primers we ordered.<br />
<br />
== Speedy Reporter ==<br />
{| border=1<br />
! name || sequence || length || desc<br />
|-<br />
| eIF4A_split_A_Fp || cggcagcagcggcagcggcagcATGGAGCCGGAAGGCGTCATCGA || 45 ||<br />
|-<br />
| eIF4A_split_B_Rp || ctgcagcggccgctactagtaTCAAATGAGGTCAGCAACGTTGAG || 45 ||<br />
|-<br />
| GFP_split_A_FP || gaattcgcggccgcttctagagatgcgtaaaggagaagaacttttc || 46 ||<br />
|-<br />
| GFP_split_B_RP || ctgccgctgctgccgctgctgccttattatttgtatagttcatccatgcca || 51 ||<br />
|-<br />
| GFP_split_A_RP || gctgccgctgctgccgctgctgccttgtttgtctgccatgatgtatac || 48 ||<br />
|-<br />
| GFP_split_B_FP ||gctgccgctgctgccgctgctgcctttgtatagttcatccatgccatg || 48 ||<br />
|-<br />
| aptamer_FP || gcttctagagacactcggaggacagcttagatgcaaagccggagtgagtgtacacc || 56 ||<br />
|-<br />
| aptamer_RP || agcctgcagcggccgctactagtattcccctggcgcggggtgtacactcactccggct || 58 ||<br />
|-<br />
| eIFA_FP || gcttctagATGGAGCCGGAAGGCGTCATCGA || 31 ||<br />
|-<br />
| eIF4A_mut1_FP || ccatatcaattctccagcagattga || 25 ||<br />
|-<br />
| eIF4A_mut1_RP || caatctgctggagaattgatatggc || 25 ||<br />
|-<br />
| eIF4A_mut2_FP || gcagaagctccagatggaa || 19 ||<br />
|-<br />
| eIF4A_mut2_RP || tccatctggagcttctgca || 19 ||<br />
|-<br />
| eIF4A_split_A_Rp || ctgcagcggccgctactagtatcaagggtctctcataaatttcttgg || 47 ||<br />
|-<br />
| eIF4A_split_B_Fp || cggcagcagcggcagcggcagcattcggattcttgtcaagaagg || 44 ||<br />
|-<br />
| RFP_split_A_FP || gaattcgcggccgcttctagatggcttcctccgaagac || 38 ||<br />
|-<br />
| RFP_split_A_RP || gctgccgctgctgccgctgctgccgtcttccgggtacatacgtt || 44 ||<br />
|-<br />
| RFP_split_B_FP || gaattcgcggccgcttctagatgggtgctctgaaaggtgaaatc || 44 ||<br />
|-<br />
| RFP_split_B_RP || gctgccgctgctgccgctgctgccagcaccggtggagtga || 40 ||<br />
|-<br />
| Total || || 773 ||<br />
|}<br />
<br />
== Speedy Switch ==<br />
{| border=1<br />
|-<br />
! name || sequence || length<br />
|-<br />
|Theophylline Riboswitch FP ||gaattcgcggccgcttctagagggtgataccagcatcgtcttgatgcccttggcag||56<br />
|-<br />
|Theophylline Riboswitch RP ||ctgcagcggccgctactagtacttgttgtcttgcagcggggtgctgccaagggcatcaagac||62<br />
|}<br />
<br />
== Speedy Protein Degrader ==<br />
{| border=1<br />
|-<br />
! name || sequence || length || desc<br />
|-<br />
| GFPLVA_out_FP || gcttctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc || 52 ||<br />
|-<br />
| RFPLVA_out_FP || gcttctagagaaagaggagaaatactagatggct || 34<br />
|-<br />
| RFPLVA_in_RP || CTACTAAAGCGTAGTTTTCGTCGTTTGCAGCagcaccggtggagtga || 47<br />
|-<br />
| SspB_FP || gcttctagatgGATTTGTCACAGCTAACAC || 30<br />
|-<br />
| SspB_RP || ctgcagcggccgctactagtattaCTTCACAACGCGTAATGC || 41<br />
|-<br />
| RFP_FP || gcttctagatggcttcctccgaagac || 26<br />
|-<br />
| GFP_FP || gcttctagatgcgtaaaggagaagaacttttc || 32<br />
|-<br />
| xFP_LVA_Remover_FP || gagctgtacaagaggccttaataatactagagccaggcatca || 42 ||<br />
|-<br />
| xFP_LVA_Remover_RP || tgatgcctggctctagtattattaaggcctcttgtacagctc || 42 ||<br />
|-<br />
| Total || || 346 ||<br />
|}<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Experiments/dddddH2OTeam:NYMU-Taipei/Experiments/dddddH2O2010-10-26T16:46:57Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
# Autoclaved an empty 250ml bottle and a jar of 2ml eppendorfs.<br />
# They were then dried in the 56C incubator then left to cool down to room temperature.<br />
# Added dddH2O into the bottle and autoclaved again to form ddddH2O.<br />
# The ddddH2O was then passed through another filter to form dddddH2O and aloquited into the 2ml eppendorfs.<br />
# Stored in a clean bag at -80C.<br />
# When needed to be used, the bag is opened only in the laminar flow.<br />
<br />
Theoretically, it's no cleaner than dddH2O though XD.<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbithttp://2010.igem.org/Team:NYMU-Taipei/Experiments/pSB1C3Team:NYMU-Taipei/Experiments/pSB1C32010-10-26T16:46:32Z<p>Blackrabbit: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
Preparing pSB1C3<br />
<br />
= 2010-09-04 =<br />
* Autoclaved 500ml of LB-Agar (1.2%) and left it in the 56<sup>o</sup>C incubator overnight<br />
<br />
= 2010-09-05 =<br />
* Added chloramphenicol resistance @50mg/ml to the LB-agar and made two stacks of Chr-resistance plates (1:00-1:30pm).<br />
* Transformed [http://partsregistry.org/partsdb/get_part.cgi?part=BBa_J04450 BBa_J04450] on a pSB1C3 plasmid (2009 kit 1 well 5A) onto a Chr-resistant plate (4:15-5:00pm -- waited extra long at the ice step).<br />
** 15uL ddddH<sub>2</sub>0 to get the plasmid out from the biobrick plate.<br />
** used 2uL of plasmid in 20uL DH5&alpha; competent cell for transformation.<br />
** also transformed 2uL of E0240 (on pSB1A2 (amp resistance)) on a chr-resistant plate as a negative control.<br />
<br />
= 2010-09-06 =<br />
* Plate to 4<sup>o</sup>C<br />
* 3-in-1 of the BBa_J04450 plate.<br />
= 2010-09-07 =<br />
* Plasmid extraction of BBa_J04450 then digested with (XP)<br />
* Gel extraction of the pSB1C3 plasmid.<br />
{{:Team:NYMU-Taipei/Footer}}</div>Blackrabbit