http://2010.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=500&target=V225522&year=&month=2010.igem.org - User contributions [en]2024-03-29T09:14:19ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-28T02:22:23Z<p>V225522: /* Repoting Assay 4 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: (Harbaugh S.V., 2008)<br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the normalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM Theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|thumb|none|800px|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|thumb|none|800px|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|thumb|none|800px|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|thumb|none|800px|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|thumb|none|800px|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|thumb|none|800px|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
* When the concentration of Theophylline is in the range 0.01mM to 2mM, the concentration of Theophylline and the resulting fluorescence (using the {{:Team:NYMU-Taipei/BBa|K411003}} construct) are directly proportional. As a result, we recommend the Theophylline riboswitch ({{:Team:NYMU-Taipei/BBa|K411001}}) to be used in that range to control the downstream translation.<br />
<br />
* The study by Suess ''et al'', adding more than 5mM of Theophylline would cause ''E. coli'' to die (Suess, 2004). In our experiments, we find that after adding more than 4mM, the Theophylline spectrum curve would be invalid. As a result, we do not recommend doing experiments with concentrations over 4mM as the ''E. coli'' cell would be unstable or the regulation of the riboswitch would not be accurate. <br />
<br />
* Our figures show that the sample fluorescence will disperse clearly after 80 minutes. As a result, we suggest that the protein expression of the downstream coding sequence will be more obvious after about 200 minutes of adding Theophylline.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
*Harbaugh S.V., Davidson M.E., Chushak Y.G., Kelley-Loughnane N., and Stone M.O.(2008) Riboswitch-based sensor in low optical background. Proc. of SPIE 7040, 70400C <br />
<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-28T02:21:38Z<p>V225522: /* Reporting Assay 3 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: (Harbaugh S.V., 2008)<br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the normalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM Theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|thumb|none|800px|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|thumb|none|800px|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|thumb|none|800px|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|thumb|none|800px|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
* When the concentration of Theophylline is in the range 0.01mM to 2mM, the concentration of Theophylline and the resulting fluorescence (using the {{:Team:NYMU-Taipei/BBa|K411003}} construct) are directly proportional. As a result, we recommend the Theophylline riboswitch ({{:Team:NYMU-Taipei/BBa|K411001}}) to be used in that range to control the downstream translation.<br />
<br />
* The study by Suess ''et al'', adding more than 5mM of Theophylline would cause ''E. coli'' to die (Suess, 2004). In our experiments, we find that after adding more than 4mM, the Theophylline spectrum curve would be invalid. As a result, we do not recommend doing experiments with concentrations over 4mM as the ''E. coli'' cell would be unstable or the regulation of the riboswitch would not be accurate. <br />
<br />
* Our figures show that the sample fluorescence will disperse clearly after 80 minutes. As a result, we suggest that the protein expression of the downstream coding sequence will be more obvious after about 200 minutes of adding Theophylline.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
*Harbaugh S.V., Davidson M.E., Chushak Y.G., Kelley-Loughnane N., and Stone M.O.(2008) Riboswitch-based sensor in low optical background. Proc. of SPIE 7040, 70400C <br />
<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-28T02:20:00Z<p>V225522: /* Reporting Assay 2 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: (Harbaugh S.V., 2008)<br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the normalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM Theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|thumb|none|800px|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|thumb|none|800px|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
* When the concentration of Theophylline is in the range 0.01mM to 2mM, the concentration of Theophylline and the resulting fluorescence (using the {{:Team:NYMU-Taipei/BBa|K411003}} construct) are directly proportional. As a result, we recommend the Theophylline riboswitch ({{:Team:NYMU-Taipei/BBa|K411001}}) to be used in that range to control the downstream translation.<br />
<br />
* The study by Suess ''et al'', adding more than 5mM of Theophylline would cause ''E. coli'' to die (Suess, 2004). In our experiments, we find that after adding more than 4mM, the Theophylline spectrum curve would be invalid. As a result, we do not recommend doing experiments with concentrations over 4mM as the ''E. coli'' cell would be unstable or the regulation of the riboswitch would not be accurate. <br />
<br />
* Our figures show that the sample fluorescence will disperse clearly after 80 minutes. As a result, we suggest that the protein expression of the downstream coding sequence will be more obvious after about 200 minutes of adding Theophylline.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
*Harbaugh S.V., Davidson M.E., Chushak Y.G., Kelley-Loughnane N., and Stone M.O.(2008) Riboswitch-based sensor in low optical background. Proc. of SPIE 7040, 70400C <br />
<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-28T01:23:06Z<p>V225522: /* Reporting Assay 1 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: (Harbaugh S.V., 2008)<br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the normalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM Theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
* When the concentration of Theophylline is in the range 0.01mM to 2mM, the concentration of Theophylline and the resulting fluorescence (using the {{:Team:NYMU-Taipei/BBa|K411003}} construct) are directly proportional. As a result, we recommend the Theophylline riboswitch ({{:Team:NYMU-Taipei/BBa|K411001}}) to be used in that range to control the downstream translation.<br />
<br />
* The study by Suess ''et al'', adding more than 5mM of Theophylline would cause ''E. coli'' to die (Suess, 2004). In our experiments, we find that after adding more than 4mM, the Theophylline spectrum curve would be invalid. As a result, we do not recommend doing experiments with concentrations over 4mM as the ''E. coli'' cell would be unstable or the regulation of the riboswitch would not be accurate. <br />
<br />
* Our figures show that the sample fluorescence will disperse clearly after 80 minutes. As a result, we suggest that the protein expression of the downstream coding sequence will be more obvious after about 200 minutes of adding Theophylline.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
*Harbaugh S.V., Davidson M.E., Chushak Y.G., Kelley-Loughnane N., and Stone M.O.(2008) Riboswitch-based sensor in low optical background. Proc. of SPIE 7040, 70400C <br />
<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-28T01:17:25Z<p>V225522: /* Method */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: (Harbaugh S.V., 2008)<br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the normalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
* When the concentration of Theophylline is in the range 0.01mM to 2mM, the concentration of Theophylline and the resulting fluorescence (using the {{:Team:NYMU-Taipei/BBa|K411003}} construct) are directly proportional. As a result, we recommend the Theophylline riboswitch ({{:Team:NYMU-Taipei/BBa|K411001}}) to be used in that range to control the downstream translation.<br />
<br />
* The study by Suess ''et al'', adding more than 5mM of Theophylline would cause ''E. coli'' to die (Suess, 2004). In our experiments, we find that after adding more than 4mM, the Theophylline spectrum curve would be invalid. As a result, we do not recommend doing experiments with concentrations over 4mM as the ''E. coli'' cell would be unstable or the regulation of the riboswitch would not be accurate. <br />
<br />
* Our figures show that the sample fluorescence will disperse clearly after 80 minutes. As a result, we suggest that the protein expression of the downstream coding sequence will be more obvious after about 200 minutes of adding Theophylline.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
*Harbaugh S.V., Davidson M.E., Chushak Y.G., Kelley-Loughnane N., and Stone M.O.(2008) Riboswitch-based sensor in low optical background. Proc. of SPIE 7040, 70400C <br />
<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-28T01:16:42Z<p>V225522: /* Reference */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the normalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
* When the concentration of Theophylline is in the range 0.01mM to 2mM, the concentration of Theophylline and the resulting fluorescence (using the {{:Team:NYMU-Taipei/BBa|K411003}} construct) are directly proportional. As a result, we recommend the Theophylline riboswitch ({{:Team:NYMU-Taipei/BBa|K411001}}) to be used in that range to control the downstream translation.<br />
<br />
* The study by Suess ''et al'', adding more than 5mM of Theophylline would cause ''E. coli'' to die (Suess, 2004). In our experiments, we find that after adding more than 4mM, the Theophylline spectrum curve would be invalid. As a result, we do not recommend doing experiments with concentrations over 4mM as the ''E. coli'' cell would be unstable or the regulation of the riboswitch would not be accurate. <br />
<br />
* Our figures show that the sample fluorescence will disperse clearly after 80 minutes. As a result, we suggest that the protein expression of the downstream coding sequence will be more obvious after about 200 minutes of adding Theophylline.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
*Harbaugh S.V., Davidson M.E., Chushak Y.G., Kelley-Loughnane N., and Stone M.O.(2008) Riboswitch-based sensor in low optical background. Proc. of SPIE 7040, 70400C <br />
<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-28T00:24:09Z<p>V225522: /* Method */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the normalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
*We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
*According to the author Beatrix '' etal'',the paper said that after added more than 5mM Theophylline the ''Escherichia coli'' would die (Beatrix,2004). And in our reasearch, we find that about adding 4 mM Theophylline the spectrum curve would be invalid. As a result, we suggest that the ''Escherichia coli'' cell or the regulation of Riboswitch would be unstable. <br />
*According to our figures, we find that the sample fluorescence will disperse clearly after 80 minutes. As a result, we suggest that the protein expression will be more obvious about 200 minutes after adding Theophylline.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/RiboswitchTeam:NYMU-Taipei/Experiments/Riboswitch2010-10-27T23:56:15Z<p>V225522: /* 2010.10.22 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=Parts=<br />
*Ribo = Theophylline riboswitch([http://partsregistry.org/Part:BBa_K411001 BBa_K411001])<br />
*RV = Theophylline riboswitch([http://partsregistry.org/Part:BBa_K411001 BBa_K411001]) + pSB1A2<br />
*FRV = Theophylline riboswitch + GFP([http://partsregistry.org/Part:BBa_J04630 BBa_J04630]) + pSB1A2<br />
*PFRV = Theophylline riboswitch + GFP([http://partsregistry.org/Part:BBa_J04630 BBa_J04630]) + pLac([http://partsregistry.org/Part:BBa_R0010 BBa_R0010]) + pSB1A2<br />
<br />
=2010.08.17 =<br />
*PCR of primer&Digestion&Ligation<br />
{| border="1" cellspacing="1" cellpadding="2" <br />
! [[Image:NYMU Ribo.jpg|250px]]<br />
| colspan=2 |<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: marker 100bp|||n|=<br />
|2: -|-|-|n|=<br />
|3: riboswitch |56 bp|none|f|=<br />
|4: riboswitch |56 bp|none|f|=<br />
|5: -|-|-|n|=<br />
|6: riboswitch |56 bp|none|f|=<br />
|7: riboswitch |56 bp|none|f|=<br />
|8: -|-|-|n|=<br />
|9: riboswitch |56 bp|none|f|=<br />
|10: riboswitch |56 bp|none|f|=<br />
|11: Positive Control|1100 bp|none|w|=<br />
|12: Negative Control||Contamination ~300bp |w|=<br />
|}} <br />
{| border=1<br />
|'''PCR mix'''for 3 tubes(25+25+50)<br />
|'''''total 50 &mu;l''''' <br />
|'''temp'''<br />
|'''time'''<br />
|-<br />
|template || 1&mu;l || 94oC ||120s<br />
|-<br />
|forward primer || 1&mu;1 || 94oC ||30s<br />
|-<br />
|reverse primer || 1&mu;1 || 55oC || 30s<br />
|-<br />
|dNTP || 4&mu;1 || 72oC ||40s<br />
|-<br />
|10x buffer || 5&mu;l ||72oC||300s<br />
|-<br />
|ddH2O || 39.75&mu;l<br />
|-<br />
|pfu || 0.5&mu;1<br />
|}<br />
|}<br />
<br />
*Plasmid extraction<br />
*Digestion<br />
*PCR purification(centrifuge)<br />
*Nanodrop<br />
*Ligation<br />
*Transform 20:00<br />
<br />
=2010.08.18 =<br />
*PCR mix<br />
*Run gel(2%argarose 100v)<br />
{| border="1" cellspacing="1" cellpadding="2" <br />
![[Image:NYMU_CIMG1185.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: marker 100bp|||n|=<br />
|2: th-ribo gene + vector|294bp|-|f|=<br />
|3: th-ribo gene + vector|294bp|-|f|=<br />
|4: -|-|-|n|=<br />
|5: Positive Control|1100 bp|none|w|=<br />
|6: Negative Control||Contamination ~3000bp|w|=<br />
|}} <br />
{| border=1<br />
| Total:(*2) || 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
(negative contaminated and appeared three different bands)<br />
*3-in-1 11:30<br />
*Run PCR 12:00<br />
*put Liquid culture&plate at 17:00<br />
<br />
=2010.08.19=<br />
*Because there are some mistake resulting from gel running, we decided to digest again.<br />
**Digest 10:30<br />
**Transformation 12:45<br />
<br />
*At the same time, we continued plasmid extraction of the result one of yesterday.<br />
**plasmid extraction 10:30<br />
**Digest 11:30<br />
**run gel 13:00<br />
**Ligation 14:00<br />
**Transformation 14:30<br />
<br />
=2010.08.20=<br />
*We decide to re-3-in-1 again.<br />
*PCR mix 10:30<br />
*3 in 1 11:30<br />
*Run PCR 01:00~02:30<br />
*Run gel 15:00(100v 20 mins)<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU R20.JPG]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: marker 100bp|||n|=<br />
|2: ribo+vector|294bp||f|=<br />
|3: ribo+vector|294bp||f|=<br />
|4: -|-|-|n|=<br />
|5: Positive Control|1100 bp|none|w|=<br />
|6: Negative Control|||w|=<br />
|}} <br />
{| border=1<br />
| Total:(*2) || 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
*Cut gel 16:30<br />
*Plasmid extraction 16:30<br />
<br />
=2010.08.23=<br />
*the upper experiment are failed, so we restart the experiment.<br />
**Run gel 11:00<br />
**After nanodrop, we found that the concentration is too low(only 3.0), so we re-PCR-of-primer again.<br />
<br />
*PCR of primer 16:00<br />
*Transformation(GFP) 17:15<br />
<br />
=2010.08.24=<br />
*Run gel 10:30am(5ul)<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU R24.JPG]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: |||n|=<br />
|2: marker 100bp|||n|=<br />
|3: |||n|=<br />
|4: pcr riboswitch|56bp||f|=<br />
|5: |||n|=<br />
|6: Positive Control||300bp|w|=<br />
|7: Negative Control|||w|=<br />
|}} <br />
{| border=1<br />
| Total:(*2) || 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
*PCR Purify 10:45(45ul)<br />
*Digest 11:15<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1<br />
|-<br />
! Total: !! 30&mu;l<br />
|-<br />
| DNA || 26&mu;l<br />
|-<br />
| Digestion buffer || 2&mu;l<br />
|-<br />
| Enzyme 1(X) || 1&mu;l<br />
|-<br />
| Enzyme 2(P) || 1&mu;l<br />
|}<br />
*Digest purify 13:30<br />
*Nanodrop(19.8ng/ul)<br />
*Ligation 15:44<br />
**Ligate riboswitch+pSB1A2(1:3) and ligate GFP+pSB1A2(1:2)(we use 2009's GFP+terminater so we have to ligate pSB1A2)<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1<br />
|-<br />
! Total: !! 10&mu;l<br />
|-<br />
| DNA of vector || 1&mu;l<br />
|-<br />
| DNA of insert || 3&mu;l<br />
|-<br />
| buffer || 2&mu;l<br />
|-<br />
| ligase || 0.5&mu;l<br />
|-<br />
| ddH2O || 4.5&mu;l<br />
|}<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1<br />
|-<br />
! Total: !! 10&mu;l<br />
|-<br />
| DNA of vector || 1&mu;l<br />
|-<br />
| DNA of insert || 2&mu;l<br />
|-<br />
| buffer || 2&mu;l<br />
|-<br />
| ligase || 0.5&mu;l<br />
|-<br />
| ddH2O || 5.5&mu;l<br />
|}<br />
<br />
=2010.08.25=<br />
*3-in-1:GFP(1 colony),Riboswitch(2 colony) 17:00pm<br />
*Run PCR 17:20pm<br />
<br />
=2010.08.26=<br />
*Run gel 10:30am<br />
**Because we thought the result is unsure,we decide to digest to check. <br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU R26-2.JPG]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: GFP|720bp||f|=<br />
|2: (1)riboswitch+pSB1A2|294bp||f|=<br />
|3: (2)riboswitch+pSB1A2|294bp||f|=<br />
|4: Positive Control|1100bp||w|=<br />
|5: Negative Control|Contamination~1000 bp||w|=<br />
|6: Marker:100bp|||n|=<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.25&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
*Liquid culture 12:00<br />
**the first step when we added MX1 we didn't resuspend,so we readded MX1~MX3.But the DNA may be less.<br />
*digest <br />
**[GFP(XP),ribo1(SP,XP>>use 10 ul and 20ul protocal),ribo2(SP,XP>>use 10 ul and use 20ul protocal)]<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1<br />
|-<br />
! Total: !! 10&mu;l<br />
|-<br />
| DNA of vector(sp) || 1&mu;l<br />
|-<br />
| DNA of insert(xp) || 3&mu;l<br />
|-<br />
| buffer || 2&mu;l<br />
|-<br />
| ligase || 0.5&mu;l<br />
|-<br />
| ddH2O || 4.5&mu;l<br />
|}<br />
{|<br />
|-<br />
|<br />
*run gel(xp)<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU R26.JPG]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: ribo1|96bp||f|=<br />
|2: |||n|=<br />
|3: ribo2|96bp||f|=<br />
|4: |||n|=<br />
|5: Marker:100bp|||n|=<br />
|6: GFP|854bp||f|=<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
*purify(ribo-1(sp);ribo-2(sp);GFP(xp))<br />
*ligate<br />
*transform<br />
*liquid culture from the plate(8/24)<br />
<br />
=2010.08.27=<br />
*PCR mix 10:30<br />
**GFP+terminator+Riboswitch=1157bp<br />
*3 in 1 12:15<br />
*Run PCR 12:30~13:30<br />
*Run gel 13:45<br />
--------------------------------------------------------------------------<br />
*Liquid culture again(use the plate 8/24) 10:30<br />
**To check the wrong step of liquid culture<br />
*Digestion 13:40<br />
*Run gel 01:45pm[GFP(XP).Riboswitch-1(XP).Riboswitch-2(XP)]<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU R27.JPG]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1:FRV |1158bp|294bp|f|=<br />
|2: FRV|1158bp|294bp|f|=<br />
|3: 100bp marker|-|-|n|=<br />
|4: FRV|1158bp|294bp|f|=<br />
<br />
|5: positive control|1100bp| |w|=<br />
|6: Negative Control|-|Contamination ~300bp|w|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
=2010.08.28=<br />
*3-IN-1 (another 3 colony from 08.26 Riboswitch+GFP-Terminator plate) 13:30<br />
**PCR (Use new dNTP & Taq buffer & taq) 14:30 <br />
**Run Gel 16:20<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010273.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: FRV|1158bp|294bp|f|=<br />
|2: FRV|1158bp|294bp|f|=<br />
|3: FRV|1158bp|294bp|f|=<br />
|4: positive control|1100bp|-|w|=<br />
|5: marker100 bp|-|-|n|=<br />
|6: negative control|-|-|w|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l ||temp||time<br />
|-<br />
| template || 2&mu;l ||94<sup>o</sup>C||60s<br />
|-<br />
| VF+VR || 2&mu;l||94<sup>o</sup>C||15s<br />
|-<br />
| dNTP || 2&mu;l||55<sup>o</sup>C||20s<br />
|-<br />
| Buffer || 5&mu;l||72<sup>o</sup>C||100s<br />
|-<br />
| ddH2O || 39.75&mu;l||72<sup>o</sup>C||300s<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
*Transformation GFP+vector 17:00<br />
*3-IN-1 (2 Colony from the plate transformed on 08/27) 17:20<br />
** PCR 18:25~19:40<br />
<br />
=2010.08.29=<br />
*Run Gel (with green marker) at 11:00 <br />
**Ribo Vac1 and Ribo Vac2 from PCR on 8/28 at 18:25~19:40 <br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010274.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: -|-|-|n|=<br />
|2: -|-|-|n|=<br />
|3: RV1|294bp|1100bp|f|=<br />
|4: marker100 bp|-|-|n|=<br />
|5: RV2|294bp|-|f|=<br />
|6: positive control|1100bp|-|w|=<br />
|7: negative control|-|-|w|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l|<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
______________________________________________________________________________________________________________<br />
*3-in-1 (3 colonies of GFP+TERMINATOR and 1 of Riboswitch+PSB1A2 vector, both from plates transformed on 8/28)<br />
**PCR 11:00~12:50<br />
**Run Gel 15:30 (result shows no band!! but positive and negative controls are correct)<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010276.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: GFP1|854bp||f|=<br />
|2: GFP2|854bp||f|=<br />
|3: GFP3|854bp||f|=<br />
|4: marker100 bp|-|-|n|=<br />
|5: riboswitch+vector|294bp|-|f|=<br />
|6: negative control|-|-|w|=<br />
|7: positive contril|1100bp|-|w|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
*transform 16:30 <br />
** (1)the Ribo2 from 8.17 (2)the Ribo (check) from 08/19 (3)GFP+terminator from 08/27<br />
***put into incubator 17:30<br />
<br />
=2010.08.30=<br />
*3-in-1: GFP,GFP+riboswitch,ribo-1,ribo-2 12:30pm<br />
*Run PCR 13:20<br />
*Run gel(2% argarose 100v)<br />
|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010277.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: GFP1|854bp|-|f|=<br />
|2: GFP2|854bp|-|f|=<br />
|3: GFP3|854bp|-|f|=<br />
|4: riboswitch1+GFP|1158bp|-|f|=<br />
|5: riboswitch2+GFP|1158bp|-|f|=<br />
|6: riboswitch3+GFP|1158bp|-|f|=<br />
|7: marker100 bp|-|-|n|=<br />
|8: ribo1+vector|294bp|-|f|=<br />
|9: ribo1+vector|294bp|-|f|=<br />
|10: ribo2+vector|294bp|-|f|=<br />
|11: ribo2+vector|294bp|-|f|=<br />
|12: positive control|1100bp|-|w|=<br />
|13: negative control|-|-|w|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l|<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
*Finally we Transform 19F(GFP+terminator), E0040 18:50<br />
<br />
=2010.08.31=<br />
*3-in-1 (ribo(xp)+pSB1A2,E0040,J04630)11:00<br />
*Nanodrop<br />
*Ligation<br />
|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010280.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: GFP1(J04630)|854bp|-|f|=<br />
|2: GFP2(J04630)|854bp|-|f|=<br />
|3: Riboswitch1+vector|294bp|-|f|=<br />
|4: Riboswitch+2vector|294bp|-|f|=<br />
|5: marker 100 bp|-|-|n|=<br />
|6: GFP1(E0040)|720bp|-|f|=<br />
|7: GFP2(E0040)|720bp|-|f|=<br />
|8: ribo1+vector|294bp|-|f|=<br />
|9: ribo1+vector|294bp|-|f|=<br />
|10: ribo2+vector|294bp|-|f|=<br />
|11: ribo2+vector|294bp|-|f|=<br />
|12: positive control|1100bp|-|w|=<br />
|13: negative control|-|-|w|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l|<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
{| border="1" cellspacing="1" cellpadding="2" <br />
![[Image:NYMU P9010281.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: GFP+terminator(19f)|854bp|-|f|=<br />
|2: GFP(E0040)|720bp|-|f|=<br />
|3: GFP(E0040)|720bp|-|f|=<br />
|4: marker 100bp|-|-|n|=<br />
|5: Positive Control|1100 bp||w|=<br />
|6: Negative Control|||w|=<br />
|}} <br />
|}<br />
<br />
=2010.09.01=<br />
*GFP*3 Plasmid Extraction 10:30<br />
*Digestion 12:30 (13:20)<br />
*Run gel 15:30<br />
{| border=1|-<br />
![[Image:NYMU P9070330.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: -|-|-|n|=<br />
|2: -|-|-|n|=<br />
|3: marker 100bp|-|-|n|=<br />
|4: -|-|-|n|=<br />
|5: (GFP)E0040-2|745bp||f|=<br />
|6: (GFP)E0040-1|745bp||f|=<br />
|7: (GFP)J04630|856bp||f|=<br />
<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.25&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
------------------------------------<br />
*RG1,RG2,RG3,PR1,PR2,PR3 3-in-1 10:00<br />
*Colony PCR 11:00~13:00<br />
*Run Gel <br />
<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010283.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: PFRV(1-a)|1158bp|294bp|f|=<br />
|2: PFRV(1-b)|1158bp|294bp|f|=<br />
|3: PFRV(2-a)|1158bp|294bp|f|=<br />
|4: PFRV(2-b)|1158bp|294bp|f|=<br />
|5: PFRV(3-a)|1158bp|294bp|f|=<br />
|6: PFRV(3-b)|1158bp|294bp|f|=<br />
|7: -|-|-|<br />
|8: marker 100bp|-|-|n|=<br />
|9: PFRV|1366bp|-|f|=<br />
|10: PFRV|1366bp|-|f|=<br />
|11: PFRV|1366bp|-|f|<br />
|12: PFRV|1366bp|-|f|=<br />
|13: PFRV|1366bp|-|f|=<br />
|14: PFRV|1366bp|-|f|=<br />
|15: positive control|1100bp||w|=<br />
|16: negative control|-|containment|w|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l ||temp||time<br />
|-<br />
| template || 2&mu;l ||94||60s<br />
|-<br />
| VF+VR || 2&mu;l||94||15s<br />
|-<br />
| dNTP || 2&mu;l||55||20s<br />
|-<br />
| Buffer || 5&mu;l||72||90s<br />
|-<br />
| ddH2O || 39.75&mu;l||72||300s<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
=2010.09.02=<br />
*Liquid culture plasmid extraction 10:00<br />
*Nanodrop<br />
*Digestion 12:12<br />
*Purification<br />
*Nanodrop<br />
*Ligation<br />
*Transform 17:00<br />
=2010.09.03=<br />
*3-in-1 chose 4 colony<br />
*PCR 11.20 <br />
*run gel<br />
{| border=1|-<br />
![[Image:NYMU P9070329.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: FRV1|1158bp|294bp|f|=<br />
|2: FRV2|1158bp|294bp|f|=<br />
|3: marker 1kb|-|-|n|=<br />
|4: FRV3|1158bp|-|f|=<br />
|5: FRV4|1158bp|294bp|f|=<br />
|6: positive control|1100bp||w|=<br />
|7: negative control||-|w|=<br />
<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
(the marker takes the wrong one,1kb marker is correct)<br />
**ligation failed<br />
*ligate again(insert+vector=8.5)<br />
*transform 16:40<br />
<br />
=2010.09.04=<br />
*PCR 20:35pm (3 colony from 20100903 plate)<br />
*run gel(FRV1&2&3&+&-) 100V 35min<br />
{| border=1|-<br />
![[Image:NYMU P9070327.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: FRV1|1158bp|294bp|f|=<br />
|2: FRV2|1158bp|294bp|f|=<br />
|3: marker 100bp |-|-|n|=<br />
|4: FRV3|1158bp|294bp|f|=<br />
|5: positive control|1000bp|-|w|=<br />
|6: negative control|-|-|w|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
*discuss<br />
<br />
=2010.09.05=<br />
*digest again(because we used XP's protocol for SP)<br />
*purification at 14:25 <br />
*nanodrop at 15:00<br />
**we digest another tube (ribo2-2 SP) 15:50<br />
*ligation <br />
*transform 17:00<br />
=2010.09.06=<br />
*Colony PCR 11:30<br />
*Run gel 14:30(2% argarose 100v 25 mins)<br />
|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU_DSC05719.JPG|250px]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: positive control|1100bp|-|w|=<br />
|2: negative control|-|-|w|=<br />
|3: 100bp marker|-|-|f|=<br />
|4: FRV|1158bp|1700bp|f|=<br />
|5: FRV|1158bp|1700bp|f|=<br />
<br />
|<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 1&mu;l <br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
-----------------------------------------<br />
*Take out the digest(sp)yesterday 10:30<br />
*digest purify<br />
*nanodrop(13.2ng/nl)<br />
*ligate 11:40~14:30<br />
*transform 17:00<br />
<br />
=2010.09.07=<br />
*3-in-1 10:30am<br />
*Run PCR 10:45am<br />
|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU_DSC05720.JPG|250px]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: FRV|1158bp|-|f|=<br />
|2: FRV|1158bp|-|f|=<br />
|3: FRV|1158bp|-|f|=<br />
|4: FRV|1158bp|-|f|=<br />
|5: 100bp marker|-|-|n|=<br />
|6: FRV|1158bp|-|f|=<br />
|7: FRV|1158bp|294bp|f|=<br />
|8: positive control|1100bp|-|w|=<br />
|9: negative control|-|-|w|=<br />
|<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l|<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
=2010.09.08=<br />
*plasmid extraction<br />
*digestion(FRV1(XP)) 11:10<br />
**nanodrop 14&mu;l<br />
*ligation 14:00<br />
*Transformation 17:00<br />
=2010.09.09=<br />
<br />
*Real PCR<br />
<br />
{| border=1|-<br />
![[Image:NYMU_R9.JPG|250px]] !!<br />
<br />
<br />
{| border="1"<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| FP+RP || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| pfu || 0.25&mu;l<br />
|}<br />
{| border="2"<br />
|-<br />
| Temp || Time<br />
|-<br />
| 94 || 60s<br />
|-<br />
| 94 || 15s<br />
|-<br />
| 50.8 ||20s<br />
|-<br />
| 74 || 45s<br />
|-<br />
| 74 || 300s<br />
|}<br />
|}<br />
<br />
=2010.09.10=<br />
*real PCR (temperature test) <br />
*run gel<br />
<br />
{| border=1|-<br />
![[Image:NYMU_DSC05722.JPG|250px]] !!<br />
<br />
<br />
{| border="1"<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| FP+RP || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| pfu || 0.25&mu;l<br />
|}<br />
{| border="2"<br />
|-<br />
| Temp || Time<br />
|-<br />
| 94 || 60s<br />
|-<br />
| 94 || 15s<br />
|-<br />
| 50.8 ||20s<br />
|-<br />
| 74 || 45s<br />
|-<br />
| 74 || 300s<br />
|}<br />
|}<br />
*cut gel<br />
<br />
*gel extraction<br />
*digest(xp)<br />
*nanodrop<br />
*ligate<br />
*transform<br />
------------------------<br />
*real pcr for 2 tubes(in suitable temperature)<br />
{| border=1|-<br />
![[Image:NYMU_DSC05723.JPG|250px]] !!<br />
<br />
<br />
{| border="1"<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| FP+RP || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| pfu || 0.25&mu;l<br />
|}<br />
{| border="2"<br />
|-<br />
| Temp || Time<br />
|-<br />
| 94 || 60s<br />
|-<br />
| 94 || 15s<br />
|-<br />
| 50.8 ||20s<br />
|-<br />
| 74 || 45s<br />
|-<br />
| 74 || 300s<br />
|}<br />
|}<br />
<br />
=2010.09.11=<br />
*3in1<br />
------------------------<br />
*two real tubes run gel and cut gel and gel extraction<br />
[[Image:NYMU_DSC05725.JPG|250px]]<br />
<br />
=2010.09.12=<br />
*run gel(length isn't correct)<br />
[[Image:NYMU_DSC05726.JPG|250px]]<br />
*(real PCR) digestion 12:00<br />
*ligation 15:00<br />
*transform 19:40<br />
<br />
=2010.09.13=<br />
*colony PCR 13:25 (3 in 1)<br />
{| border=1|-<br />
![[Image:NYMU_DSC05728.JPG|250px]] !!<br />
<br />
<br />
{| border="1"<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VR+VF || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| tag || 0.25&mu;l<br />
|}<br />
{| border="2"<br />
|-<br />
| Temp || Time<br />
|-<br />
| 94 || 60s<br />
|-<br />
| 94 || 15s<br />
|-<br />
| 55 ||20s<br />
|-<br />
| 72 || 30s ||30 cycle<br />
|-<br />
| 72 || 300s<br />
|}<br />
|}<br />
----------------------<br />
*nanodrop<br />
*ligation 14:00<br />
*Colony PCR 15:00<br />
<br />
=2010.09.22 =<br />
*Real PCR<br />
{| border=1|-<br />
![[Image: DSC05680.JPG|250px ]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.7 || <br />
|-<br />
| FP || 1&mu;l || 1.7&mu;l || Theophylline Riboswitch Forward Primer <br />
|-<br />
| RP || 1&mu;l || 1.7&mu;l || Theophylline Riboswitch Reverse Primer <br />
|-<br />
| dNTP || 2&mu;l || 3.4&mu;l || <br />
|-<br />
| 10XBuff. || 5&mu;l || 8.5&mu;l || <br />
|-<br />
| pfu || 0.25&mu;l || 0.425&mu;l || <br />
|-<br />
| ddH2O || 39.75&mu;l || 67.575&mu;l || <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 52<br />
| 20s<br />
|- <br />
| 68 <br />
| 30s<br />
| 35 cycles<br />
|-<br />
| 68<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
<br />
*Digest ribo(xp) overnight<br />
*Ligate ribo with vector(xp)<br />
*Transform:23:30<br />
<br />
=2010.09.23=<br />
*Ligate ribo with vector again<br />
*Transform<br />
=2010.09.24=<br />
*3-in-1 (ribo+vector)<br />
*colony PCR<br />
{| border=1|-<br />
![[Image: DSC05682.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.9<br />
|-<br />
| VR+VF|| 2&mu;l || 3.8&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.8&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 9.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.475&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 75.525&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
-----------------------<br />
*Cut gel(ribo&pSB1A2(xp) digested)<br />
[[Image:DSC05683.JPG|100px]]<br />
[[Image:DSC05684.JPG|100px]]<br />
<br />
=2010.09.26=<br />
*3-in-1(0925 plate)<br />
*colony PCR<br />
{| border=1|-<br />
![[Image:DSC05682.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.5 <br />
|-<br />
| VR+VF|| 2&mu;l || 5&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 5&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 1.25&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 99.375&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
=2010.09.27=<br />
*plasmid extraction(RV)<br />
*Digest RV 13:30<br />
*run gel<br />
[[Image:IMG_3189.JPG|250px]]<br />
<br />
There is GFP on vector, so it's wrong.<br />
*Digest ribo again overnight<br />
<br />
=2010.09.28=<br />
*cut gel(ribo& vector)<br />
[[Image:DSC05689.JPG|250px]]<br />
*Ligate ribo with vector<br />
*Transform<br />
According to 0927 gel pic, 30th colony may be correct RV, so we take out second plate and incubate in LB liguid.<br />
*plasmid extraction 21:30<br />
*Digest RV(SP) overnight<br />
<br />
=2010.09.29=<br />
*Ligate RV(sp) with GFP(BBa_J04630 already have terminator)<br />
*Transform<br />
<br />
=2010.09.30=<br />
*Transform BBa_J04630<br />
=2010.10.01=<br />
*3-in-1<br />
**colony PCR<br />
{| border=1|-<br />
![[Image:DSC05690.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.6 <br />
|-<br />
| VR+VF|| 2&mu;l || 3.2&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.2&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 8&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.4&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 63.6&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 70s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
=2010.10.02=<br />
*BBa_J04630 plasmid extraction<br />
*Digest J04630(XP)<br />
*cut gel(GFP)<br />
[[Image:DSC05691.JPG|250px]]<br />
*Ligate RV(SP) with GFP(XP)<br />
*Transform<br />
<br />
=2010.10.03=<br />
*FRV(RV+GFP) 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05692.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.9 <br />
|-<br />
| VR+VF|| 2&mu;l || 3.8&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.8&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 9.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.475&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 75.525&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 100s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
=2010.10.04=<br />
*FRV plasmid extraction<br />
*Digest FRV (XP)<br />
*cut gel & purify(FRV)<br />
[[Image:DSC05693.JPG|250px]]<br />
*Ligate FRV with pLac(from ssrA group)<br />
*Transform<br />
-------------------------------------<br />
*pLac plasmid extraction<br />
*Digest pLac(SP) overnight<br />
<br />
=2010.10.05=<br />
*pLac digest purify(run gel with 3-in-1)<br />
*PFRV, GFP, RV 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05695.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
| Total: || 49&mu;l || X2.5 <br />
|-<br />
| VR+VF|| 2&mu;l || 5&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 5&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.625&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 99.375&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
-------------------<br />
*Digest pLac(SP) again overnight<br />
<br />
=2010.10.06=<br />
*pLac cut gel<br />
[[Image:DSC05696.JPG|250px]]<br />
*Ligate pLac(SP) with FRV(XP)<br />
*Transform 22:40<br />
------------------------------------<br />
*Digest FRV(XP) overnight<br />
<br />
=2010.10.07=<br />
*FRV(XP) cut gel<br />
[[Image:DSC05697.JPG|250px]]<br />
*Ligate FRV with pLac<br />
*Transform<br />
<br />
=2010.10.08=<br />
*PFRV 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05698.JPG|400px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X3.8 <br />
|-<br />
| VR+VF|| 2&mu;l || &mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.8&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 9.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.475mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 75.525&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 100s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
------------------------<br />
*Ligate FRV with pLac<br />
*Transform 22:15<br />
<br />
=2010.10.09=<br />
*PFRV 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05699.JPG|400px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X3.8 <br />
|-<br />
| VR+VF|| 2&mu;l || 7.6&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 7.6&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 17&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.95&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 151.06&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*colony PCR again<br />
{| border=1|-<br />
![[Image:DSC05700.JPG|400px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X3.8 <br />
|-<br />
| VR+VF|| 2&mu;l || 7.6&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 7.6&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 17&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.95&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 151.06&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 180s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*Ligate FRV with pLac again<br />
*Transform<br />
<br />
=2010.10.10=<br />
*PFRV 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05702.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X3.2 <br />
|-<br />
| VR+VF|| 2&mu;l || 6.4&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 6.4&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 15&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.8&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 127.2&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94<br />
| 60s<br />
|-<br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 180s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
length is correct!!!<br />
*F colony liquid culture<br />
*FRV liquid culture<br />
------------------------------<br />
*Digest FRV(XP) again<br />
<br />
=2010.10.11=<br />
*FRV&PFRV plasmid extraction<br />
*FRV cut gel<br />
[[Image:DSC05703.JPG|250px]]<br />
*Digest PFRV(XP)&FRV&pSB1C3 <br />
*Ligate PFRV with C3/ FRV with C3/ ribo with C3<br />
*Transform<br />
<br />
=2010.10.12=<br />
*Ligate PFRV with C3/FRV with C3/ribo with C3 again<br />
*Transform 17:25<br />
=2010.10.13=<br />
*PFRC&FRC&RC 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05704.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.7 <br />
|-<br />
| VR+VF|| 2&mu;l || 3.4&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.4&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 8&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.425&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 67.575&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94<br />
| 60s<br />
|-<br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
<br />
-------------------------------<br />
*Ligate PFRV,FRV,ribo with C3<br />
*Transform 00:50<br />
-------------------------------<br />
*Digest PFRV(XP)&RV(XP) again overnight<br />
<br />
=2010.10.14=<br />
*PFRV&RV run gel<br />
[[Image:DSC05705.JPG|250px]]<br />
-------------------<br />
*Ligate RV,FRV,PFRV with C3 again<br />
*Transform<br />
<br />
=2010.10.15=<br />
*FRC,RC 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05706.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.5 <br />
|-<br />
| VR+VF|| 2&mu;l || 5&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 5&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.625&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 99.375&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
<br />
*3-in-1 again <br />
<br />
{| border=1|-<br />
![[Image:DSC05707.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.5 <br />
|-<br />
| VR+VF|| 2&mu;l || 5&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 5&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.625&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 99.375&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
FRC and PFRC are correct, but RC is still incorrect<br />
*PFRC&FRC liquid culture<br />
-------------------------------<br />
*Ligate ribo with C3 again<br />
*Transform<br />
<br />
=2010.10.16=<br />
*Theophylline solution<br />
**Take 1.8012g Theophylline into 15ml DMSO;concentration is 0.67M<br />
*put 15 &mu;l into LB liquid, concentration is 2.5mM;<br />
put 30 &mu;l into LB liquid, concentration is 5mM<br />
-------------------------------<br />
*Ligate ribo(xp) with C3 again<br />
*Transform<br />
<br />
=2010.10.17=<br />
*transform second plate of PFRC into agar plate<br />
positive:C3 30&mu;l+theophylline 0.0027g<br />
<br />
negative:C3<br />
<br />
*PFRC&FRC plasmid extraction<br />
<br />
=2010.10.18=<br />
*PFRC PCR test<br />
{| border=1|-<br />
![[Image:DSC05708.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.3 <br />
|-<br />
| VR+VF|| 2&mu;l || 2.6&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 2.6&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 6.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.325&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 51.675&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*Theophylline in DMSO<br />
**add 1 ml DMSO + Theophylline into 4 ml LB<br />
----------------------------<br />
*Ligate ribo with C3 again<br />
*Transform<br />
----------------------------<br />
*Digest ribo(XP)& C3(XP) <br />
*ribo & C3 cut gel<br />
[[Image:DSC05710.JPG|250px]]<br />
<br />
=2010.10.19=<br />
*Assay Test <br />
{| border=1<br />
|-<br />
! !! O.D/2 || O.D || add to liquid <br />
|-<br />
| PFRC|| 2.503 ||5.006 ||166.5 <br />
|-<br />
| LB || 0 || 0 || <br />
|-<br />
<br />
|}<br />
**Because Theophylline entry into E. coli spend 1 hours at least, O.D= 0.0325<br />
*Assay:add 80 &mu;l PFRC liquid into LB<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.67M) || PFRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| A || 0 mM || 0 || 80.4 ||4 <br />
|-<br />
| B || 0.5 mM || 2.985 &mu;l || 80.4 || 4 <br />
|-<br />
| C || 1 mM || 5.97 &mu;l || 80.4 || 4<br />
|-<br />
| D || 2 mM || 11.94 &mu;l || 80.4 || 4<br />
|-<br />
| E || 4 mM || 23.88 &mu;l || 80.4 || 4<br />
|-<br />
| F || 5 mM || 29.85 &mu;pl || 80,4 ||4<br />
|-<br />
|}<br />
-------------------------------<br />
*10/18 RC 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05711.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.1 <br />
|-<br />
| VR+VF|| 2&mu;l || 4.2&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 4.2&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 10.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.525&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 83.475&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
<br />
*PFRC & C liquid culture<br />
--------------------------<br />
*Ligate ribo with C3 again<br />
*Transform<br />
<br />
=2010.10.20=<br />
*Assay<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.67M) || PFRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 mM || 0|| 130 || 4<br />
|-<br />
| A || 0.1 mM || 0.597 &mu;l || 130 || 4 <br />
|-<br />
| B || 0.05 mM || 1.4925 &mu;l || 130|| 4 <br />
|-<br />
| C || 0.5 mM || 2.985 &mu;l || 130 || 4<br />
|-<br />
| D || 1 mM || 5.97 &mu;l || 130 ||4<br />
|-<br />
| E || 2 mM || 11.94 &mu;l || 130 ||4<br />
|-<br />
| F || 4 mM || 23.88 &mu;pl || 130 ||4<br />
|-<br />
| G || 8 mM || 47.76 &mu;l || 130 ||4<br />
|-<br />
|}<br />
culture for 2 hours<br />
*Transform<br />
<br />
=2010.10.21=<br />
*Assay<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.67M) || PFRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M || 0|| 85.7 || 4<br />
|-<br />
| A || 50 &mu;M || 0.2985 &mu;l || 85.7 ||4 <br />
|-<br />
| B || 100 &mu;M || 0.597 &mu;l || 85.7 ||4 <br />
|-<br />
| C || 200 &mu;M || 1.194 &mu;l || 85.7 ||4<br />
|-<br />
| D || 500 &mu;M || 2.985 &mu;l || 85.7 ||4<br />
|-<br />
| E || 1000 &mu;M || 5.97 &mu;l || 85.7 ||4<br />
|-<br />
| F || 2000 &mu;M || 11.94 &mu;l || 85.7 ||4<br />
|-<br />
| G || 4000 &mu;M || 23.88 &mu;l || 85.7 ||4<br />
|-<br />
| H || 8000 &mu;M || 47.76 &mu;l || 85.7 ||4<br />
|-<br />
| I || 10000 &mu;M || 59.7 &mu;l || 85.7 ||4<br />
|-<br />
| J || 20000 &mu;M || 119.4 &mu;l || 85.7 ||4<br />
|- <br />
| K || 40000 &mu;M || 238.8 &mu;l || 85.7 ||4<br />
|}<br />
*10/20 RC 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05712.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.5 <br />
|-<br />
| VR+VF|| 2&mu;l || 5&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 5&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 1.25&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 99.375&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*Digest ribo again<br />
<br />
=2010.10.22=<br />
*Digest C3 from PFRC plasmid<br />
*Ligate ribo with C3<br />
*Transform<br />
-------------------------------<br />
*Preparing 0.1 M Theophylline solution in DMSO.<br />
*Assay<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.1M) || PFRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M ||0 || 85.7 || 4<br />
|-<br />
| A || 10 &mu;M || 0.4 &mu;l || 117.7 ||4 <br />
|-<br />
| B || 50 &mu;M || 2 &mu;l || 117.7 ||4 <br />
|-<br />
| C || 100 &mu;M || 4 &mu;l || 117.7 ||4<br />
|-<br />
| D || 200 &mu;M || 8 &mu;l || 117.7 ||4<br />
|-<br />
| E || 500 &mu;M || 20 &mu;l || 117.7 ||4<br />
|-<br />
| F || 1000 &mu;M || 40 &mu;l || 117.7 ||4<br />
|-<br />
| G || 2000 &mu;M || 80 &mu;l || 117.7 ||4<br />
|-<br />
| H || 4000 &mu;M || 160 &mu;l || 117.7 ||4<br />
|-<br />
| I || 8000 &mu;M || 320 &mu;l || 117.7 ||4<br />
|-<br />
| J || 10000 &mu;M || 400 &mu;l || 117.7 ||4<br />
|- <br />
| K || 20000 &mu;M || 800 &mu;l || 117.7 ||4<br />
|}<br />
<br />
* Modified experiment design<br />
<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.1M) || PFRC liquid(&mu;l)||FRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M || 0 || 261 ||0|| 4<br />
|-<br />
| A || 10 &mu;M || 0.4 &mu;l || 261 ||0|| 4 <br />
|-<br />
| B || 50 &mu;M || 2 &mu;l || 261 ||0|| 4 <br />
|-<br />
| C || 100 &mu;M || 4 &mu;l ||261 ||0|| 4<br />
|-<br />
| D || 200 &mu;M || 8 &mu;l || 261 ||0||4<br />
|-<br />
| E || 500 &mu;M || 20 &mu;l || 261 ||0||4<br />
|-<br />
| F || 1000 &mu;M || 40 &mu;pl || 261 ||0||4<br />
|-<br />
| G || 2000 &mu;M || 80 &mu;l || 261 ||0||4<br />
|-<br />
| H || 4000 &mu;M || 160 &mu;l || 261 ||0||4<br />
|-<br />
| I || 8000 &mu;M || 320 &mu;l || 261 ||0||4<br />
|-<br />
| J || 10000 &mu;M || 400 &mu;l ||261 ||0||4<br />
|- <br />
| K || 20000 &mu;M || 800 &mu;l || 261 ||0||4<br />
|-<br />
| NT || 100 &mu;M || 4 &mu;l || 0 || 261 || 4<br />
|-<br />
| N || 0 &mu;M || 0 &mu;l || 0 || 261 || 4<br />
|-<br />
|}<br />
<br />
=2010.10.24=<br />
*ribo 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05713.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X0.9 <br />
|-<br />
| VR+VF|| 2&mu;l || 1.8&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 1.8&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 4.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.225&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 35.775&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*ribo liquid culture<br />
*colony PCR <br />
{| border=1|-<br />
![[Image:DSC05715.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.6 <br />
|-<br />
| VR+VF|| 2&mu;l || 3.2&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.2&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 8&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.8&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 63&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*Assay<br />
<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.1M) || Remove LB(&mu;l) || PFRC liquid(&mu;l)||FRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M || 0 || 325 || 325 ||0|| 4<br />
|-<br />
| A || 10 &mu;M || 0.4 &mu;l || 325|| 325 ||0|| 4 <br />
|-<br />
| B || 50 &mu;M || 2 &mu;l || 327||325 ||0|| 4 <br />
|-<br />
| C || 100 &mu;M || 4 &mu;l ||329 ||325 ||0|| 4<br />
|-<br />
| D || 200 &mu;M || 8 &mu;l || 333||325 ||0||4<br />
|-<br />
| E || 500 &mu;M || 20 &mu;l || 345||325 ||0||4<br />
|-<br />
| F || 1000 &mu;M || 40 &mu;pl || 365||325 ||0||4<br />
|-<br />
| G || 2000 &mu;M || 80 &mu;l || 405||325 ||0||4<br />
|-<br />
| H || 4000 &mu;M || 160 &mu;l || 485||325 ||0||4<br />
|-<br />
| I || 8000 &mu;M || 320 &mu;l || 645||325 ||0||4<br />
|-<br />
| J || 10000 &mu;M || 400 &mu;l ||725 ||325 ||0||4<br />
|- <br />
| K || 20000 &mu;M || 800 &mu;l ||1125 ||325 ||0||4<br />
|-<br />
| NT || 100 &mu;M || 4 &mu;l || 504 || 0 || 500 || 4<br />
|-<br />
| N || 0 &mu;M || 0 &mu;l ||500 || 0 || 500 || 4<br />
|-<br />
|}<br />
---------------------------<br />
*Digest RV(XP)& FRC(XP)<br />
*Ligate ribo with C3<br />
*transform<br />
--------------------------------<br />
*PFRC&FRC liquid culture<br />
<br />
=2010.10.25=<br />
*RC 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05716.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.4 <br />
|-<br />
| VR+VF|| 2&mu;l || 4.8&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 4.8&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.6&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 95.4&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*FRC&PFRC&RC liquid culture<br />
<br />
<br />
*Assay<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.1M) || Remove LB(&mu;l) || PFRC liquid(&mu;l)|| FRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M || 0 || 151 || 147 || 0 || 4<br />
|-<br />
| A || 50 &mu;M || 2 &mu;l || 153|| 147 ||0 ||4 <br />
|-<br />
| B || 500 &mu;M || 20 &mu;l || 171||147 ||0 ||4 <br />
|-<br />
| C || 1000 &mu;M || 40 &mu;l ||191 ||147 ||0 ||4<br />
|-<br />
| D || 4000 &mu;M || 160 &mu;l || 311||147 ||0 ||4<br />
|-<br />
| E || 10000 &mu;M || 400 &mu;l || 551||147 ||0 ||4<br />
|-<br />
| NT || 100 &mu;M || 4 &mu;l ||158 || 0||150 || 4<br />
|-<br />
| N || 0 &mu;M || 0 &mu;l ||154 ||0||150 || 4<br />
|-<br />
|}<br />
<br />
=2010.10.26=<br />
*Assay<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.1M) || Remove LB(&mu;l) || PFRC liquid(&mu;l)|| FRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M || 0 || 151 || 147 || 0 || 4<br />
|-<br />
| A || 50 &mu;M || 2 &mu;l || 153|| 147 ||0 ||4 <br />
|-<br />
| B || 500 &mu;M || 20 &mu;l || 171||147 ||0 ||4 <br />
|-<br />
| C || 1000 &mu;M || 40 &mu;l ||191 ||147 ||0 ||4<br />
|-<br />
| D || 4000 &mu;M || 160 &mu;l || 311||147 ||0 ||4<br />
|-<br />
| E || 10000 &mu;M || 400 &mu;l || 551||147 ||0 ||4<br />
|-<br />
| NT || 100 &mu;M || 4 &mu;l ||158 || 0||150 || 4<br />
|-<br />
| N || 0 &mu;M || 0 &mu;l ||154 ||0||150 || 4<br />
|-<br />
|}<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T23:52:28Z<p>V225522: /* Conclusion */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|thumb|none|800px|Fig.1: The 12 different concentration of theophylline and control group comparision.]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|thumb|none|800px|Fig.2: The 12 different concentration of theophylline comparision.]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
*We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
*According to the author Beatrix '' etal'',the paper said that after added more than 5mM Theophylline the ''Escherichia coli'' would die (Beatrix,2004). And in our reasearch, we find that about adding 4 mM Theophylline the spectrum curve would be invalid. As a result, we suggest that the ''Escherichia coli'' cell or the regulation of Riboswitch would be unstable. <br />
*According to our figures, we find that the sample fluorescence will disperse clearly after 80 minutes. As a result, we suggest that the protein expression will be more obvious about 200 minutes after adding Theophylline.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T21:15:25Z<p>V225522: /* Conclusion */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|700px|frame|Fig.1:The 12 different concentration of theophylline and control group comparision. ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|700px|frame|Fig.2:The 12 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
*We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
*According to the author<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T21:14:18Z<p>V225522: /* Reporting Assay 3 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|700px|frame|Fig.1:The 12 different concentration of theophylline and control group comparision. ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|700px|frame|Fig.2:The 12 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is invalid.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
*We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T21:09:28Z<p>V225522: /* Conclusion */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|700px|frame|Fig.1:The 12 different concentration of theophylline and control group comparision. ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|700px|frame|Fig.2:The 12 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is useless.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
*We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T21:08:37Z<p>V225522: /* Reporting Assay 3 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|700px|frame|Fig.1:The 12 different concentration of theophylline and control group comparision. ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|700px|frame|Fig.2:The 12 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px|frame|Fig.3:The 12 different concentration of theophylline and control group comparision. ]]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px|frame|Fig.4:The 12 different concentration of theophylline comparision. ]]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px|frame|Fig.5:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px|frame|Fig.6:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4mM. Also, we can find that 4 mM sample is useless.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px|frame|Fig.7:The 6 different concentration of theophylline and control group comparision. ]]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px|frame|Fig.7:The 6 different concentration of theophylline comparision. ]]<br />
<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_switchTeam:NYMU-Taipei/Project/Speedy switch2010-10-27T21:01:34Z<p>V225522: /* Result */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=<font color=blue>Abstract</font>=<br />
[[Image:NYMU_Central_Dogma.png|thumb|250px|right|The Central Dogma (top) and the effective central dogma when using riboswitches (bottom). Transcription is effectively skipped when ready for use, since the mRNA will have already been expressed.]]<br />
<br />
*'''Speedy Switch''' controls the "on/off " of RNA translation. We use "Riboswitch" as our speedy switch to pause central dogma at the mRNA level.<br />
<br />
<br />
In the past, translating proteins from DNA has followed the central dogma of molecular biology: DNA to RNA to Protein. Normally, after mRNA is transcribed from DNA, ribosomes will bind to the ribosome binding site(RBS) and begin translating mRNA into protein. During this process, we have no way of knowing the location, nor the quantity of mRNA; and after the process, mRNA is quickly degraded. As such, it is very hard to research the detailed roles and implications of mRNA in the central dogma. To resolve this problem, we placed a mRNA level based switch which can be used to control the translation of mRNA: riboswitch.<br />
<br />
=<font color=blue>Introduction</font>=<br />
[[Image:NYMU Pre-ribo2.jpg|thumb|right|250px|The riboswitch is turned off. The RBS is hidden by the secondary structure the riboswitch forms. The ribosome is unable to bind to the RBS, suspending translation of the downstream gene.]]<br />
[[Image:NYMU Ribo-2.jpg|thumb|right|250px|The riboswitch is turned on when a specific small molecule binds to it. The ribosome can then bind to the RBS, inducing translation of the downstream gene.]]<br />
<br />
'''Function of Speedy Switch: speed up the cycle from DNA to mRNA to protein and act as a switch between the mRNA and protein levels'''<br />
<br />
In our project, Speedy Switch serves two main roles. The first is to speed up the expression cycle from DNA to mRNA to protein. Using a riboswitch we can pretranscribe a DNA into an mRNA, ready to be translated at a moments notice. In essence, we can produce protein without having to wait for transcription. The second role the riboswitch serves is to act as a switch between the mRNA and protein levels. Using a riboswitch, we can regulate downstream mRNA and control the expression of proteins.<br />
<br />
Typically, since translation often occurs at the moment mRNA passed into the cytoplasm, protein and mRNA normally exist together. With a riboswitch control, we can study both the expression of mRNA and the expression of protein in the same cells, without protein-mRNA interference. <br />
<br />
<br />
'''We use "Riboswitch" as our speedy switch, which can control translation. It can be divided into two parts: a sensor and an actuator.'''<br />
<br />
Before the discovery of RNA regulatory system , the only way to induce reaction in a cell was through inducible promoters. By turning these promoters on or off, we could control the transcription of the downstream DNA into RNA thus also controlling the translation of RNA to Protein. However, with only promoters we traditionally skip the RNA system involved in the pathway of protein synthesis. By inserting a "switch" between the DNA and RNA system we can make a thorough inspection into the individual mechanism of both systems and the cross-effect between their regulatory factors. <br />
<br />
The discovery of the riboswitch was based on data which described conserved mRNA secondary structure found on 5’-untranslated regions and the creation of small-molecule binding mRNA, sensors. The function of these riboswitches is similar to the function of inducible promoters in that they both regulate downstream genetic data: their difference is that while promoters regulate transcription of DNA, riboswitches control translation of mRNA. <br />
<br />
A riboswitch is a part of mRNA molecule that can bind a small molecule. When it does, the riboswitch will change its structure to regulate the following gene's activity.<br />
<br />
A riboswitch has two parts: a sensor and an actuator. These two components work together to form a ‘switch’. The sensor binds to a small molecule inducer, and the actuator structurally changes to regulate gene expression.<br />
(Harbaugh et al.,2008)(Lynch et al., 2006)<br />
==Purpose==<br />
*Verification of protein function<br />
**We can perform RNA assay and protein assay in the same cell<br />
*Control of protein expression<br />
<br />
=<font color=blue>Experiments</font>=<br />
<br />
==Design==<br />
In order for a suitable riboswitch to work in our experiments, it needs to have the following characteristics:<br />
* The inducer does not naturally exist or metabolize in the target organism.<br />
* The riboswitch does not exist naturally in the target organism.<br />
* The riboswitch does not have EcoRI, XbaI, SpeI, or PstI cutting sites.<br />
** Although we can modify the cutting sites of our riboswitch, this action may cause more problems: the cutting site may mutate the secondary structure and molecule binding sites causing it to cease function.<br />
<br />
===An example of our '''Speedy Switch'''===<br />
<br />
Because we were using ''Escherichia coli'' DH5alpha as our chassie organism, so we decided to use '''Theophylline Riboswitch''' which fits all these requirements for our circuit design and enginnering. <br />
<br />
Since most riboswitches already have Ribosome binding sites (RBSs) in their structures, we did not add other RBSs in front of downstream reporters.<br />
<br />
After transforming the whole structure,"promoter+ riboswitch+ GFP+ terminator in plasmid" into ''Escherichia coli,''<br />
the cells will express GFP when theophylline (the inducer) is introduced.<br />
<br />
==Composition of our circuit==<br />
[[Image:NYMU Ribo circuit.jpg|left|thumb|500px|This is our circuit of speedy switch. Theophylline Riboswitch sequence is after the promoter, inclusive of the ribosome binding site. And then we put GFP,next is the terminator. We just add Theophylline, GFP will emit green fluorescence.]]<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
To test our hyposthesis, we needed to construct a circuit that has a promoter, a riboswitch, a reporter, and a terminator. We chose to use the theophylline riboswitch as it suited our requirements.<br />
<br />
When the full sequence outlined above is transformed into the bacteria, it waits, inactivated, for the right small molecule inducer, in this case, theophylline. When theophylline is added, it will induce the riboswitch to fold differently to allow the translation of the downstream gene, without waiting for transcription. <br />
<br />
By comparing the flourescence intensity data (the speed of GFP production), we can determine the difference in time between the traditional method of inducing promoters, to our method of inducing mRNA.<br />
<br />
===Promoter===<br />
*We used '''pLac''' constitutive promoter from Biobrick Parts Registry{{:Team:NYMU-Taipei/BBa|R0010}}<br />
<br />
We used this constitutive promoter because it can keep working without additional stimulation. So we can get sufficient mRNA with Theophylline Riboswitch in ''Escherichia coli'' DH5alpha. We just need to add Theophylline and Theophylline Riboswitch will function rapidly.<br />
<!-- * Although we have the sequence for the theophylline riboswitch, without a template, we could not run PCR (Polymerase Chain Reaction) to produce the quantity of DNA we required. To create this template, we design forward and reverse primers that have a common region.<br />
--><br />
<br />
===Theophylline Riboswitch===<br />
Since the sequence length of this riboswitch is relatively short, we decided to synthesize the riboswitch directly using two primers (which also contain the biobrick prefix and suffix)<br />
*sequence<br />
ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaag<br />
forward primer : gaattcgcggccgcttctagag ggtgataccagcatcgtcttgatgcccttggcag<br />
reverse primer : ctgcagcggccgctactagtacttgttgtcttgcagcggggtgctgccaagggcatcaagac<br />
<br />
PCR expected result (99bp)<br />
gaattcgcggccgcttctagagggtgataccagcatcgtcttgatgcccttggcag<br />
gaattcgcggccgcttctagag<font color="red">ggtgataccagcatcgtcttgatgcccttggcagcaccccgctgcaagacaacaag</font>tactagtagcggccgctgcag<br />
gtcttgatgcccttggcagcaccccgctgcaagacaacaagtactagtagcggccgctgcag<br />
<br />
These two primers anneal at this common region.<br />
<br />
===GFP+terminator===<br />
*We used biobrick {{:Team:NYMU-Taipei/BBa|J04630}}<br />
We used Green fluorescent protein as our reporter for two main reasons. First, GFP makes a great reporter because it fluoresces when it is activated, making itself easy to detect. We can measure the activity of the promoter by the intensity of the fluorescence . The second reason is that the GFP used is a biobrick, thus if another team needs to use this riboswitch circuit, it would be easy for them to attach another biobrick. So we chose biobrick - {{:Team:NYMU-Taipei/BBa|J04630}} (GFP with terminator)<br />
<br />
==Whole Process==<br />
# First, two riboswitch primers will anneal together at the common region through PCR amplification. <br />
# We then digested the riboswitch PCR product and a plasmid containing the plasmid backbone pSB1A2 with the restriction enzymes XbaI and PstI.<br />
# After gel extraction/PCR purification of the relevant parts, we ligated them and produced the biobrick part {{:Team:NYMU-Taipei/BBa|K411101}}.<br />
# Performed a back insert of {{:Team:NYMU-Taipei/BBa|J04630|(GFP+terminator)}} (digested with XbaI and PstI) into {{:Team:NYMU-Taipei/BBa|K411101}} (digested with SpeI and PstI) and formed the biobrick {{:Team:NYMU-Taipei/BBa|K411102}}.<br />
# Performed another back insert of {{:Team:NYMU-Taipei/BBa|K411102}} (digested with XbaI and PstI) into {{:Team:NYMU-Taipei/BBa|R0010|(lac promoter)}} (digested with SpeI and PstI) and formed the biobrick {{:Team:NYMU-Taipei/BBa|K411103}}.<br />
# Finally we tested this kind of ''Escherichia coli''. We add Theophylline to induce riboswitch and and translate GFP.<br />
<br />
=<font color=blue>Result</font>=<br />
In theory, if we add more inducers to a cell, riboswitch will translate more GFPs. But theophylline is toxic for ''Escherichia coli.'' From paper, we know that if theophylline concentration is over 5 &mu;M, ''Escherichia coli'' will die.(Lynch et al., 2006)<br />
[[Image:20101025(org).png|800px|In this picture, it shows that when more Theophylline is added, more GFP is created and fluoresces.<br />
For more of our speedy switch experimental data, please check out our SpeedBac experimental result section.]]<br />
<br />
This figure shows the results of our experiments. Comparing to N (stands for the Negative control), we find GFP express when we add Theophylline. <br />
For more Speedy Switch experimental data, please check out our SpeedBac experimental results [[Team:NYMU-Taipei/Experiments/Speedy switch | here]].<br />
<br />
=<font color=blue>Reference</font>=<br />
*Desai, S.K., and Gallivan, J.P. (2004). Genetic screens and selections for small molecules based on a synthetic riboswitch that activates protein translation. ''J Am Chem Soc'' 126, 13247-13254.<br />
<br />
*Harbaugh S.V., Davidson M.E., Chushak Y.G., Kelley-Loughnane N., and Stone M.O.(2008) Riboswitch-based sensor in low optical background. ''Proc. of SPIE'' 7040, 70400C<br />
<br />
*Lynch, S.A., Desai, S.K., Sajja, H.K., and Gallivan, J.P. (2007). A high-throughput screen for synthetic riboswitches reveals mechanistic insights into their function. ''Chem Biol'' 14, 173-184.<br />
<br />
*Mandal, M., Boese, B., Barrick, J.E., Winkler, W.C., and Breaker, R.R. (2003). Riboswitches control fundamental biochemical pathways in Bacillus subtilis and other bacteria. ''Cell'' 113, 577-586.<br />
<br />
*Suess, B., Fink, B., Berens, C., Stentz, R., and Hillen, W. (2004). A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. ''Nucleic Acids Res'' 32, 1610-1614.<br />
<br />
*Topp, S., and Gallivan, J.P. (2007). Guiding bacteria with small molecules and RNA. ''J Am Chem Soc'' 129, 6807-6811.<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:45:53Z<p>V225522: /* Conclusion */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|800px|frame|Fig.1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3 & 4, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:44:56Z<p>V225522: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|800px|frame|Fig.1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
<br />
=Reference=<br />
*Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 )<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:43:33Z<p>V225522: /* Repoting Assay 4 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|800px|frame|Fig.1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:43:09Z<p>V225522: /* Reporting Assay 3 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|800px|frame|Fig.1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:42:28Z<p>V225522: /* Reporting Assay 2 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|800px|frame|Fig.1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''Escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:42:01Z<p>V225522: /* Reporting Assay 1 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|800px|frame|Fig.1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''Escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''Escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''Escherichia coli'' limitation and ''Escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:38:25Z<p>V225522: /* Conclusion */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|800px|frame|Fig.1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:35:52Z<p>V225522: /* Reporting Assay 2 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|800px|frame|Fig.1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:35:27Z<p>V225522: /* Reporting Assay 1 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(re).png|800px|frame|Fig.1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/File:20101023(re).pngFile:20101023(re).png2010-10-27T20:24:38Z<p>V225522: </p>
<hr />
<div></div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:10:54Z<p>V225522: /* Repoting Assay 4 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px|frame|Fig. 1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:10:06Z<p>V225522: /* Reporting Assay 2 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px|frame|Fig. 1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:09:36Z<p>V225522: /* Reporting Assay 1 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px|frame|Fig. 1: ]]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity. <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli'' limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:04:39Z<p>V225522: /* Repoting Assay 4 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px|frame|Fig. 1: lolololloolooloolololololo ]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:03:17Z<p>V225522: /* Reporting Assay 3 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px|frame|Fig. 1: lolololloolooloolololololo ]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity .<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . The study by Beatrix Suess''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:02:42Z<p>V225522: /* Reporting Assay 2 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px|frame|Fig. 1: lolololloolooloolololololo ]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . The study by Beatrix Suess''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:02:19Z<p>V225522: /* Reporting Assay 1 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px|frame|Fig. 1: lolololloolooloolololololo ]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity. The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . The study by Beatrix Suess''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T20:01:13Z<p>V225522: /* Repoting Assay 4 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the ''escherichia coli'' would die (Beatrix Suess, 2004). <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity. The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . The study by Beatrix Suess''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T19:59:44Z<p>V225522: /* Reporting Assay 3 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the ''escherichia coli'' would die (Beatrix Suess, 2004). <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity. The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T19:58:13Z<p>V225522: /* Reporting Assay 2 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the ''escherichia coli'' would die (Beatrix Suess, 2004). <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity. The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T19:56:51Z<p>V225522: /* Reporting Assay 2 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the ''escherichia coli'' would die (Beatrix Suess, 2004). <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity. The study by Beatrix Suess "et al" said that if added more than 5mM theophylline the escherichia coli would die (Beatrix Suess, 2004).<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T19:55:38Z<p>V225522: /* Reporting Assay 2 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the ''escherichia coli'' would die (Beatrix Suess, 2004). <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity. said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T19:54:40Z<p>V225522: /* Reporting Assay 1 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . The study by Beatrix Suess ''et al'' said that if added more than 5mM theophylline the ''escherichia coli'' would die (Beatrix Suess, 2004). <br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
=Conclusion=<br />
In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range.<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T19:46:54Z<p>V225522: /* Repoting Assay 4 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
**In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4 mM. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range. <br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T19:42:57Z<p>V225522: /* Repoting Assay 4 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
**Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 8mM and 10mM lines were low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 2==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
*Discussion<br />
**Under 8mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
**The 20mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
<br />
==Reporting Assay 3==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM lines was low initially and then growing.We sugested that may have two possibility.One is that because we take out ''escherichia coli'' from 37 degrees centigrade and added theophylline in it at room temperature and we take the ''escherichia coli'' into 37 degrees centigrade incubator.So the ''escherichia coli'' may not get with the temperature and die initially.<br />
<br />
==Repoting Assay 4==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
*Discussion<br />
**Under 4mM theophylline,we added more concentrations of theophylline the protein expressed strongers so we can see the higher fluorescent intensity . From the paper(Beatrix Suess, Barbara Fink, Christian Berens, ReÂgis Stentz and Wolfgang Hillen(2004)A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Research, Vol. 32, No. 4 ) said if added more than 5mM theophylline the ''escherichia coli'' would die.<br />
**The 10mM line show that the theophylline concentration reached the ''escherichia coli''limitation and ''escherichia coli'' was dead.<br />
**In the assay 3, we revised the reagent formula in order to eliminate the total volume effect of the sample because the volume of Theophylline we add should be considered. As a result, we modify the LB liquid volume to fit the total volume of each sample into 4mL. By this modifying method, we can make sure the concentration of Theophylline in each sample. Comparing to the assay1 & 2, we can find that 4mM sample is still above the 0 mM curve because the real concentration of this sample is below 4000&uM;M. Also, we can find that 4 mM sample is useless. We suggest that the higher concentration of Theophylline for Riboswitch, the fluorescence will be higher in the concentration range from 0.01mM to 2mM. As a result, we recommend the Riboswitch can be “on” and translate the downstream code on the mRNA the concentration of Theophylline in the concentration of that range. <br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T18:32:18Z<p>V225522: /* Repoting Assay4 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . From the paper said if added more than 5mM theophylline the Escherichia coli would die.<br />
<br />
==Reporting Assay 2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay 3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay 4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T18:32:03Z<p>V225522: /* Reporting Assay3 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . From the paper said if added more than 5mM theophylline the Escherichia coli would die.<br />
<br />
==Reporting Assay 2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay 3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T18:31:51Z<p>V225522: /* Reporting Assay2 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . From the paper said if added more than 5mM theophylline the Escherichia coli would die.<br />
<br />
==Reporting Assay 2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T18:31:27Z<p>V225522: /* Reporting Assay1 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay 1==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . From the paper said if added more than 5mM theophylline the Escherichia coli would die.<br />
<br />
==Reporting Assay2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T18:30:32Z<p>V225522: /* Reporting Assay1 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay1==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 Reagent formula]]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . From the paper said if added more than 5mM theophylline the Escherichia coli would die.<br />
<br />
==Reporting Assay2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T18:29:48Z<p>V225522: /* Reporting Assay3 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . From the paper said if added more than 5mM theophylline the Escherichia coli would die.<br />
<br />
==Reporting Assay2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 Reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T18:21:52Z<p>V225522: </p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
*The optimizing data:<br />
We took the data from OD600 of each sample, which should have an exponential growth curve, and took the ln of each value. After taking the logarithm of the data, we created a linear curve. Since we have the two end points of the OD 600 of each sample, we use this linear curve to modulate OD value of each sample at each specific time point. This value was then recalculated back into its original curve using exponents. <br />
Our fluorescent data was normalized by taking the fluorescence of our sample at each time point and subtracting the fluorescence of the negative control in the same OD value at the same time point.<br />
Finally, plot the nomalized fluorescence versus time in minutes scale.<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
*Discussion<br />
Under 4mM theophylline , we added more concentrations of theophylline the protein expressed stronger ,so we can see the higher fluorescent intensity . From the paper said if added more than 5mM theophylline the Escherichia coli would die.<br />
<br />
==Reporting Assay2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T16:52:37Z<p>V225522: /* Reporting Assay */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized with the control N line and NT line.<br />
<br />
==Reporting Assay1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
<br />
==Reporting Assay2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/RiboswitchTeam:NYMU-Taipei/Experiments/Riboswitch2010-10-27T16:47:09Z<p>V225522: /* 2010.10.19 */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
=2010.08.17 =<br />
*PCR of primer&Digestion&Ligation<br />
{| border="1" cellspacing="1" cellpadding="2" <br />
! [[Image:NYMU Ribo.jpg|250px]]<br />
| colspan=2 |<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: marker 100bp|||n|=<br />
|2: -|-|-|n|=<br />
|3: riboswitch |56 bp|none|w|=<br />
|4: riboswitch |56 bp|none|w|=<br />
|5: -|-|-|n|=<br />
|6: riboswitch |56 bp|none|w|=<br />
|7: riboswitch |56 bp|none|w|=<br />
|8: -|-|-|n|=<br />
|9: riboswitch |56 bp|none|w|=<br />
|10: riboswitch |56 bp|none|w|=<br />
|11: Positive Control|1100 bp|none|f|=<br />
|12: Negative Control||Contamination ~300bp |f|=<br />
|}} <br />
{| border=1<br />
|'''PCR mix'''for 3 tubes(25+25+50)<br />
|'''''total 50 &mu;l''''' <br />
|'''temp'''<br />
|'''time'''<br />
|-<br />
|template || 1&mu;l || 94oC ||120s<br />
|-<br />
|forward primer || 1&mu;1 || 94oC ||30s<br />
|-<br />
|reverse primer || 1&mu;1 || 55oC || 30s<br />
|-<br />
|dNTP || 4&mu;1 || 72oC ||40s<br />
|-<br />
|10x buffer || 5&mu;l ||72oC||300s<br />
|-<br />
|ddH2O || 39.75&mu;l<br />
|-<br />
|pfu || 0.5&mu;1<br />
|}<br />
|}<br />
<br />
*Plasmid extraction<br />
*Digestion<br />
*PCR purification(centrifuge)<br />
*Nanodrop<br />
*Ligation<br />
*Transform 20:00<br />
<br />
=2010.08.18 =<br />
*PCR mix<br />
*Run gel(2%argarose 100v)<br />
{| border="1" cellspacing="1" cellpadding="2" <br />
![[Image:NYMU_CIMG1185.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: marker 100bp|||n|=<br />
|2: th-ribo gene + vector|294bp|-|f|=<br />
|3: th-ribo gene + vector|294bp|-|f|=<br />
|4: -|-|-|n|=<br />
|5: Positive Control|1100 bp|none|w|=<br />
|6: Negative Control||Contamination ~3000bp|f|=<br />
|}} <br />
{| border=1<br />
| Total:(*2) || 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
(negative contaminated and appeared three different bands)<br />
*3-in-1 11:30<br />
*Run PCR 12:00<br />
*put Liquid culture&plate at 17:00<br />
<br />
=2010.08.19=<br />
*Because there are some mistake resulting from gel running, we decided to digest again.<br />
**Digest 10:30<br />
**Transformation 12:45<br />
<br />
*At the same time, we continued plasmid extraction of the result one of yesterday.<br />
**plasmid extraction 10:30<br />
**Digest 11:30<br />
**run gel 13:00<br />
**Ligation 14:00<br />
**Transformation 14:30<br />
<br />
=2010.08.20=<br />
*We decide to re-3-in-1 again.<br />
*PCR mix 10:30<br />
*3 in 1 11:30<br />
*Run PCR 01:00~02:30<br />
*Run gel 15:00(100v 20 mins)<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU R20.JPG]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: marker 100bp|||n|=<br />
|2: ribo+vector|294bp||f|=<br />
|3: ribo+vector|294bp||f|=<br />
|4: -|-|-|n|=<br />
|5: Positive Control|1100 bp|none|w|=<br />
|6: Negative Control|||n|=<br />
|}} <br />
{| border=1<br />
| Total:(*2) || 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
*Cut gel 16:30<br />
*Plasmid extraction 16:30<br />
<br />
=2010.08.23=<br />
*the upper experiment are failed,so we restart the experiment.<br />
**Run gel 11:00<br />
**After nanodrop, we found that the concentration is too low(only 3.0), so we re-PCR-of-primer again.<br />
<br />
*PCR of primer 16:00<br />
*Transformation(GFP) 17:15<br />
<br />
=2010.08.24=<br />
*Run gel 10:30am(5ul)<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU R24.JPG]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: |||n|=<br />
|2: marker 100bp|||n|=<br />
|3: |||n|=<br />
|4: pcr riboswitch|56bp||w|=<br />
|5: |||n|=<br />
|6: Positive Control||300bp|f|=<br />
|7: Negative Control|||w|=<br />
|}} <br />
{| border=1<br />
| Total:(*2) || 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
*PCR Purify 10:45(45ul)<br />
*Digest 11:15<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1<br />
|-<br />
! Total: !! 30&mu;l<br />
|-<br />
| DNA || 26&mu;l<br />
|-<br />
| Digestion buffer || 2&mu;l<br />
|-<br />
| Enzyme 1(X) || 1&mu;l<br />
|-<br />
| Enzyme 2(P) || 1&mu;l<br />
|}<br />
*Digest purify 13:30<br />
*Nanodrop(19.8ng/ul)<br />
*Ligation 15:44<br />
**Ligate riboswitch+pSB1A2(1:3) and ligate GFP+pSB1A2(1:2)(we use 2009's GFP+terminater so we have to ligate pSB1A2)<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1<br />
|-<br />
! Total: !! 10&mu;l<br />
|-<br />
| DNA of vector || 1&mu;l<br />
|-<br />
| DNA of insert || 3&mu;l<br />
|-<br />
| buffer || 2&mu;l<br />
|-<br />
| ligase || 0.5&mu;l<br />
|-<br />
| ddH2O || 4.5&mu;l<br />
|}<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1<br />
|-<br />
! Total: !! 10&mu;l<br />
|-<br />
| DNA of vector || 1&mu;l<br />
|-<br />
| DNA of insert || 2&mu;l<br />
|-<br />
| buffer || 2&mu;l<br />
|-<br />
| ligase || 0.5&mu;l<br />
|-<br />
| ddH2O || 5.5&mu;l<br />
|}<br />
<br />
=2010.08.25=<br />
*3-in-1:GFP(1 colony),Riboswitch(2 colony) 17:00pm<br />
*Run PCR 17:20pm<br />
<br />
=2010.08.26=<br />
*Run gel 10:30am<br />
**Because we thought the result is unsure,we decide to digest to check. <br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU R26-2.JPG]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: GFP|||f|=<br />
|2: (1)riboswitch+pSB1A2|294bp||w|=<br />
|3: (2)riboswitch+pSB1A2|294bp||f|=<br />
|4: Positive Control|1100bp||f|=<br />
|5: Negative Control|Contamination~1000 bp||f|=<br />
|6: Marker:100bp|||n|=<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.25&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
*Liquid culture 12:00<br />
**the first step when we added MX1 we didn't resuspend,so we readded MX1~MX3.But the DNA may be less.<br />
*digest <br />
**[GFP(XP),ribo1(SP,XP>>use 10 ul and 20ul protocal),ribo2(SP,XP>>use 10 ul and use 20ul protocal)]<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1<br />
|-<br />
! Total: !! 10&mu;l<br />
|-<br />
| DNA of vector(sp) || 1&mu;l<br />
|-<br />
| DNA of insert(xp) || 3&mu;l<br />
|-<br />
| buffer || 2&mu;l<br />
|-<br />
| ligase || 0.5&mu;l<br />
|-<br />
| ddH2O || 4.5&mu;l<br />
|}<br />
{|<br />
|-<br />
|<br />
*run gel(xp)<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU R26.JPG]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: ribo1|96bp||f|=<br />
|2: |||n|=<br />
|3: ribo2|96bp||f|=<br />
|4: |||n|=<br />
|5: Marker:100bp|||n|=<br />
|6: GFP|854bp||f|=<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
*purify(ribo-1(sp);ribo-2(sp);GFP(xp))<br />
*ligate<br />
*transform<br />
*liquid culture from the plate(8/24)<br />
<br />
=2010.08.27=<br />
*PCR mix 10:30<br />
**GFP+terminator+Riboswitch=1157bp<br />
*3 in 1 12:15<br />
*Run PCR 12:30~13:30<br />
*Run gel 13:45<br />
--------------------------------------------------------------------------<br />
*Liquid culture again(use the plate 8/24) 10:30<br />
**To check the wrong step of liquid culture<br />
*Digestion 13:40<br />
*Run gel 01:45pm[GFP(XP).Riboswitch-1(XP).Riboswitch-2(XP)]<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU R27.JPG]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: |-|-|n|=<br />
|2: riboswitch+GFP|1158bp|292bp|f|=<br />
|3: riboswitch+GFP|1158bp|292bp|f|=<br />
|4: |-|-|n|=<br />
|5: Positive Control|1100 bp|none|w|=<br />
|6: |-|-|n|=<br />
|7: Negative Control||Contamination ~1000bp |f|=<br />
|8: |-|-|n|=<br />
|9: Marker=100bp|||n|<br />
|10: |-|-|n|=<br />
|11: GFP(XP)|879bp|854bp|f|=<br />
|12: |-|-|n|=<br />
|13: ribo-1(xp)|294bp||f|=<br />
|14: |-|-|n|=<br />
|15: ribp-2(xp)|294bp||f|=<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l<br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
=2010.08.28=<br />
*3-IN-1 (another 3 colony from 08.26 Riboswitch+GFP-Terminator plate) 13:30<br />
**PCR (Use new dNTP & Taq buffer & taq) 14:30 <br />
**Run Gel 16:20<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010273.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: riboswitch+GFP|1158bp|292bp|f|=<br />
|2: riboswitch+GFP|1158bp|292bp|f|=<br />
|3: riboswitch+GFP|1158bp|292bp|f|=<br />
|4: positive control|1100bp|-|w|=<br />
|5: marker100 bp|-|-|n|=<br />
|6: negative control|-|-|n|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l ||temp||time<br />
|-<br />
| template || 2&mu;l ||94<sup>o</sup>C||60s<br />
|-<br />
| VF+VR || 2&mu;l||94<sup>o</sup>C||15s<br />
|-<br />
| dNTP || 2&mu;l||55<sup>o</sup>C||20s<br />
|-<br />
| Buffer || 5&mu;l||72<sup>o</sup>C||100s<br />
|-<br />
| ddH2O || 39.75&mu;l||72<sup>o</sup>C||300s<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
*Transformation GFP+vector 17:00<br />
*3-IN-1 (2 Colony from the plate transformed on 08/27) 17:20<br />
** PCR 18:25~19:40<br />
<br />
=2010.08.29=<br />
*Run Gel (with green marker) at 11:00 <br />
**Ribo Vac1 and Ribo Vac2 from PCR on 8/28 at 18:25~19:40 <br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010274.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: -|-|-|n|=<br />
|2: -|-|-|n|=<br />
|3: riboswitch1+vector|294bp|-|f|=<br />
|4: marker100 bp|-|-|n|=<br />
|5: riboswitch2+vector|294bp|-|f|=<br />
|6: positive control|1100bp|-|n|=<br />
|7: negative control|-|-|n|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l|<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
______________________________________________________________________________________________________________<br />
*3-in-1 (3 colonies of GFP+TERMINATOR and 1 of Riboswitch+PSB1A2 vector, both from plates transformed on 8/28)<br />
**PCR 11:00~12:50<br />
**Run Gel 15:30 (result shows no band!! but positive and negative controls are correct)<br />
{|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010276.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: GFP1|854bp||f|=<br />
|2: GFP2|854bp||f|=<br />
|3: GFP3|854bp||f|=<br />
|4: marker100 bp|-|-|n|=<br />
|5: riboswitch+vector|294bp|-|f|=<br />
|6: negative control|-|-|n|=<br />
|7: positive contril|1100bp|-|n|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
*transform 16:30 <br />
** (1)the Ribo2 from 8.17 (2)the Ribo (check) from 08/19 (3)GFP+terminator from 08/27<br />
***put into incubator 17:30<br />
<br />
=2010.08.30=<br />
*3-in-1: GFP,GFP+riboswitch,ribo-1,ribo-2 12:30pm<br />
*Run PCR 13:20<br />
*Run gel(2% argarose 100v)<br />
|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010277.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: GFP1|854bp|-|f|=<br />
|2: GFP2|854bp|-|f|=<br />
|3: GFP3|854bp|-|f|=<br />
|4: riboswitch1+GFP|1158bp|-|f|=<br />
|5: riboswitch2+GFP|1158bp|-|f|=<br />
|6: riboswitch3+GFP|1158bp|-|f|=<br />
|7: marker100 bp|-|-|n|=<br />
|8: ribo1+vector|294bp|-|w|=<br />
|9: ribo1+vector|294bp|-|w|=<br />
|10: ribo2+vector|294bp|-|w|=<br />
|11: ribo2+vector|294bp|-|w|=<br />
|12: positive control|1100bp|-|f|=<br />
|13: negative control|-|-|n|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l|<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
*Finally we Transform 19F(GFP+terminator), E0040 18:50<br />
<br />
=2010.08.31=<br />
*3-in-1 (ribo(xp)+pSB1A2,E0040,J04630)11:00<br />
*Nanodrop<br />
*Ligation<br />
|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010280.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: GFP1(J04630)|854bp|-|f|=<br />
|2: GFP2(J04630)|854bp|-|f|=<br />
|3: Riboswitch1+vector|294bp|-|f|=<br />
|4: Riboswitch+2vector|294bp|-|f|=<br />
|5: marker100 bp|-|-|n|=<br />
|6: GFP1(E0040)|720bp|-|f|=<br />
|7: GFP2(E0040)|720bp|-|n|=<br />
|8: ribo1+vector|294bp|-|w|=<br />
|9: ribo1+vector|294bp|-|w|=<br />
|10: ribo2+vector|294bp|-|w|=<br />
|11: ribo2+vector|294bp|-|w|=<br />
|12: positive control|1100bp|-|f|=<br />
|13: negative control|-|-|n|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l|<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
{| border="1" cellspacing="1" cellpadding="2" <br />
![[Image:NYMU P9010281.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: GFP+terminator(19f)|854bp|-|w|=<br />
|2: GFP(E0040)|720bp|-|w|=<br />
|3: GFP(E0040)|720bp|-|w|=<br />
|4: marker 100bp|-|-|n|=<br />
|5: Positive Control|1100 bp||n|=<br />
|6: Negative Control|||n|=<br />
|}} <br />
|}<br />
<br />
=2010.09.01=<br />
*GFP*3 Plasmid Extraction 10:30<br />
*Digestion 12:30 (13:20)<br />
*Run gel 15:30<br />
{| border=1|-<br />
![[Image:NYMU P9070330.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: -|-|-|n|=<br />
|2: -|-|-|n|=<br />
|3: marker 100bp|-|-|n|=<br />
|4: -|-|-|n|=<br />
|5: (GFP)E0040-2|745bp||w|=<br />
|6: (GFP)E0040-1|745bp||w|=<br />
|7: (GFP)J04630|856bp||w|=<br />
<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.25&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
------------------------------------<br />
*RG1,RG2,RG3,PR1,PR2,PR3 3-in-1 10:00<br />
*Colony PCR 11:00~13:00<br />
*Run Gel <br />
<br />
<br />
{| border=1|-<br />
![[Image:NYMU P9010283.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: riboswitch+GFP(1-a)|1158bp|294bp|f|=<br />
|2: riboswitch+GFP(1-b)|1158bp|294bp|f|=<br />
|3: riboswitch+GFP(2-a)|1158bp|294bp|f|=<br />
|4: riboswitch+GFP(2-b)|1158bp|294bp|f|=<br />
|5: riboswitch+GFP(3-a)|1158bp|294bp|f|=<br />
|6: riboswitch+GFP(3-b)|1158bp|294bp|f|=<br />
|7: -|-|-|<br />
|8: marker 100bp|-|-|n|=<br />
|9: promoter+ribo+GFP|1366bp|-|f|=<br />
|10: promoter+ribo+GFP|1366bp|-|f|=<br />
|11: promoter+ribo+GFP|1366bp|-|f|<br />
|12: promoter+ribo+GFP|1366bp|-|f|=<br />
|13: promoter+ribo+GFP|1366bp|-|f|=<br />
|14: promoter+ribo+GFP|1366bp|-|f|=<br />
|15: positive control|1100bp||n|=<br />
|16: negative control|-|containment|f|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l ||temp||time<br />
|-<br />
| template || 2&mu;l ||94||60s<br />
|-<br />
| VF+VR || 2&mu;l||94||15s<br />
|-<br />
| dNTP || 2&mu;l||55||20s<br />
|-<br />
| Buffer || 5&mu;l||72||90s<br />
|-<br />
| ddH2O || 39.75&mu;l||72||300s<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
=2010.09.02=<br />
*Liquid culture plasmid extraction 10:00<br />
*Nanodrop<br />
*Digestion 12:12<br />
*Purification<br />
*Nanodrop<br />
*Ligation<br />
*Transform 17:00<br />
=2010.09.03=<br />
*3-in-1 chose 4 colony<br />
*PCR 11.20 <br />
*run gel<br />
{| border=1|-<br />
![[Image:NYMU P9070329.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: FRV1|1158bp|294bp|f|=<br />
|2: FRV2|1158bp|294bp|f|=<br />
|3: marker 1kb|-|-|n|=<br />
|4: FRV3|-|-|n|=<br />
|5: FRV4|1158bp|294bp|w|=<br />
|6: positive control|1100bp||f|=<br />
|7: negative control||-|w|=<br />
<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
(the marker takes the wrong one,1kb marker is correct)<br />
**ligation failed<br />
*ligate again(insert+vector=8.5)<br />
*transform 16:40<br />
<br />
=2010.09.04=<br />
*PCR 20:35pm (3 colony from 20100903 plate)<br />
*run gel(FRV1&2&3&+&-) 100V 35min<br />
{| border=1|-<br />
![[Image:NYMU P9070327.jpg]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: FRV1|1158bp|294bp|n|=<br />
|2: FRV2|1158bp|294bp|n|=<br />
|3: marker 100bp |-|-|w|=<br />
|4: FRV3|1158bp|294bp|w|=<br />
|5: positive control|1000bp|-|n|=<br />
|6: negative control|-|-|w|=<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
*discuss<br />
<br />
=2010.09.05=<br />
*digest again(because we used XP's protocol for SP)<br />
*purification at 14:25 <br />
*nanodrop at 15:00<br />
**we digest another tube (ribo2-2 SP) 15:50<br />
*ligation <br />
*transform 17:00<br />
=2010.09.06=<br />
*Colony PCR 11:30<br />
*Run gel 14:30(2% argarose 100v 25 mins)<br />
|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU_DSC05719.JPG|250px]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: positive control|1100bp|-|f|=<br />
|2: negative control|-|-|f|=<br />
|3: 100bp marker|-|-|f|=<br />
|4: FRV|1158bp|1700bp|f|=<br />
|5: FRV|1158bp|1700bp|w|=<br />
<br />
|<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 1&mu;l <br />
|-<br />
| VF+VR || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
-----------------------------------------<br />
*Take out the digest(sp)yesterday 10:30<br />
*digest purify<br />
*nanodrop(13.2ng/nl)<br />
*ligate 11:40~14:30<br />
*transform 17:00<br />
<br />
=2010.09.07=<br />
*3-in-1 10:30am<br />
*Run PCR 10:45am<br />
|<br />
|-<br />
|<br />
<br />
{| border=1|-<br />
![[Image:NYMU_DSC05720.JPG|250px]] !!<br />
{{:Team:NYMU-Taipei/GELC|=<br />
|1: FRV|1158bp|-|f|=<br />
|2: FRV|1158bp|-|f|=<br />
|3: FRV|1158bp|-|f|=<br />
|4: FRV|1158bp|-|f|=<br />
|5: 100bp marker|-|-|f|=<br />
|6: FRV|1158bp|-|f|=<br />
|7: FRV|1158bp|294bp|n|=<br />
|8: positive control|1100bp|-|w|=<br />
|9: negative control|-|-|w|=<br />
|<br />
<br />
|}} <br />
{| border=1<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VF+VR || 2&mu;l|<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| Enzyme tag || 0.25&mu;l<br />
|}<br />
|}<br />
<br />
=2010.09.08=<br />
*plasmid extraction<br />
*digestion(FRV1(XP)) 11:10<br />
**nanodrop 14&mu;l<br />
*ligation 14:00<br />
*Transformation 17:00<br />
=2010.09.09=<br />
<br />
*Real PCR<br />
<br />
{| border=1|-<br />
![[Image:NYMU_R9.JPG|250px]] !!<br />
<br />
<br />
{| border="1"<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| FP+RP || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| pfu || 0.25&mu;l<br />
|}<br />
{| border="2"<br />
|-<br />
| Temp || Time<br />
|-<br />
| 94 || 60s<br />
|-<br />
| 94 || 15s<br />
|-<br />
| 50.8 ||20s<br />
|-<br />
| 74 || 45s<br />
|-<br />
| 74 || 300s<br />
|}<br />
|}<br />
<br />
=2010.09.10=<br />
*real PCR (temperature test) <br />
*run gel<br />
<br />
{| border=1|-<br />
![[Image:NYMU_DSC05722.JPG|250px]] !!<br />
<br />
<br />
{| border="1"<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| FP+RP || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| pfu || 0.25&mu;l<br />
|}<br />
{| border="2"<br />
|-<br />
| Temp || Time<br />
|-<br />
| 94 || 60s<br />
|-<br />
| 94 || 15s<br />
|-<br />
| 50.8 ||20s<br />
|-<br />
| 74 || 45s<br />
|-<br />
| 74 || 300s<br />
|}<br />
|}<br />
*cut gel<br />
<br />
*gel extraction<br />
*digest(xp)<br />
*nanodrop<br />
*ligate<br />
*transform<br />
------------------------<br />
*real pcr for 2 tubes(in suitable temperature)<br />
{| border=1|-<br />
![[Image:NYMU_DSC05723.JPG|250px]] !!<br />
<br />
<br />
{| border="1"<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| FP+RP || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| pfu || 0.25&mu;l<br />
|}<br />
{| border="2"<br />
|-<br />
| Temp || Time<br />
|-<br />
| 94 || 60s<br />
|-<br />
| 94 || 15s<br />
|-<br />
| 50.8 ||20s<br />
|-<br />
| 74 || 45s<br />
|-<br />
| 74 || 300s<br />
|}<br />
|}<br />
<br />
=2010.09.11=<br />
*3in1<br />
------------------------<br />
*two real tubes run gel and cut gel and gel extraction<br />
[[Image:NYMU_DSC05725.JPG|250px]]<br />
<br />
=2010.09.12=<br />
*run gel(length isn't correct)<br />
[[Image:NYMU_DSC05726.JPG|250px]]<br />
*(real PCR) digestion 12:00<br />
*ligation 15:00<br />
*transform 19:40<br />
<br />
=2010.09.13=<br />
*colony PCR 13:25 (3 in 1)<br />
{| border=1|-<br />
![[Image:NYMU_DSC05728.JPG|250px]] !!<br />
<br />
<br />
{| border="1"<br />
! Total:(*2) !! 50&mu;l <br />
|-<br />
| template || 2&mu;l <br />
|-<br />
| VR+VF || 2&mu;l<br />
|-<br />
| dNTP || 2&mu;l<br />
|-<br />
| Buffer || 5&mu;l<br />
|-<br />
| ddH2O || 39.75&mu;l<br />
|-<br />
| tag || 0.25&mu;l<br />
|}<br />
{| border="2"<br />
|-<br />
| Temp || Time<br />
|-<br />
| 94 || 60s<br />
|-<br />
| 94 || 15s<br />
|-<br />
| 55 ||20s<br />
|-<br />
| 72 || 30s ||30 cycle<br />
|-<br />
| 72 || 300s<br />
|}<br />
|}<br />
----------------------<br />
*nanodrop<br />
*ligation 14:00<br />
*Colony PCR 15:00<br />
<br />
=2010.09.22 =<br />
*Real PCR<br />
{| border=1|-<br />
![[Image: DSC05680.JPG|250px ]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.7&mu;l || <br />
|-<br />
| FP || 1&mu;l || 1.7&mu;l || Theophylline Riboswitch Forward Primer <br />
|-<br />
| RP || 1&mu;l || 1.7&mu;l || Theophylline Riboswitch Reverse Primer <br />
|-<br />
| dNTP || 2&mu;l || 3.4&mu;l || <br />
|-<br />
| 10XBuff. || 5&mu;l || 8.5&mu;l || <br />
|-<br />
| pfu || 0.25&mu;l || 0.425&mu;l || <br />
|-<br />
| ddH2O || 39.75&mu;l || 67.575&mu;l || <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 52<br />
| 20s<br />
|- <br />
| 68 <br />
| 30s<br />
| 35 cycles<br />
|-<br />
| 68<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
<br />
*Digest ribo(xp) overnight<br />
*Ligate ribo with vector(xp)<br />
*Transform:23:30<br />
<br />
=2010.09.23=<br />
*Ligate ribo with vector again<br />
*Transform<br />
=2010.09.24=<br />
*3-in-1 (ribo+vector)<br />
*colony PCR<br />
{| border=1|-<br />
![[Image: DSC05682.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.9&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 3.8&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.8&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 9.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.475&mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 75.525&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
-----------------------<br />
*Cut gel(ribo&pSB1A2(xp) digested)<br />
[[Image:DSC05683.JPG|100px]]<br />
[[Image:DSC05684.JPG|100px]]<br />
<br />
=2010.09.26=<br />
*3-in-1(0925 plate)<br />
*colony PCR<br />
{| border=1|-<br />
![[Image:DSC05682.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.5&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 5&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 5&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 1.25mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 99.375&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
=2010.09.27=<br />
*plasmid extraction(RV)<br />
*Digest RV 13:30<br />
*run gel<br />
[[Image:IMG_3189.JPG|250px]]<br />
<br />
There is GFP on vector, so it's wrong.<br />
*Digest ribo again overnight<br />
<br />
=2010.09.28=<br />
*cut gel(ribo& vector)<br />
[[Image:DSC05689.JPG|250px]]<br />
*Ligate ribo with vector<br />
*Transform<br />
According to 0927 gel pic, 30th colony may be correct RV, so we take out second plate and incubate in LB liguid.<br />
*plasmid extraction 21:30<br />
*Digest RV(SP) overnight<br />
<br />
=2010.09.29=<br />
*Ligate RV(sp) with GFP(BBa_J04630 already have terminator)<br />
*Transform<br />
<br />
=2010.09.30=<br />
*Transform BBa_J04630<br />
=2010.10.01=<br />
*3-in-1<br />
**colony PCR<br />
{| border=1|-<br />
![[Image:DSC05690.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.6&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 3.2&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.2&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 8&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.4mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 63.6&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 70s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
=2010.10.02=<br />
*BBa_J04630 plasmid extraction<br />
*Digest J04630(XP)<br />
*cut gel(GFP)<br />
[[Image:DSC05691.JPG|250px]]<br />
*Ligate RV(SP) with GFP(XP)<br />
*Transform<br />
<br />
=2010.10.03=<br />
*FRV(RV+GFP) 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05692.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1,9&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 3.8&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.8&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 9.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.475mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 75.525&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 100s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
=2010.10.04=<br />
*FRV plasmid extraction<br />
*Digest FRV (XP)<br />
*cut gel & purify(FRV)<br />
[[Image:DSC05693.JPG|250px]]<br />
*Ligate FRV with pLac(from ssrA group)<br />
*Transform<br />
-------------------------------------<br />
*pLac plasmid extraction<br />
*Digest pLac(SP) overnight<br />
<br />
=2010.10.05=<br />
*pLac digest purify(run gel with 3-in-1)<br />
*PFRV, GFP, RV 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05695.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
Total: !! 49&mu;l || X2.5&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 5&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 5&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.625mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 99.375&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
-------------------<br />
*Digest pLac(SP) again overnight<br />
<br />
=2010.10.06=<br />
*pLac cut gel<br />
[[Image:DSC05696.JPG|250px]]<br />
*Ligate pLac(SP) with FRV(XP)<br />
*Transform 22:40<br />
------------------------------------<br />
*Digest FRV(XP) overnight<br />
<br />
=2010.10.07=<br />
*FRV(XP) cut gel<br />
[[Image:DSC05697.JPG|250px]]<br />
*Ligate FRV with pLac<br />
*Transform<br />
<br />
=2010.10.08=<br />
*PFRV 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05698.JPG|400px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || 3.8&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || &mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.8&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 9.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.475mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 75.525&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 100s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
------------------------<br />
*Ligate FRV with pLac<br />
*Transform 22:15<br />
<br />
=2010.10.09=<br />
*PFRV 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05699.JPG|400px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X3.8&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 7.6&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 7.6&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 17&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.95mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 151.06&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*colony PCR again<br />
{| border=1|-<br />
![[Image:DSC05700.JPG|400px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X3.8&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 7.6&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 7.6&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 17&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.95mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 151.06&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 180s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*Ligate FRV with pLac again<br />
*Transform<br />
<br />
=2010.10.10=<br />
*PFRV 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05702.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X3.2&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 6.4&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 6.4&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 15&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.8mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 127.2&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94<br />
| 60s<br />
|-<br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 180s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
length is correct!!!<br />
*F colony liquid culture<br />
*FRV liquid culture<br />
------------------------------<br />
*Digest FRV(XP) again<br />
<br />
=2010.10.11=<br />
*FRV&PFRV plasmid extraction<br />
*FRV cut gel<br />
[[Image:DSC05703.JPG|250px]]<br />
*Digest PFRV(XP)&FRV&pSB1C3 <br />
*Ligate PFRV with C3/ FRV with C3/ ribo with C3<br />
*Transform<br />
<br />
=2010.10.12=<br />
*Ligate PFRV with C3/FRV with C3/ribo with C3 again<br />
*Transform 17:25<br />
=2010.10.13=<br />
*PFRC&FRC&RC 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05704.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.7&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 3.4&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.4&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 8&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.425mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 67.575&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94<br />
| 60s<br />
|-<br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
<br />
-------------------------------<br />
*Ligate PFRV,FRV,ribo with C3<br />
*Transform 00:50<br />
-------------------------------<br />
*Digest PFRV(XP)&RV(XP) again overnight<br />
<br />
=2010.10.14=<br />
*PFRV&RV run gel<br />
[[Image:DSC05705.JPG|250px]]<br />
-------------------<br />
*Ligate RV,FRV,PFRV with C3 again<br />
*Transform<br />
<br />
=2010.10.15=<br />
*FRC,RC 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05706.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.5&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 5&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 5&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.625mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 99.375&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
<br />
*3-in-1 again <br />
<br />
{| border=1|-<br />
![[Image:DSC05707.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.5&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 5&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 5&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.625mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 99.375&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
FRC and PFRC are correct, but RC is still incorrect<br />
*PFRC&FRC liquid culture<br />
-------------------------------<br />
*Ligate ribo with C3 again<br />
*Transform<br />
<br />
=2010.10.16=<br />
*Theophylline solution<br />
**Take 1.8012g Theophylline into 15ml DMSO;concentration is 0.67M<br />
*put 15 &mu;l into LB liquid, concentration is 2.5mM;<br />
put 30 &mu;l into LB liquid, concentration is 5mM<br />
-------------------------------<br />
*Ligate ribo(xp) with C3 again<br />
*Transform<br />
<br />
=2010.10.17=<br />
*transform second plate of PFRC into agar plate<br />
positive:C3 30&mu;l+theophylline 0.0027g<br />
<br />
negative:C3<br />
<br />
*PFRC&FRC plasmid extraction<br />
<br />
=2010.10.18=<br />
*PFRC PCR test<br />
{| border=1|-<br />
![[Image:DSC05708.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.3&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 2.6&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 2.6&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 6.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.325mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 51.675&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 90s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*Theophylline in DMSO<br />
**add 1 ml DMSO + Theophylline into 4 ml LB<br />
----------------------------<br />
*Ligate ribo with C3 again<br />
*Transform<br />
----------------------------<br />
*Digest ribo(XP)& C3(XP) <br />
*ribo & C3 cut gel<br />
[[Image:DSC05710.JPG|250px]]<br />
<br />
=2010.10.19=<br />
*Assay Test <br />
{| border=1<br />
|-<br />
! !! O.D/2 || O.D || add to liquid <br />
|-<br />
| PFRC|| 2.503 ||5.006 ||166.5 <br />
|-<br />
| LB || 0 || 0 || <br />
|-<br />
<br />
|}<br />
**Because Theophylline entry into E. coli spend 1 hours at least, O.D= 0.0325<br />
*Assay:add 80 &mu;l PFRC liquid into LB<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.67M) || PFRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| A || 0 mM || 0 || 80.4 ||4 <br />
|-<br />
| B || 0.5 mM || 2.985 &mu;l || 80.4 || 4 <br />
|-<br />
| C || 1 mM || 5.97 &mu;l || 80.4 || 4<br />
|-<br />
| D || 2 mM || 11.94 &mu;l || 80.4 || 4<br />
|-<br />
| E || 4 mM || 23.88 &mu;l || 80.4 || 4<br />
|-<br />
| F || 5 mM || 29.85 &mu;pl || 80,4 ||4<br />
|-<br />
|}<br />
-------------------------------<br />
*10/18 RC 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05711.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.1&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 4.2&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 4.2&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 10.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.525mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 83.475&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
<br />
*PFRC & C liquid culture<br />
--------------------------<br />
*Ligate ribo with C3 again<br />
*Transform<br />
<br />
=2010.10.20=<br />
*Assay<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.67M) || PFRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 mM || 0|| 130 || 4<br />
|-<br />
| A || 0.1 mM || 0.597 &mu;l || 130 || 4 <br />
|-<br />
| B || 0.05 mM || 1.4925 &mu;l || 130|| 4 <br />
|-<br />
| C || 0.5 mM || 2.985 &mu;l || 130 || 4<br />
|-<br />
| D || 1 mM || 5.97 &mu;l || 130 ||4<br />
|-<br />
| E || 2 mM || 11.94 &mu;l || 130 ||4<br />
|-<br />
| F || 4 mM || 23.88 &mu;pl || 130 ||4<br />
|-<br />
| G || 8 mM || 47.76 &mu;l || 130 ||4<br />
|-<br />
|}<br />
culture for 2 hours<br />
*Transform<br />
<br />
=2010.10.21=<br />
*Assay<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.67M) || PFRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M || 0|| 85.7 || 4<br />
|-<br />
| A || 50 &mu;M || 0.2985 &mu;l || 85.7 ||4 <br />
|-<br />
| B || 100 &mu;M || 0.597 &mu;l || 85.7 ||4 <br />
|-<br />
| C || 200 &mu;M || 1.194 &mu;l || 85.7 ||4<br />
|-<br />
| D || 500 &mu;M || 2.985 &mu;l || 85.7 ||4<br />
|-<br />
| E || 1000 &mu;M || 5.97 &mu;l || 85.7 ||4<br />
|-<br />
| F || 2000 &mu;M || 11.94 &mu;l || 85.7 ||4<br />
|-<br />
| G || 4000 &mu;M || 23.88 &mu;l || 85.7 ||4<br />
|-<br />
| H || 8000 &mu;M || 47.76 &mu;l || 85.7 ||4<br />
|-<br />
| I || 10000 &mu;M || 59.7 &mu;l || 85.7 ||4<br />
|-<br />
| J || 20000 &mu;M || 119.4 &mu;l || 85.7 ||4<br />
|- <br />
| K || 40000 &mu;M || 238.8 &mu;l || 85.7 ||4<br />
|}<br />
*10/20 RC 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05712.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.5&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 5&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 5&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 1.25mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 99.375&mu;l<br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*Digest ribo again<br />
<br />
=2010.10.22=<br />
*Digest C3 from PFRC plasmid<br />
*Ligate ribo with C3<br />
*Transform<br />
-------------------------------<br />
*Theophylline solution; concentration is 0.1M<br />
*Assay<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.1M) || PFRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M ||0 || 85.7 || 4<br />
|-<br />
| A || 10 &mu;M || 0.4 &mu;l || 117.7 ||4 <br />
|-<br />
| B || 50 &mu;M || 2 &mu;l || 117.7 ||4 <br />
|-<br />
| C || 100 &mu;M || 4 &mu;l || 117.7 ||4<br />
|-<br />
| D || 200 &mu;M || 8 &mu;l || 117.7 ||4<br />
|-<br />
| E || 500 &mu;M || 20 &mu;l || 117.7 ||4<br />
|-<br />
| F || 1000 &mu;M || 40 &mu;l || 117.7 ||4<br />
|-<br />
| G || 2000 &mu;M || 80 &mu;l || 117.7 ||4<br />
|-<br />
| H || 4000 &mu;M || 160 &mu;l || 117.7 ||4<br />
|-<br />
| I || 8000 &mu;M || 320 &mu;l || 117.7 ||4<br />
|-<br />
| J || 10000 &mu;M || 400 &mu;l || 117.7 ||4<br />
|- <br />
| K || 20000 &mu;M || 800 &mu;l || 117.7 ||4<br />
|}<br />
<br />
* Modified experiment design<br />
<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.1M) || PFRC liquid(&mu;l)||FRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M || 0 || 261 ||0|| 4<br />
|-<br />
| A || 10 &mu;M || 0.4 &mu;l || 261 ||0|| 4 <br />
|-<br />
| B || 50 &mu;M || 2 &mu;l || 261 ||0|| 4 <br />
|-<br />
| C || 100 &mu;M || 4 &mu;l ||261 ||0|| 4<br />
|-<br />
| D || 200 &mu;M || 8 &mu;l || 261 ||0||4<br />
|-<br />
| E || 500 &mu;M || 20 &mu;l || 261 ||0||4<br />
|-<br />
| F || 1000 &mu;M || 40 &mu;pl || 261 ||0||4<br />
|-<br />
| G || 2000 &mu;M || 80 &mu;l || 261 ||0||4<br />
|-<br />
| H || 4000 &mu;M || 160 &mu;l || 261 ||0||4<br />
|-<br />
| I || 8000 &mu;M || 320 &mu;l || 261 ||0||4<br />
|-<br />
| J || 10000 &mu;M || 400 &mu;l ||261 ||0||4<br />
|- <br />
| K || 20000 &mu;M || 800 &mu;l || 261 ||0||4<br />
|-<br />
| NT || 100 &mu;M || 4 &mu;l || 0 || 261 || 4<br />
|-<br />
| N || 0 &mu;M || 0 &mu;l || 0 || 261 || 4<br />
|-<br />
|}<br />
<br />
=2010.10.24=<br />
*ribo 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05713.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X0.9&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 1.8&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 1.8&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 4.5&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.225mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 35.775&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*ribo liquid culture<br />
*colony PCR <br />
{| border=1|-<br />
![[Image:DSC05715.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X1.6&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 3.2&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 3.2&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 8&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.8mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 63&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*Assay<br />
<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.1M) || Remove LB(&mu;l) || PFRC liquid(&mu;l)||FRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M || 0 || 325 || 325 ||0|| 4<br />
|-<br />
| A || 10 &mu;M || 0.4 &mu;l || 325|| 325 ||0|| 4 <br />
|-<br />
| B || 50 &mu;M || 2 &mu;l || 327||325 ||0|| 4 <br />
|-<br />
| C || 100 &mu;M || 4 &mu;l ||329 ||325 ||0|| 4<br />
|-<br />
| D || 200 &mu;M || 8 &mu;l || 333||325 ||0||4<br />
|-<br />
| E || 500 &mu;M || 20 &mu;l || 345||325 ||0||4<br />
|-<br />
| F || 1000 &mu;M || 40 &mu;pl || 365||325 ||0||4<br />
|-<br />
| G || 2000 &mu;M || 80 &mu;l || 405||325 ||0||4<br />
|-<br />
| H || 4000 &mu;M || 160 &mu;l || 485||325 ||0||4<br />
|-<br />
| I || 8000 &mu;M || 320 &mu;l || 645||325 ||0||4<br />
|-<br />
| J || 10000 &mu;M || 400 &mu;l ||725 ||325 ||0||4<br />
|- <br />
| K || 20000 &mu;M || 800 &mu;l ||1125 ||325 ||0||4<br />
|-<br />
| NT || 100 &mu;M || 4 &mu;l || 504 || 0 || 500 || 4<br />
|-<br />
| N || 0 &mu;M || 0 &mu;l ||500 || 0 || 500 || 4<br />
|-<br />
|}<br />
---------------------------<br />
*Digest RV(XP)& FRC(XP)<br />
*Ligate ribo with C3<br />
*transform<br />
--------------------------------<br />
*PFRC&FRC liquid culture<br />
<br />
=2010.10.25=<br />
*RC 3-in-1<br />
{| border=1|-<br />
![[Image:DSC05716.JPG|250px]] !!<br />
{| border="1"<br />
|-<br />
! Total: !! 49&mu;l || X2.4&mu;l <br />
|-<br />
| VR+VF|| 2&mu;l || 4.8&mu;l <br />
|-<br />
| dNTP || 2&mu;l || 4.8&mu;l <br />
|-<br />
| 10XBuff. || 5&mu;l || 12&mu;l <br />
|-<br />
| tag || 0.25&mu;l || 0.6mu;l <br />
|-<br />
| ddH2O || 39.75&mu;l || 95.4&mu;l <br />
|}<br />
{| border="2"<br />
|- <br />
! PCR Protocol !! <br />
|-<br />
| 94 <br />
| 60s<br />
|- <br />
| 94 <br />
| 15s<br />
|- <br />
| 55<br />
| 20s<br />
|- <br />
| 72 <br />
| 30s<br />
| 30 cycles<br />
|-<br />
| 72<br />
| 300s<br />
|-<br />
|}<br />
<br />
|}<br />
<br />
<br />
*FRC&PFRC&RC liquid culture<br />
<br />
<br />
*Assay<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.1M) || Remove LB(&mu;l) || PFRC liquid(&mu;l)|| FRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M || 0 || 151 || 147 || 0 || 4<br />
|-<br />
| A || 50 &mu;M || 2 &mu;l || 153|| 147 ||0 ||4 <br />
|-<br />
| B || 500 &mu;M || 20 &mu;l || 171||147 ||0 ||4 <br />
|-<br />
| C || 1000 &mu;M || 40 &mu;l ||191 ||147 ||0 ||4<br />
|-<br />
| D || 4000 &mu;M || 160 &mu;l || 311||147 ||0 ||4<br />
|-<br />
| E || 10000 &mu;M || 400 &mu;l || 551||147 ||0 ||4<br />
|-<br />
| NT || 100 &mu;M || 4 &mu;l ||158 || 0||150 || 4<br />
|-<br />
| N || 0 &mu;M || 0 &mu;l ||154 ||0||150 || 4<br />
|-<br />
|}<br />
<br />
=2010.10.26=<br />
*Assay<br />
{| border=1<br />
|-<br />
! !! Theophylline concentration || Theophylline(0.1M) || Remove LB(&mu;l) || PFRC liquid(&mu;l)|| FRC liquid(&mu;l)|| Cm50(&mu;l) <br />
|-<br />
| O || 0 &mu;M || 0 || 151 || 147 || 0 || 4<br />
|-<br />
| A || 50 &mu;M || 2 &mu;l || 153|| 147 ||0 ||4 <br />
|-<br />
| B || 500 &mu;M || 20 &mu;l || 171||147 ||0 ||4 <br />
|-<br />
| C || 1000 &mu;M || 40 &mu;l ||191 ||147 ||0 ||4<br />
|-<br />
| D || 4000 &mu;M || 160 &mu;l || 311||147 ||0 ||4<br />
|-<br />
| E || 10000 &mu;M || 400 &mu;l || 551||147 ||0 ||4<br />
|-<br />
| NT || 100 &mu;M || 4 &mu;l ||158 || 0||150 || 4<br />
|-<br />
| N || 0 &mu;M || 0 &mu;l ||154 ||0||150 || 4<br />
|-<br />
|}<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T16:42:27Z<p>V225522: /* Reporting Assay */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline in order to eliminate the spectrum effect of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized by the control N line and NT line.<br />
<br />
==Reporting Assay1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
<br />
==Reporting Assay2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T16:41:16Z<p>V225522: /* Reporting Assay */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline. <br />
*Fig.2, fig.4, fig.6, and fig.8 are charts which have been normalized by the control N line and NT line.<br />
<br />
==Reporting Assay1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
<br />
==Reporting Assay2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522http://2010.igem.org/Team:NYMU-Taipei/Experiments/Speedy_switchTeam:NYMU-Taipei/Experiments/Speedy switch2010-10-27T16:40:53Z<p>V225522: /* Reporting Assay */</p>
<hr />
<div>{{:Team:NYMU-Taipei/Header}}<br />
<br />
=Method =<br />
*Protocol: <br />
<br />
1.Selected genes to be reported are incubated overnight in an LB liquid culture at 37oC and 180-200rpm. This makes sure they are fresh in the morning. Positive and negative controls are also needed. <br />
<br />
2.Overnight liquid culture is diluted to OD600 of 0.1, Theophylline is added at concentrations ranging from 0.01mM to 20mM, and the mix incubated for 2-2.5 hours. <br />
<br />
3.Measurement of OD at 2 hours: For each used well in the 96-well plate: <br />
Take 200uL from the liquid (make sure you pipette this step well) and put it in a cuvette to read the OD600. <br />
Note down the OD600 ["OD at 2 hours"], then take the liquid in the cuvette and put it in the right place in the 96-well plate. <br />
<br />
4.Measurement of fluorescence: <br />
Continuous measurement of fluorescence with the excitation/emission wavelengths 488/511nm for 2 hours, with one fluorescence data point every 2 minutes.<br />
<br />
5.Measurement of OD at 4 hours: For each used well in the 96-well plate: <br />
Take the liquid from the well and put it in the cuvette to measure the OD ["OD at 4 hours"].<br />
<br />
=Reporting Assay=<br />
*Fig.1, fig.3, fig.5, and fig.7 are the original charts of the experiment. N line and NT line are control line. N line stands for the cell which sequence doesn't have pLac promoter.NT line stands for the cell which sequence doesn't have promoter but added 0.1mM Theophylline. N line shows that even though the sequence doesn't have promoter it still have little fluorescence so we use it to modify the instrument errors. 0μM sample which sequence has promoter but doesn’t added Theophylline still has little fluorescence because mRNA is leak. Normalizing with the N, we use this line to find out what's the degree of mRNA leak. NT line which doesn’t have promoter in the plasmid but add 0.1 mM Theophylline still is detected fluorescence. We added Theophylline in DMSO, so we use this NT line to normalize the other samples which added different concentration of Theophylline. <br />
*Fig.2,fig.4,fig.6,and fig.8 are charts which have been normalized by the control N line and NT line.<br />
<br />
==Reporting Assay1==<br />
*[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.22 reagent formula]<br />
<br />
<br />
* The oringinal fluorescence data.<br />
[[Image:20101023(org).png|800px]][fig.1]<br />
<br />
* Normalized the 12 different Theophylline concentration samples with NT & N.<br />
[[Image:Plot20101023.png|800px]][fig.2]<br />
<br />
==Reporting Assay2==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.24 Reagent Formula]]<br />
<br />
*The original fluorescence data.<br />
[[Image:20101024(org).png|800px ]][fig.3]<br />
*Normalized 12 different concentration of Theophylline with NT & N.<br />
[[Image:20101024.png|800px ]][fig.4]<br />
<br />
==Reporting Assay3==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.25 reagent formula]]<br />
<br />
*The oringinal fluorescence data. <br />
[[Image:20101025(org).png|800px]][fig.5]<br />
<br />
*Normalized the 6 different Theophylline concentration samples with NT & N. <br />
[[Image:20101025.png|800px]][fig.6]<br />
<br />
==Repoting Assay4==<br />
*[[https://2010.igem.org/Team:NYMU-Taipei/Experiments/Riboswitch#2010.10.26 Reagent Formula]]<br />
*The original fluorescence data.<br />
[[Image:20101026(org).png|800px]][fig.7]<br />
<br />
*Normalized 6 different concentration of Theophylline with NT & N.<br />
[[Image:20101026.png|800px]][fig.8]<br />
<br />
{{:Team:NYMU-Taipei/Footer}}</div>V225522