User contributions
From 2010.igem.org
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)
- 17:09, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB10 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB10== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:08, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB9 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB9== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:08, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB8 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB8== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:08, 24 October 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzBB7 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence BB7== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 17:07, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 3: Assembling Biobricks)
- 17:04, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 3: Assembling Biobricks)
- 16:46, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
- 16:45, 24 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 16:43, 24 October 2010 (diff | hist) N Team:LMU-Munich/Human practice (New page: {{:Team:LMU-Munich/Templates/Page Header}} = Human practice = == Survey == We asked over 200 people of different nationalities on their opinion of synthetic biology. == Results == == Origi...) (top)
- 16:39, 24 October 2010 (diff | hist) Team:LMU-Munich/Team (→What we did)
- 15:26, 24 October 2010 (diff | hist) Team:LMU-Munich/Safety (→Safety)
- 15:24, 24 October 2010 (diff | hist) N File:Safety2.jpg (top)
- 15:22, 24 October 2010 (diff | hist) Team:LMU-Munich/Safety
- 15:21, 24 October 2010 (diff | hist) File:Safety1.jpg (uploaded a new version of "Image:Safety1.jpg") (top)
- 15:11, 24 October 2010 (diff | hist) N File:Safety1.jpg
- 15:09, 24 October 2010 (diff | hist) Team:LMU-Munich/Safety (→Safety)
- 13:32, 22 October 2010 (diff | hist) Team:LMU-Munich
- 13:30, 22 October 2010 (diff | hist) Team:LMU-Munich
- 13:29, 22 October 2010 (diff | hist) Team:LMU-Munich
- 13:24, 22 October 2010 (diff | hist) N File:Ratiolab-Logo II.jpg (top)
- 13:09, 22 October 2010 (diff | hist) Team:LMU-Munich
- 13:05, 22 October 2010 (diff | hist) Team:LMU-Munich
- 13:02, 22 October 2010 (diff | hist) Team:LMU-Munich
- 14:11, 14 October 2010 (diff | hist) Talk:Team:LMU-Munich (top)
- 14:10, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:52, 14 October 2010 (diff | hist) Talk:Team:LMU-Munich
- 13:50, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:49, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:49, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:48, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:46, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:45, 14 October 2010 (diff | hist) Team:LMU-Munich
- 13:45, 14 October 2010 (diff | hist) Team:LMU-Munich
- 17:03, 11 October 2010 (diff | hist) Talk:Team:LMU-Munich
- 15:48, 29 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-29-2010)
- 13:08, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:07, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:06, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:04, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:03, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:01, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 13:00, 29 September 2010 (diff | hist) Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery
- 08:59, 24 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-24-2010)
- 15:38, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 14:33, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 14:30, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 14:28, 23 September 2010 (diff | hist) File:23 9 10 2apo.jpg (uploaded a new version of "Image:23 9 10 2apo.jpg") (top)
- 14:24, 23 September 2010 (diff | hist) N File:23 9 10 2apo.jpg
- 14:19, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 14:15, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 14:05, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 13:52, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 09:43, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 09:35, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 09:32, 23 September 2010 (diff | hist) N File:23 9 10 1.jpg (top)
- 09:17, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 08:58, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-23-2010)
- 08:46, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 08:44, 23 September 2010 (diff | hist) N File:9 22 10 beschriftet.jpg (top)
- 08:44, 23 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 16:00, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 15:57, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 15:54, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 14:46, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 14:23, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-22-2010)
- 14:06, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 14:05, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 14:04, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 14:03, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 14:01, 22 September 2010 (diff | hist) N File:Fermentas ladder mix.jpg (top)
- 14:01, 22 September 2010 (diff | hist) N File:21 9 10apo2.jpg (top)
- 14:00, 22 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 10:38, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR8 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence PCR8== {{:Team:LMU-Munich/Templates/Page Footer}})
- 10:38, 21 September 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
- 10:37, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
- 10:36, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR10 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence PCR10== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 10:36, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR9 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence PCR9== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 10:35, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR6 (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==Sequence PCR6== {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 10:35, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR5 (top)
- 10:35, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR1 (top)
- 10:34, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR3 (→Sequnce PCR3)
- 10:33, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR3
- 10:32, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR5 (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 10:32, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR3 (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 10:32, 21 September 2010 (diff | hist) N Team:LMU-Munich/Jump-or-die/Schedule/SequenzPCR1 (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 10:30, 21 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/19 leerer link (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 10:16, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/20 PCR with Phusion Hot Start (top)
- 09:57, 21 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/20 PCR with Phusion Hot Start (New page: {{:Team:LMU-Munich/Templates/Page Header}} ==PCR with Phusion Polymerase== Source: Finnzymes/Thermo scientific http://www.finnzymes.fi/pdf/phusion_hs2_datasheet_f549sl_1_2_low.pdf Proto...)
- 09:34, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/22 Ligation (top)
- 09:29, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/22 Ligation
- 09:26, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/22 Ligation
- 09:23, 21 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/22 Ligation (New page: {{:Team:LMU-Munich/Templates/Page Header}} <b>Ligation</b> source: OpenWetWare: http://openwetware.org/wiki/DNA_Ligation Materials Reagents * T4 DNA ligase * 10x T4 DNA Ligase ...)
- 09:12, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/23 LB Medium (top)
- 09:11, 21 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/23 LB Medium (New page: <b>LB Medium</b> For 1 liter Medium: *10g Casein, tryptonic digested *10g NaCl *5g yeast extract if you want to make Agar-plates, add: *10g Agar Fill up to 1 liter with destilled water...)
- 09:06, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook
- 07:54, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-17-2010)
- 16:04, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Pathway
- 16:04, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis
- 15:57, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Pathway (→Contents)
- 15:53, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-01-2010)
- 15:51, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Contents)
- 14:00, 20 September 2010 (diff | hist) N File:20.9.10.jpg (top)
- 13:59, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-20-2010)
- 13:58, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-20-2010)
- 13:42, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-20-2010)
- 13:34, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-20-2010)
- 15:45, 10 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-10-2010)
- 13:37, 9 September 2010 (diff | hist) Team:LMU-Munich/Sponsoring
- 13:31, 9 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-09-2010)
- 13:25, 9 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-09-2010)
- 09:24, 8 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-11-2010)
- 09:14, 8 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-08-2010)
- 09:13, 8 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-08-2010)
- 09:06, 8 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-18-2010)
- 09:05, 8 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 12:41, 7 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-07-2010)
- 11:08, 7 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-07-2010)
- 11:08, 7 September 2010 (diff | hist) N File:7-9-10-1.jpg (top)
- 11:07, 7 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-07-2010)
- 10:12, 7 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-07-2010)
- 16:11, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 14:45, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 14:41, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 14:17, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 09:21, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 09:18, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-06-2010)
- 09:16, 6 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-03-2010)
- 16:20, 2 September 2010 (diff | hist) N File:9-2-10apo3.jpg (top)
- 16:19, 2 September 2010 (diff | hist) N File:9-2-10apo2.jpg (top)
- 16:16, 2 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-02-2010)
- 14:38, 2 September 2010 (diff | hist) N File:9.1.10apo.pdf (top)
- 14:37, 2 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-01-2010)
- 13:23, 2 September 2010 (diff | hist) N File:9-1-10apo.pdf (top)
- 13:22, 2 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-01-2010)
- 13:09, 2 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-02-2010)
- 13:08, 2 September 2010 (diff | hist) N File:2 9 10 apo.jpg (top)
- 13:07, 2 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-02-2010)
- 12:43, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-01-2010)
- 12:42, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs/Touch down
- 12:41, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs/Touch down
- 12:40, 1 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs/Touch down (New page: PCR program: Touch-Down ::{| |- |95°C |1 min |- |95°C |30 sec |- |56°C |60 sec |- |72°C |30 sec |- |return to step 2 for 2 cycles |- |95°C |30 sec |- |54°C |60 sec |- |72°C |30 sec...)
- 12:34, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs
- 12:26, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs
- 12:25, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs
- 12:25, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs
- 12:21, 1 September 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/17 Special thermal cycler programs (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 12:20, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 11:58, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/16 PCR with DreamTaq (top)
- 11:58, 1 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/16 PCR with DreamTaq
- 15:46, 31 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-31-2010)
- 09:58, 31 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/15 PCR with Phusion (top)
- 08:09, 31 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/15 PCR with Phusion
- 08:09, 31 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/15 PCR with Phusion
- 08:06, 31 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/15 PCR with Phusion (New page: {{:Team:LMU-Munich/Templates/Page Header}} <b>PCR with Phusion Polymerase</b> Source: Susanne Gebhard In a sterile, nuclease free PCR-tube mix following components: {| |- |Component |V...)
- 08:00, 31 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 13:44, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-30-2010)
- 13:20, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-30-2010)
- 13:16, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 13:16, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 13:14, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-30-2010)
- 11:32, 30 August 2010 (diff | hist) N File:27 8 10 ccdb.jpg (top)
- 11:31, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 11:30, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 11:08, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook
- 11:02, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 11:01, 30 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 11:00, 30 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 10:53, 30 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Construct 2)
- 10:52, 30 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Construct 1)
- 10:51, 30 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 3: Testing products)
- 10:49, 30 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Construct 2)
- 10:47, 30 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Construct 1)
- 09:59, 30 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 3: Testing products)
- 09:57, 30 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 3: Testing products)
- 09:29, 30 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 15:01, 27 August 2010 (diff | hist) Team:LMU-Munich
- 15:00, 27 August 2010 (diff | hist) N File:Fermentas Fisher red.jpg (top)
- 14:58, 27 August 2010 (diff | hist) Team:LMU-Munich
- 14:57, 27 August 2010 (diff | hist) Team:LMU-Munich
- 14:52, 27 August 2010 (diff | hist) N File:Sina logo.JPG (top)
- 14:35, 27 August 2010 (diff | hist) Team:LMU-Munich
- 14:34, 27 August 2010 (diff | hist) Team:LMU-Munich
- 14:33, 27 August 2010 (diff | hist) N File:Genxprologo.JPG (top)
- 14:22, 27 August 2010 (diff | hist) N File:SINA logo.jpg (top)
- 14:17, 27 August 2010 (diff | hist) Team:LMU-Munich
- 14:12, 27 August 2010 (diff | hist) Team:LMU-Munich
- 12:48, 27 August 2010 (diff | hist) Team:LMU-Munich/Schedule/Primer table (top)
- 12:47, 27 August 2010 (diff | hist) N Team:LMU-Munich/Schedule/Primer table (New page: == Primer Table== {| |Number |Oligo Name |Sequence 5' to 3' (include modification codes if applicable) |- |1 |pduA fwd |GCAGAATTCGCGGCCGCTTCTAGAGACTTTAAGAAGGAGATATACATATGCA |- |2 ...)
- 12:46, 27 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 12:42, 27 August 2010 (diff | hist) Primer table (→Primer Table) (top)
- 12:39, 27 August 2010 (diff | hist) N Primer table (New page: == Primer Table== {| |Number |Oligo Name |Sequence 5' to 3' (include modification codes if applicable) |- |1 |pduA fwd |GCAGAATTCGCGGCCGCTTCTAGAGACTTTAAGAAGGAGATATACATATGCA |- |2 |pduU ...)
- 12:30, 27 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 12:24, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 12:23, 27 August 2010 (diff | hist) N File:27-8-10-1.jpg (top)
- 12:11, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 12:08, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 11:56, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-27-2010)
- 11:38, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-26-2010)
- 11:32, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-26-2010)
- 11:25, 27 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-26-2010)
- 16:19, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 16:15, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 16:09, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 10:11, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 10:08, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 09:59, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/11 Agarose gel electrophoresis (top)
- 09:57, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 09:56, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 09:54, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 09:40, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-25-2010)
- 09:36, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 09:34, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 09:10, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 09:09, 25 August 2010 (diff | hist) File:24 8 10 apo3.jpg (uploaded a new version of "Image:24 8 10 apo3.jpg") (top)
- 09:06, 25 August 2010 (diff | hist) N File:24 8 10 apo3.jpg
- 07:32, 25 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:22, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:20, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:19, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:16, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:15, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:14, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:13, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:12, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 15:10, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 14:46, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 13:18, 24 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 12:39, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 12:37, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Pathway (→Contents)
- 12:36, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Contents)
- 12:36, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Contents)
- 12:34, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→Contents)
- 10:06, 23 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 18:49, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-23-2010)
- 18:46, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-20-2010)
- 16:04, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-22-2010)
- 16:04, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-21-2010)
- 16:02, 20 August 2010 (diff | hist) N File:J3.jpg (top)
- 16:02, 20 August 2010 (diff | hist) N File:J2.jpg (top)
- 16:02, 20 August 2010 (diff | hist) N File:J1.jpg (top)
- 16:02, 20 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Assembling Biobricks)
- 16:00, 20 August 2010 (diff | hist) N File:N2.jpg (top)
- 15:59, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Assembling Biobricks)
- 15:58, 20 August 2010 (diff | hist) N File:N1.jpg
- 15:58, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Assembling Biobricks)
- 15:56, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Assembling Biobricks)
- 11:55, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 11:53, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 11:51, 20 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 11:46, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
(Latest | Earliest) View (newer 250 | older 250) (20 | 50 | 100 | 250 | 500)