User contributions
From 2010.igem.org
(Latest | Earliest) View (newer 500 | older 500) (20 | 50 | 100 | 250 | 500)
- 10:57, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→d) both constructs 2 and 3 enter the cell)
- 10:54, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→d) both constructs 2 and 3 enter the cell)
- 10:53, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→d) both constructs 2 and 3 enter the cell)
- 10:52, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→Construct 1)
- 10:51, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→Construct 1)
- 10:51, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→Jump-or-die-System)
- 10:50, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→Jump-or-die-System)
- 10:49, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→Jump-or-die-System)
- 10:48, 25 October 2010 (diff | hist) N File:Dnajump7.PNG (top)
- 10:48, 25 October 2010 (diff | hist) N File:Dnajump6.PNG (top)
- 10:47, 25 October 2010 (diff | hist) N File:Dnajump5.PNG (top)
- 10:47, 25 October 2010 (diff | hist) N File:Dnajump4.PNG (top)
- 10:47, 25 October 2010 (diff | hist) N File:Dnajump3.PNG (top)
- 10:46, 25 October 2010 (diff | hist) N File:Dnajump2.PNG (top)
- 10:46, 25 October 2010 (diff | hist) N File:Dnajump1.PNG (top)
- 10:31, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 19:13, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→Jump-or-die-System)
- 19:12, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 4: Testing products)
- 19:09, 24 October 2010 (diff | hist) N File:Konstruktcut2.png (top)
- 19:08, 24 October 2010 (diff | hist) N File:Konstruktcut1.png (top)
- 19:07, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Construct 1)
- 19:06, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Construct 1)
- 19:05, 24 October 2010 (diff | hist) N File:Konstruktjump3.PNG (top)
- 19:05, 24 October 2010 (diff | hist) N File:Konstruktjump2.PNG (top)
- 19:05, 24 October 2010 (diff | hist) N File:Konstruktjump1.PNG (top)
- 19:05, 24 October 2010 (diff | hist) N File:Konstruktcut2.PNG (top)
- 19:04, 24 October 2010 (diff | hist) N File:Konstruktcut1.PNG (top)
- 17:50, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenceBB6 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB6== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:45, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenceBB5 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB5== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:44, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenceBB4 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB4== === with forward primer === NNNNNNNNNNNNNNCCTATNNNNNTAGGCGTATCACGAGGCAGAATTTCAGATA AAAAAAATCCTTAGCTTTCGCTAAGGATGNTTTCTGGAATTCG...) (top)
- 17:41, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenceBB3 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB3== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:41, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenceBB2 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB2== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:41, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenceBB1 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB1== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:40, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequence)
- 17:38, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequence)
- 17:37, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 3: Assembling Biobricks)
- 17:29, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
- 17:28, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 3: Assembling Biobricks)
- 17:26, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR8 (→Sequence PCR8) (top)
- 17:23, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR3 (→Sequence PCR3) (top)
- 17:21, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR3 (→Sequence PCR3)
- 17:17, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB11 (→Reverse Primer:) (top)
- 17:17, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB11 (→Forward Primer:)
- 17:16, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB11 (→Reverse Primer:)
- 17:16, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB11 (→Sequence BB11)
- 17:14, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB11 (→Forward Primer:)
- 17:13, 24 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB11 (→Sequence BB11)
- 17:10, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 3: Assembling Biobricks)
- 17:09, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB11 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB11== {{:Team:LMU-Munich/Templates/Page Footer}})
- 17:09, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB12 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB12== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:09, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB10 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB10== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:08, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB9 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB9== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:08, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB8 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB8== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:08, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB7 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB7== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:07, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 3: Assembling Biobricks)
- 17:04, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 3: Assembling Biobricks)
- 16:46, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
- 16:45, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 16:43, 24 October 2010 (diff | hist) N Team:LMU-Munich/Human practice (New page: {{:Team:LMU-Munich/Templates/Page Header}} = Human practice = == Survey == We asked over 200 people of different nationalities on their opinion of synthetic biology. == Results == == Origi...) (top)
- 16:39, 24 October 2010 (diff | hist) Team:LMU-Munich/Team (→What we did)
- 15:26, 24 October 2010 (diff | hist) Team:LMU-Munich/Safety (→Safety)
- 15:24, 24 October 2010 (diff | hist) N File:Safety2.jpg (top)
- 15:22, 24 October 2010 (diff | hist) Team:LMU-Munich/Safety
- 15:21, 24 October 2010 (diff | hist) File:Safety1.jpg (uploaded a new version of "Image:Safety1.jpg") (top)
- 15:11, 24 October 2010 (diff | hist) N File:Safety1.jpg
- 15:09, 24 October 2010 (diff | hist) Team:LMU-Munich/Safety (→Safety)
- 13:32, 22 October 2010 (diff | hist) Team:LMU-Munich
- 13:30, 22 October 2010 (diff | hist) Team:LMU-Munich
- 13:29, 22 October 2010 (diff | hist) Team:LMU-Munich
- 13:24, 22 October 2010 (diff | hist) N File:Ratiolab-Logo II.jpg (top)
- 13:09, 22 October 2010 (diff | hist) Team:LMU-Munich
- 13:05, 22 October 2010 (diff | hist) Team:LMU-Munich
- 13:02, 22 October 2010 (diff | hist) Team:LMU-Munich
- 14:11, 14 October 2010 (diff | hist) Talk:Team:LMU-Munich (top)
- 14:10, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:52, 14 October 2010 (diff | hist) Talk:Team:LMU-Munich
- 13:50, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:49, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:49, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:48, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:46, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:45, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:45, 14 October 2010 (diff | hist) Team:LMU-Munich
- 17:03, 11 October 2010 (diff | hist) Talk:Team:LMU-Munich
- 15:48, 29 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-29-2010)
- 13:08, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:07, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:06, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:04, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:03, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:01, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:00, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 08:59, 24 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-24-2010)
- 15:38, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 14:33, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 14:30, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 14:28, 23 September 2010 (diff | hist) File:23 9 10 2apo.jpg (uploaded a new version of "Image:23 9 10 2apo.jpg") (top)
- 14:24, 23 September 2010 (diff | hist) N File:23 9 10 2apo.jpg
- 14:19, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 14:15, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 14:05, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 13:52, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 09:43, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 09:35, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 09:32, 23 September 2010 (diff | hist) N File:23 9 10 1.jpg (top)
- 09:17, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 08:58, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 08:46, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 08:44, 23 September 2010 (diff | hist) N File:9 22 10 beschriftet.jpg (top)
- 08:44, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 16:00, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 15:57, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 15:54, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 14:46, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 14:23, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 14:06, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 14:05, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 14:04, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 14:03, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 14:01, 22 September 2010 (diff | hist) N File:Fermentas ladder mix.jpg (top)
- 14:01, 22 September 2010 (diff | hist) N File:21 9 10apo2.jpg (top)
- 14:00, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 10:38, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR8 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence PCR8== {{:Team:LMU-Munich/Templates/Page Footer}})
- 10:38, 21 September 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
- 10:37, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
- 10:36, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR10 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence PCR10== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 10:36, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR9 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence PCR9== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 10:35, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR6 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence PCR6== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 10:35, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR5 (top)
- 10:35, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR1 (top)
- 10:34, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR3 (→Sequnce PCR3)
- 10:33, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR3
- 10:32, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR5 (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 10:32, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR3 (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 10:32, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR1 (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 10:30, 21 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/19 leerer link (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 10:16, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/20 PCR with Phusion Hot Start (top)
- 09:57, 21 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/20 PCR with Phusion Hot Start (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==PCR with Phusion Polymerase== Source: Finnzymes/Thermo scientific http://www.finnzymes.fi/pdf/phusion_hs2_datasheet_f549sl_1_2_low.pdf Proto...)
- 09:34, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/22 Ligation (top)
- 09:29, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/22 Ligation
- 09:26, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/22 Ligation
- 09:23, 21 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/22 Ligation (New page: {{:Team:LMU-Munich/Templates/Page Header}} <b>Ligation</b> source: OpenWetWare: http://openwetware.org/wiki/DNA_Ligation Materials Reagents * T4 DNA ligase * 10x T4 DNA Ligase ...)
- 09:12, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/23 LB Medium (top)
- 09:11, 21 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/23 LB Medium (New page: <b>LB Medium</b> For 1 liter Medium: *10g Casein, tryptonic digested *10g NaCl *5g yeast extract if you want to make Agar-plates, add: *10g Agar Fill up to 1 liter with destilled water...)
- 09:06, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook
- 07:54, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-17-2010)
- 16:04, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Pathway
- 16:04, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis
- 15:57, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Pathway (→Contents)
- 15:53, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-01-2010)
- 15:51, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Contents)
- 14:00, 20 September 2010 (diff | hist) N File:20.9.10.jpg (top)
- 13:59, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-20-2010)
- 13:58, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-20-2010)
- 13:42, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-20-2010)
- 13:34, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-20-2010)
- 15:45, 10 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-10-2010)
- 13:37, 9 September 2010 (diff | hist) Team:LMU-Munich/Sponsoring
- 13:31, 9 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-09-2010)
- 13:25, 9 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-09-2010)
- 09:24, 8 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-11-2010)
- 09:14, 8 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-08-2010)
- 09:13, 8 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-08-2010)
- 09:06, 8 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-18-2010)
- 09:05, 8 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 12:41, 7 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-07-2010)
- 11:08, 7 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-07-2010)
- 11:08, 7 September 2010 (diff | hist) N File:7-9-10-1.jpg (top)
- 11:07, 7 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-07-2010)
- 10:12, 7 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-07-2010)
- 16:11, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 14:45, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 14:41, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 14:17, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 09:21, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 09:18, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 09:16, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-03-2010)
- 16:20, 2 September 2010 (diff | hist) N File:9-2-10apo3.jpg (top)
- 16:19, 2 September 2010 (diff | hist) N File:9-2-10apo2.jpg (top)
- 16:16, 2 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-02-2010)
- 14:38, 2 September 2010 (diff | hist) N File:9.1.10apo.pdf (top)
- 14:37, 2 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-01-2010)
- 13:23, 2 September 2010 (diff | hist) N File:9-1-10apo.pdf (top)
- 13:22, 2 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-01-2010)
- 13:09, 2 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-02-2010)
- 13:08, 2 September 2010 (diff | hist) N File:2 9 10 apo.jpg (top)
- 13:07, 2 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-02-2010)
- 12:43, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-01-2010)
- 12:42, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs/Touch down
- 12:41, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs/Touch down
- 12:40, 1 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs/Touch down (New page: PCR program: Touch-Down ::{| |- |95°C |1 min |- |95°C |30 sec |- |56°C |60 sec |- |72°C |30 sec |- |return to step 2 for 2 cycles |- |95°C |30 sec |- |54°C |60 sec |- |72°C |30 sec...)
- 12:34, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs
- 12:26, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs
- 12:25, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs
- 12:25, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs
- 12:21, 1 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 12:20, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 11:58, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/16 PCR with DreamTaq (top)
- 11:58, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/16 PCR with DreamTaq
- 15:46, 31 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-31-2010)
- 09:58, 31 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/15 PCR with Phusion (top)
- 08:09, 31 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/15 PCR with Phusion
- 08:09, 31 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/15 PCR with Phusion
- 08:06, 31 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/15 PCR with Phusion (New page: {{:Team:LMU-Munich/Templates/Page Header}} <b>PCR with Phusion Polymerase</b> Source: Susanne Gebhard In a sterile, nuclease free PCR-tube mix following components: {| |- |Component |V...)
- 08:00, 31 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 13:44, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-30-2010)
- 13:20, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-30-2010)
- 13:16, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 13:16, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 13:14, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-30-2010)
- 11:32, 30 August 2010 (diff | hist) N File:27 8 10 ccdb.jpg (top)
- 11:31, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 11:30, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 11:08, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook
- 11:02, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 11:01, 30 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 11:00, 30 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 10:53, 30 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Construct 2)
- 10:52, 30 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Construct 1)
- 10:51, 30 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 3: Testing products)
- 10:49, 30 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Construct 2)
- 10:47, 30 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Construct 1)
- 09:59, 30 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 3: Testing products)
- 09:57, 30 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 3: Testing products)
- 09:29, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 15:01, 27 August 2010 (diff | hist) Team:LMU-Munich
- 15:00, 27 August 2010 (diff | hist) N File:Fermentas Fisher red.jpg (top)
- 14:58, 27 August 2010 (diff | hist) Team:LMU-Munich
- 14:57, 27 August 2010 (diff | hist) Team:LMU-Munich
- 14:52, 27 August 2010 (diff | hist) N File:Sina logo.JPG (top)
- 14:35, 27 August 2010 (diff | hist) Team:LMU-Munich
- 14:34, 27 August 2010 (diff | hist) Team:LMU-Munich
- 14:33, 27 August 2010 (diff | hist) N File:Genxprologo.JPG (top)
- 14:22, 27 August 2010 (diff | hist) N File:SINA logo.jpg (top)
- 14:17, 27 August 2010 (diff | hist) Team:LMU-Munich
- 14:12, 27 August 2010 (diff | hist) Team:LMU-Munich
- 12:48, 27 August 2010 (diff | hist) Team:LMU-Munich/Schedule/Primer table (top)
- 12:47, 27 August 2010 (diff | hist) N Team:LMU-Munich/Schedule/Primer table (New page: == Primer Table== {| |Number |Oligo Name |Sequence 5' to 3' (include modification codes if applicable) |- |1 |pduA fwd |GCAGAATTCGCGGCCGCTTCTAGAGACTTTAAGAAGGAGATATACATATGCA |- |2 ...)
- 12:46, 27 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 12:42, 27 August 2010 (diff | hist) Primer table (→Primer Table) (top)
- 12:39, 27 August 2010 (diff | hist) N Primer table (New page: == Primer Table== {| |Number |Oligo Name |Sequence 5' to 3' (include modification codes if applicable) |- |1 |pduA fwd |GCAGAATTCGCGGCCGCTTCTAGAGACTTTAAGAAGGAGATATACATATGCA |- |2 |pduU ...)
- 12:30, 27 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 12:24, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 12:23, 27 August 2010 (diff | hist) N File:27-8-10-1.jpg (top)
- 12:11, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 12:08, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 11:56, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 11:38, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-26-2010)
- 11:32, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-26-2010)
- 11:25, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-26-2010)
- 16:19, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 16:15, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 16:09, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 10:11, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 10:08, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 09:59, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/11 Agarose gel electrophoresis (top)
- 09:57, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 09:56, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 09:54, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 09:40, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 09:36, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 09:34, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 09:10, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 09:09, 25 August 2010 (diff | hist) File:24 8 10 apo3.jpg (uploaded a new version of "Image:24 8 10 apo3.jpg") (top)
- 09:06, 25 August 2010 (diff | hist) N File:24 8 10 apo3.jpg
- 07:32, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:22, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:20, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:19, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:16, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:15, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:14, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:13, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:12, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:10, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 14:46, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 13:18, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 12:39, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 12:37, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Pathway (→Contents)
- 12:36, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Contents)
- 12:36, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Contents)
- 12:34, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Contents)
- 10:06, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 18:49, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 18:46, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-20-2010)
- 16:04, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-22-2010)
- 16:04, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-21-2010)
- 16:02, 20 August 2010 (diff | hist) N File:J3.jpg (top)
- 16:02, 20 August 2010 (diff | hist) N File:J2.jpg (top)
- 16:02, 20 August 2010 (diff | hist) N File:J1.jpg (top)
- 16:02, 20 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Assembling Biobricks)
- 16:00, 20 August 2010 (diff | hist) N File:N2.jpg (top)
- 15:59, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Assembling Biobricks)
- 15:58, 20 August 2010 (diff | hist) N File:N1.jpg
- 15:58, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Assembling Biobricks)
- 15:56, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Assembling Biobricks)
- 11:55, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 11:53, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 11:51, 20 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 11:46, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 11:45, 20 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 11:41, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 11:41, 20 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 11:29, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 11:27, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 11:25, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 11:23, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 10:58, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Pathway (→Pathway Notebook)
- 10:56, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Pathway (→Contents)
- 09:59, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-20-2010)
- 09:57, 20 August 2010 (diff | hist) N File:GelverdauPCR3-1.jpg (Gelfoto PCR3-1) (top)
- 09:56, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-20-2010)
- 09:53, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-20-2010)
- 09:43, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 09:38, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-18-2010)
- 08:54, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 08:52, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-17-2010)
- 08:37, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-16-2010)
- 08:24, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-13-2010)
- 08:15, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-12-2010)
- 08:03, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Apoptosis Notebook)
- 07:56, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Apoptosis Notebook)
- 07:51, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Apoptosis Notebook)
- 20:23, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-18-2010)
- 20:21, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-18-2010)
- 20:18, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→d) construct 2 and 3 entered the cell)
- 20:18, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→Construct 3)
- 20:17, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→Construct 2)
- 20:17, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→Construct 1)
- 20:16, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die
- 20:14, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 17:00, 18 August 2010 (diff | hist) N Team:LMU-Munich/Inner BMC (Team:LMU-Munich/Inner BMC moved to Team:LMU-Munich/Outer BMC)
- 17:00, 18 August 2010 (diff | hist) m Team:LMU-Munich/Sequences (Team:LMU-Munich/Inner BMC moved to Team:LMU-Munich/Outer BMC)
- 17:00, 18 August 2010 (diff | hist) N Team:LMU-Munich/Sequences (New page: chnsedoif)
- 16:59, 18 August 2010 (diff | hist) Team:LMU-Munich/Team (→Advisors)
- 14:50, 18 August 2010 (diff | hist) Team:LMU-Munich/Apo Control
- 14:48, 18 August 2010 (diff | hist) Team:LMU-Munich/Apo Control
- 14:44, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 13:37, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 13:34, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Seqences (→Jump-or-Die Sequences)
- 13:33, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences (→Cut'N'survive Sequences)
- 13:32, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-Die/Sequences/SV40 PA (New page: {{:Team:LMU-Munich/Templates/Page Header}} CTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACC TGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACA...) (top)
- 13:32, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-Die/Sequences/CMV Promoter (New page: {{:Team:LMU-Munich/Templates/Page Header}} CGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGCCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTC ATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCC...) (top)
- 13:32, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-Die/Sequences/TRE (Tet-Inducible Promoter (New page: {{:Team:LMU-Munich/Templates/Page Header}} CTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGT GAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCC...) (top)
- 13:31, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-Die/Sequences/eGFP (top)
- 13:31, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-Die/Sequences/eGFP (New page: {{:Team:LMU-Munich/Templates/Page Header}} ATGGTAAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCAT...)
- 13:31, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-Die/Sequences/Human Bak (New page: {{:Team:LMU-Munich/Templates/Page Header}} ATGGCTTCGGGGCAAGGCCCAGGTCCTCCCAGGCAGGAGTGCGGAGAGCCTGCCCTGCCCTCTGCTTCTGAGGAGCAGGT AGCCCAGGACACAGAGGAGGTTTTCCGCAGCTACGTTTTTTACCGCCATCAGCAGGAACAGGA...) (top)
- 13:30, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-Die/Sequences/attP site (New page: {{:Team:LMU-Munich/Templates/Page Header}} CCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGG {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 13:30, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-Die/Sequences/attB site (New page: {{:Team:LMU-Munich/Templates/Page Header}} GGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCG {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 13:30, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-Die/Sequences/phiC31o Integrase (New page: {{:Team:LMU-Munich/Templates/Page Header}} ATGGATACCTACGCCGGAGCCTACGACAGACAGAGCCGGGAGAGAGAGAACAGCAGCGCCGCCAGCCCCGCCACCCAGAG AAGCGCCAACGAGGATAAGGCCGCCGATCTGCAGAGAGAGGTGGAGAGGGACGGCGGCAGATTC...) (top)
- 13:29, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Seqences (→Jump-or-Die Sequences)
- 13:25, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Sequences/SV40 PA (New page: {{:Team:LMU-Munich/Templates/Page Header}} CTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACC TGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACA...) (top)
- 13:24, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Sequences/CMV Promoter (New page: {{:Team:LMU-Munich/Templates/Page Header}} CGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGCCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTC ATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC...) (top)
- 13:23, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Sequences/TRE (Tet-Inducible Promoter (New page: {{:Team:LMU-Munich/Templates/Page Header}} CTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGT GAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCC...) (top)
- 13:23, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Sequences/eGFP (New page: {{:Team:LMU-Munich/Templates/Page Header}} ATGGTAAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCAT...) (top)
- 13:23, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Sequences/Human Bak (New page: {{:Team:LMU-Munich/Templates/Page Header}} ATGGCTTCGGGGCAAGGCCCAGGTCCTCCCAGGCAGGAGTGCGGAGAGCCTGCCCTGCCCTCTGCTTCTGAGGAGCAGGT AGCCCAGGACACAGAGGAGGTTTTCCGCAGCTACGTTTTTTACCGCCATCAGCAGGAACAGGA...) (top)
- 13:23, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Sequences/TEVrecogn+N-Deg+SF3b (New page: {{:Team:LMU-Munich/Templates/Page Header}} ATGGATGAATTGTACAAATCTATTACTTCTTTGTACAAGAAGGCTGGTTCTGAAAACTTGTACTTCCAATTCCACAAGTC TGGTGCTTGGAAGTTGCCAGTTTCTTTGGTTAAGAGAGGGATCGATAAGCTTGATTATAAAGA...) (top)
- 13:22, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Sequences/TEV-Protease-recognition site (New page: {{:Team:LMU-Munich/Templates/Page Header}} GAAAACTTGTACTTCCAATTC {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 13:22, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Sequences/TEV-Protease (New page: {{:Team:LMU-Munich/Templates/Page Header}} ATGGCGATGCAAGCGGCCAAGAGGGCGAACATTCGACTTCCACCTGAAGTAAATCGGATATTGTATATAAGAAATTTGCC ATACAAAATCACAGCTGAAGAAATGTATGATATATTTGGGAAATATGGACCTATTCGTCAAAT...) (top)
- 13:21, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences
- 13:05, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Seqences
- 13:03, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences
- 12:36, 18 August 2010 (diff | hist) N File:TEV14.jpg (TEV degradation) (top)
- 12:34, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle (→Case b) the plasmid has been incorporated)
- 12:33, 18 August 2010 (diff | hist) N File:TEV13.jpg (TEV degradation) (top)
- 12:33, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle (→Case b) the plasmid has been incorporated)
- 12:32, 18 August 2010 (diff | hist) N File:TEV12.jpg (TEV construct 2) (top)
- 12:32, 18 August 2010 (diff | hist) N File:TEV11.jpg (TEV construct 1) (top)
- 12:31, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle (→TEVdegron-System)
- 12:31, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle (→Construct 2)
- 12:30, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle (→Construct 1)
- 12:28, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→d) construct 2 and 3 entered the cell)
- 12:28, 18 August 2010 (diff | hist) N File:Jump14.jpg (Jump recombination) (top)
- 12:26, 18 August 2010 (diff | hist) N File:Jump13.jpg (Jump construct 3) (top)
- 12:25, 18 August 2010 (diff | hist) N File:Jump12.jpg (Jump construct 2) (top)
- 12:10, 18 August 2010 (diff | hist) N File:Jump11.jpg (Jump construct 1) (top)
- 12:09, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle
- 10:00, 18 August 2010 (diff | hist) N File:Jara2.jpg (Portrait Jara) (top)
- 09:56, 18 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 09:55, 18 August 2010 (diff | hist) Team:LMU-Munich/Templates/Apo Navigation
- 09:55, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule
- 09:53, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule
- 09:50, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 09:49, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Seqences (New page: {{:Team:LMU-Munich/Templates/Page Header}} <p>phiC31o Integrase: <html> <a href="http://www.ncbi.nlm.nih.gov/pu...)
- 09:48, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle
- 09:47, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Functional Principle (New page: {{:Team:LMU-Munich/Templates/Page Header}} == Jump-or-die-System == The jump-or-die-system selects the itegration of a gene of interest by apoptosis. Therefore three constructs ae needed....)
- 09:45, 18 August 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 09:45, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Aim 4 (New page: {{:Team:LMU-Munich/Templates/Page Header}} Testing Cut'N'survive System {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 09:44, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Aim 3 (New page: {{:Team:LMU-Munich/Templates/Page Header}} Testing constructs {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 09:43, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Aim 2 (New page: {{:Team:LMU-Munich/Templates/Page Header}} Create and assemble Biobricks {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 09:42, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Aim 1 (New page: {{:Team:LMU-Munich/Templates/Page Header}} Identification, multiplication and extraction of received plasmids. CMV (= CMV-promoter, BBa_J52034) pDS7 (= TEV recogn N Degron SF3b155) Ph...) (top)
- 09:42, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule (New page: {{:Team:LMU-Munich/Templates/Page Header}} Meilensteine Für die Projekte haben wir uns jeweils folgende „Meilensteine“ gesetzt: <p><b>„TEV-System“</b></p> 1. Verknüpfen von Bak...)
- 09:41, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences
- 09:41, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Sequences (New page: {{:Team:LMU-Munich/Templates/Page Header}} <p>TEV-Protease+p14* <html> <a href ="http://www.ncbi.nlm.nih.gov/pubmed?term...)
- 09:40, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Functional Principle (New page: {{:Team:LMU-Munich/Templates/Page Header}} == TEVdegron-System == The TEVdegron-System uses and combines several proteins with different properties to select the incorporation of a plasm...)
- 09:38, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive (New page: {{:Team:LMU-Munich/Templates/Page Header}} TEV-System The TEV-System contains of two multi-protein-complexes. The DNA of the first one that you can see below shall integrate into the geno...)
- 09:36, 18 August 2010 (diff | hist) Team:LMU-Munich/Templates/Apo Navigation
- 18:25, 17 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Schedule/Aim 3 (top)
- 18:22, 17 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Schedule/Aim 2 (top)
- 18:20, 17 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Schedule/Aim 1 (top)
- 18:06, 17 August 2010 (diff | hist) N Talk:Team:LMU-Munich/TEV-System/Schedule/Aim 1 (New page: save alte version == Lab-Notebook == This notebook is used to structure our work and progress == DNA-multiplication == It is necessary to increase the amount of DNA we have got in orde...) (top)
- 14:03, 16 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/9 Handling primers (New page: {{:Team:LMU-Munich/Templates/Page Header}} == Handling Primers == source: Alexander Buschle Handling of primers received: - Short spin the primers - Add autoclaved, sterile, distille...) (top)
- 14:01, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 10:29, 16 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle (→Selection) (top)
- 10:22, 16 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle (→Construct 2)
- 10:19, 16 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle (→Construct 1)
- 10:16, 16 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle (→TEVdegron-System)
- 09:59, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-14-2010)
- 09:11, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-14-2010)
- 21:17, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 21:17, 15 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 21:15, 15 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 21:14, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 21:06, 15 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 20:40, 15 August 2010 (diff | hist) N File:Tresch.jpg (Portrait Achim Tresch) (top)
- 20:39, 15 August 2010 (diff | hist) N File:Mascher.jpg (Portrait Thorsten Mascher) (top)
- 20:38, 15 August 2010 (diff | hist) N File:Jung.jpg (Portrait Kirsten Jung) (top)
- 20:37, 15 August 2010 (diff | hist) N File:Böttger.jpg (Portrait Angelika Böttger) (top)
- 20:33, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:58, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:57, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:57, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:57, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:56, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:56, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:55, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:53, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:52, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:51, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:50, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 19:49, 15 August 2010 (diff | hist) N File:LMU-Munich team.png (LMU-Munich group picture) (top)
- 19:38, 15 August 2010 (diff | hist) N Talk:Team:LMU-Munich/TEV-System/Functional Principle (New page: old text: If one has the Cellline which is stable transformed with TetinduciblePromoter+TEVrecognition+Ndegron+SF3B+bak one can transform these cells with the Construct containing the Prot...) (top)
- 19:38, 15 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle
- 19:37, 15 August 2010 (diff | hist) N File:TEV4.jpg (TEVdegron-System: functional principle) (top)
- 19:36, 15 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle
- 19:19, 15 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle
- 19:11, 15 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle
- 18:37, 15 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle
- 18:34, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 18:31, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 18:29, 15 August 2010 (diff | hist) Team:LMU-Munich/Team
- 18:24, 15 August 2010 (diff | hist) N File:Jump3.jpg (Jump-and-Stop construct 3) (top)
- 18:24, 15 August 2010 (diff | hist) N File:Jump2.jpg (Jump-and-Stop construct 2) (top)
- 18:23, 15 August 2010 (diff | hist) N File:Jump1.jpg (Jump-and-Stop Construct 1) (top)
- 18:23, 15 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Functional Principle (top)
- 18:22, 15 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle
- 18:22, 15 August 2010 (diff | hist) N File:TEV2.jpg (top)
- 18:21, 15 August 2010 (diff | hist) N File:TEV1.jpg (TEV Construct 1) (top)
- 18:21, 15 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle
- 18:06, 15 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle
- 18:06, 15 August 2010 (diff | hist) File:Jara1.jpg (uploaded a new version of "Image:Jara1.jpg": Portrait Jara) (top)
- 17:53, 15 August 2010 (diff | hist) N User:Jara (New page: {{:Team:LMU-Munich/Templates/Page Header}} see my profile at the teampage: Jara Radeck {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:49, 15 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle
- 17:48, 15 August 2010 (diff | hist) N File:Jara1.jpg (Portrait Jara)
- 17:35, 15 August 2010 (diff | hist) N Team:LMU-Munich/Team/Jara (New page: {{:Team:LMU-Munich/Templates/Page Header}} Jara Radeck ==Contact Info== *Jara Radeck *Ludwig Maximilians University (LMU) ==Education== * 2011 (expected) BS...) (top)
- 17:30, 15 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 17:29, 15 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 10:54, 13 August 2010 (diff | hist) N Team:LMU-Munich/Functional Principle (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 10:53, 13 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation
- 14:36, 12 August 2010 (diff | hist) Team:LMU-Munich/Apo Control
- 17:44, 11 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/5 Restriction digest (top)
- 17:38, 11 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/5 Restriction digest (New page: {{:Team:LMU-Munich/Templates/Page Header}} Restrictionsdigest (Source: http://www.promega.com/enotes/applications/ap0078.htm, http://openwetware.org/wiki/Engineering_BioBrick_vectors_fr...)
- 17:34, 11 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/4 Plasmid extraction from cells (New page: {{:Team:LMU-Munich/Templates/Page Header}} Plasmid extraction from cells (using the promega kit) (Source: http://www.promega.com/tbs/tb374/tb374.pdf) 4.A. Centrifugation Protocol The f...)
- 17:31, 11 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/3 Transformation (top)
- 17:31, 11 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/3 Transformation (New page: {{:Team:LMU-Munich/Templates/Page Header}} Transformation (Source: http://openwetware.org/wiki/Transforming_chemically_competent_cells) 1. Thaw TSS cells on ice. 2. Add DNA, pipette ...)
- 17:29, 11 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/2 Highly competent cells (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 17:28, 11 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/1 Competent cells (top)
- 17:27, 11 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/1 Competent cells
- 17:26, 11 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/1 Competent cells
- 17:23, 11 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/1 Competent cells (New page: {{:Team:LMU-Munich/Templates/Page Header}} Produce Competent Cells(Source: http://openwetware.org/wiki/Preparing_chemically_competent_cells, http://openwetware.org/wiki/TSS) Very Importa...)
- 17:01, 11 August 2010 (diff | hist) Team:LMU-Munich/Notebook
- 20:03, 10 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Schedule/Aim 1
- 19:41, 10 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Schedule/Aim 1
- 18:29, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Functional Principle
- 18:22, 6 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/eGFP (top)
- 18:21, 6 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/Human Bak (top)
- 18:21, 6 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/attP site (top)
- 18:20, 6 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/attB site (top)
- 18:20, 6 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/phiC31o Integrase (top)
- 18:19, 6 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/SV40 PA (top)
- 18:18, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences/SV40 PA (top)
- 18:18, 6 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/CMV Promoter (top)
- 18:17, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences/CMV Promoter (top)
- 18:17, 6 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/TRE (Tet-Inducible Promoter (top)
- 18:17, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences/TRE (Tet-Inducible Promoter (top)
- 18:15, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences/eGFP (top)
- 18:14, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences/Human Bak (top)
- 18:13, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences/TEVrecogn+N-Deg+SF3b (top)
- 18:12, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences/TEV-Protease-recognition site (top)
- 18:11, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences/TEV-Protease (top)
- 18:10, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences
- 18:08, 6 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Seqences
- 18:08, 6 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences
- 18:07, 6 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Seqences
- 18:07, 6 August 2010 (diff | hist) N Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/SV40 PA (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 18:07, 6 August 2010 (diff | hist) N Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/CMV Promoter (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 18:06, 6 August 2010 (diff | hist) N Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/TRE (Tet-Inducible Promoter (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 18:06, 6 August 2010 (diff | hist) N Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/eGFP (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 18:06, 6 August 2010 (diff | hist) N Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/Human Bak (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 18:06, 6 August 2010 (diff | hist) N Team:LMU-Munich/Jump-In-Variety/Genomic Map/Sequences/attP site (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
(Latest | Earliest) View (newer 500 | older 500) (20 | 50 | 100 | 250 | 500)