http://2010.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=50&target=Rudolf2010.igem.org - User contributions [en]2024-03-29T12:13:13ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:Heidelberg/Notebook/Material/PrimerTeam:Heidelberg/Notebook/Material/Primer2010-10-28T03:59:56Z<p>Rudolf: /* ViroBytes primers */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
<br />
{{:Team:Heidelberg/tables|normal=FFF|highlight=ddd}}<br />
<br />
{{:Team:Heidelberg/Single_Pagetop|note_primer}}<br />
<br />
__NOTOC__<br />
<br />
==Primer Table==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified !! origin !! for backbone<br />
|-<br />
|align="right"| 001 || Casp8FWEcoR1 || ttttgaattcatggacttcagcagaaatc || Caspase8 death gene || Caspase8 ||<br />
|-<br />
|align="right"| 002 || CMV_AgeI_fw || ttttaccggtagaatctgcttagggttagg || CMV, shRNA || pcDNA5/FRT-shRNA || pTR-UF3 <br />
|-<br />
|align="right"| 003 || CMVshRNApA_BglII_rv || taatagatctcagaagccatagagcccacc || CMV, shRNA || pcDNA5/FRT-shRNA || pTR-UF3<br />
|-<br />
|align="right"| 004 || EGFPRVFse1 || ttttggccggcccttgtacagctcgtccatg || EGFP || GFP ||<br />
|-<br />
|align="right"| 005 || ElenasFirstSyntheticRNA_F || aatatgtctaaactattatttatgccaaccagccaatctagctactgctaggc || part 2 Elenas first synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 006 || ElenasFirstSyntheticRNA_R || aataatagtttagacatatttatgccagccagccagaccagctctgctaagg || part 3 Elenas first synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 007 || ElenasSecondSyntheticRNA_F || gacatgtctaaactattgtcttcggtagcgtcgtagactagctactgctaggc || part 2 Elenas second synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 008 || ElenasSecondSyntheticRNA_R || gacaatagtttagacatgtcttcggtatcgtcgtatcccagctctgctaagg || part 3 Elenas second synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 009 || ElenasThirdSyntheticRNA_F || tatttgtctaaactataataattcgcggctggcctgactagctactgctaggc || part 2 Elenas third synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 010 || ElenasThirdSyntheticRNA_R || tattatagtttagacaaataattcgcgtctggccttcccagctctgctaagg || part 3 Elenas third synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 011 || ElenasFifthSyntheticRNA_F || tatttgtctaaactataataattcgcggctggcctgactagctactgctaggc || part 2 Elenas fifth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 012 || ElenasFifthSyntheticRNA_R || atctatagtttagacaagatgaaacgccgagttaacgccagctctgctaagg || part 3 Elenas fifth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 013 || ElenasSixthSyntheticRNA_F || ttattgtctaaactatataactgccgtaactccaaatctagctactgctaggc || part 2 Elenas sixth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 014 || ElenasSixthSyntheticRNA_R || ttatatagtttagacaataactgccgtcactccaacgccagctctgctaagg || part 3 Elenas sixth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 015 || ElenasSeventhSyntheticRNA_F || atcttgtctaaactatagataactgccatcactccccctagctactgctaggc || part 2 Elenas seventh synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 016 || ElenasSeventhSyntheticRNA_R || atctatagtttagacaagataactgccgtcactccaaccagctctgctaagg || part 3 Elenas seventh synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 017 || ElenasEighthSyntheticRNA_F || tacatgtctaaactattgtagtcggttcatgcagcccctagctactgctaggc || part 2 Elenas eighth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 018 || ElenasEighthSyntheticRNA_R || tacaatagtttagacatgtagtcggtttatgcagcaaccagctctgctaagg || part 3 Elenas eighth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 019 || ElenasNinethSyntheticRNA_F || aaattgtctaaactatatttgatccagagatacagaactagctactgctaggc || part 2 Elenas nineth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 020 || ElenasNinethSyntheticRNA_R || aaatatagtttagacaatttgatccagcgatacagcgccagctctgctaagg || part 3 Elenas nineth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 021 || ElenasTenthSyntheticRNA_F || attatgtctaaactattaatatcggtgaccgtggtacctagctactgctaggc || part 2 Elenas tenth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 022 || ElenasTenthSyntheticRNA_R || attaatagtttagacataatatcggtggccgtggtgtccagctctgctaagg || part 3 Elenas tenth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 023 || FADDFWEcoR1 || ttttgaattcatgggcggtaggcgtgtacg || FADD || || <br />
|-<br />
|align="right"| 024 || gE1A-Fse1_rev || tttttccggccggttatggcctggggcctttaca || E1A rescue gene || || <br />
|-<br />
|align="right"| 025 || Hcrfor_HindIII_AgeI_TL || gagtcaagcttaccggttggaggtgaagttaacaccttcgtg || part 1 shRNA against everything; cutting site: HindIII, AgeI || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 026 || Hcrrev_ApaI_SalI_TL || ctcgagggcccgtcgacaagcaaacgatgccaagacatttatcg || part 4 shRNA against everything; cutting site: ApaI, SalI || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 027 || HSVluc_norm_BglII_fw || tttttagatcttgcaggagcttcagggagtg || HSV-TK, ''Firefly'' Luciferase || psiCHECK2 || pTR-UF3<br />
|-<br />
|align="right"| 028 || HSVluc_norm_BglII_rv || ttttagatctggttccgcgcacatttccc || HSV-TK, ''Firefly'' Luciferase || psiCHECK2 || pTR-UF3<br />
|-<br />
|align="right"| 029 || Kif11_PLK1_shRNA-hcrfor:ecoRI || gagtcgaattctggaggtgaagttaacaccttcgtg || part 1 shRNA against everything; cutting site: ecoRI || miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 030 || Kif11&PLK1_shRNA_hcrrev:XbaI || ctcgaagatctaagcaaacgatgccaagacatttatcg || part 4 shRNA against everything; cutting site: XbaI || miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 031 || Kif11_shRNA_forward || actctgtctaaactatgagtacattaaacaattcctattagctactgctaggc || part 2 shRNA against Kif11 || miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 032 || Kif11_shRNA_reverse || actcatagtttagacagagtacattaatcaattccattcagctctgctaagg || part3 shRNA against Kif11 || miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 033 || PLK1_shRNA_forward || atgatgtctaaactattcattaagcagatcgttaaccgtagctactgctaggc || part2 shRNA against PLK1|| miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 034 || PLK1_shRNA_reverse || atgaatagtttagacatcattaagcagctcgttaatggcagctctgctaagg || part3 shRNA against PLK1|| miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 035 || pTR-UF3_Nsp1_for || ctattacgccagctggatgcatcccagctgc || for pTR-UF3 backbone Pst1->Nsi1 mutation || || <br />
|-<br />
|align="right"| 036 || pTR-UF3_Nsp1_rev || gcagctgggatgcatccagctggcgtaatag || for pTR-UF3 backbone Pst1->Nsi1 mutation || || <br />
|-<br />
|align="right"| 037 || pTR-UF3_PstI-NsiI_for || gctattacgccagctggatgcatcccagctgcattaatgaatcgg || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3 <br />
|-<br />
|align="right"| 038 || pTR-UF3_PstI-NsiI_rev || ccgattcattaatgcagctgggatgcatccagctggcgtaatagc || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3 <br />
|-<br />
|align="right"| 039 || pTR-UF3_PstI-NsiI_shifted_rev || cattaatgcagctgggatgcatccagctggcgtaatagcgaagag || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3<br />
|-<br />
|align="right"| 040 || pTRUF3_seq_fwrv || caactccatcactaggggttcct || sequencing purpose || pTR-UF3 || pTR-UF3<br />
|-<br />
|align="right"| 041 || SCLpsv40_FW || ctcaattagtcagcaaccatagtccc || FWprimer for testing stable integration of shRNA into T-Rex || || T-REx cells <br />
|-<br />
|align="right"| 042 || SCLpsv40_FW || gcaaagtgccgataaacataacgatct || RVprimer for testing stable integration of shRNA into T-Rex || || T-REx cells <br />
|-<br />
|align="right"| 043 || Sequencing primer_pTR-UF3 mutated || ctaaatcggaaccctaaagggagcccccg || sequencing of mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3<br />
|-<br />
|align="right"| 044 || Sv40lucmcs_AgeI_fw || ttttaccggtgtggaatgtgtgtcagttag || SV40, ''Renilla'' Luciferase, MCS || pTR-UF3 ||<br />
|-<br />
|align="right"| 045 || Sv40lucmcs_BglII_rv || tattagatctccgcgtcagacaaaccctaac || SV40, ''Renilla'' Luciferase, MCS || psiCHECK2 || pTR-UF3<br />
|-<br />
|align="right"| 046 || tBidGFPRVFse1 || tttttggccggccttacatgtacagctcg || tBid death gene || pcherryBidGFP ||<br />
|-<br />
|align="right"| 047 || tBidFWEcoR1 || tttttgaattcaaccgcagcagccactc || tBid death gene || pcherryBidGFP ||<br />
|-<br />
|align="right"| 048 || tBidRVFse1 || tttttccggccgggtccatcccatttctg || tBid death gene || pcherryBidGFP ||<br />
|-<br />
|align="right"| 049 || TetO2FW || ggggacaacttttctatacaaagttgtccctatcagtgatagagatctc || TetO8 || synthesized tetO8 || Gateway entry vector <br />
|}<br />
<br />
==Standart Kit Cloning Primers==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3') <br />
|-<br />
|align="right"| D001 || backbone_AvrII_fw || ttttcctaggtagcggcgcattaagcgcgg <br />
|-<br />
|align="right"| D002 || backbone_AvrII_rev || ttttcctaggcttgttgtagcttaaattttg <br />
|-<br />
|align="right"| D003 || backbone_ClaI_fw || ttttatcgattagcggcgcattaagcgcgg <br />
|-<br />
|align="right"| D004 || backbone_XhoI_rev || ttttctcgagcttgttgtagcttaaattttg <br />
|-<br />
|align="right"| D005 || BBB_Oligo_XhoI || ccggActgcagcggccgcgcgctagcacactagtgcggccgcgaattCa <br />
|-<br />
|align="right"| D006 || BBB_Oligo_XmaI || tcgatgaattcgcggccgcactagtgtgctagcgcgcggccgctgcagt <br />
|-<br />
|align="right"| D007 || BBB_Oligo_XmaI || tcgatgaattcgcggccgcactagtgtgctagcgcgcggccgctgcagt <br />
|-<br />
|align="right"| D008 || BBB_suffix_reverse || aaaactgcagcggccgcgc <br />
|-<br />
|align="right"| D009 || BGH_pA_BamHI_rc_fw || ttttgaattcgcggccgcactagtggatccccatagagcccaccgcatccc <br />
|-<br />
|align="right"| D010 || BGH_pA_fw || ttttgaattcgcggccgcactagttttaaacccgctgatcagcc <br />
|-<br />
|align="right"| D011 || BGH_pA_rev || ttttctgcagcggccgcgctagcccatagagcccaccgcatccc <br />
|-<br />
|align="right"| D012 || BGH_pA_rc_rev || ttttctgcagcggccgcgctagctttaaacccgctgatcagcc <br />
|-<br />
|align="right"| D013 || biCMV_BBB_fw || ttttgaattcgcggccgcactagtgcgatctgacggttcactaaacg <br />
|-<br />
|align="right"| D014 || biCMV_BBB_fw || ttttgaattcgcggccgcactagtgcgatctgacggttcactaaacg <br />
|-<br />
|align="right"| D015 || biCMV_BBB_rev || ttttctgcagcggccgcgcgctagcacagcggatctgacggttcac <br />
|-<br />
|align="right"| D016 || biCMV_rc_BBB_fw || ttttgaattcgcggccgcactagtagcggatctgacggttcac <br />
|-<br />
|align="right"| D017 || biCMV_rc_BBB_rev || ttttctgcagcggccgcgctagcgcgatctgacggttcac <br />
|-<br />
|align="right"| D018 || CMV_BBB_BamHI_fw || gaattcgcggccgcactagtggatcccgatgtacgggccagatatacg <br />
|-<br />
|align="right"| D019 || CMV_BBB_fw || ttttgaattcgcggccgcactagtcgatgtacgggccagatatacg <br />
|-<br />
|align="right"| D020 || CMV_BBB_rev || ttttctgcagcggccgcgcgctagcacatttcgataagccagtaagc <br />
|-<br />
|align="right"| D021 || CMV_Teto2_BBB_fw || tttt gaattcgcggccgcactagtgttgacattgattattgtctag <br />
|-<br />
|align="right"| D022 || CMV_TetO2_BBB_rev || tttt ctgcagcggccgcgcgctagcaccggaggctggatcggtc <br />
|-<br />
|align="right"| D023 || CMV_rc_BBB_fw || ttttgaattcgcggccgcactagtatttcgataagccagtaagc <br />
|-<br />
|align="right"| D024 || CMV_rc_BBB_rev || ttttctgcagcggccgcgctagccgatgtacgggccagatatacg <br />
|-<br />
|align="right"| D025 || FRT_rev || ctgcagcggccgcgctagcccaaggaagttcctatactttc <br />
|-<br />
|align="right"| D026 || FRT_rev || gaattcgcggccgcactagtttctcgccacgttcgccggc <br />
|-<br />
|align="right"| D027 || hRluc_ter_BBB_fw || ttttgaattcgcggccgcactagtatggcttccaaggtgtacgac <br />
|-<br />
|align="right"| D028 || hRluc_ter_BBB_rev || ttttctgcagcggccgcgctagcttactgctcgttcttcagcacgc <br />
|-<br />
|align="right"| D029 || hsa-mir-122_BBB(perf) || ttttgaattcgcggccgcactagtcaaacaccattgtcacactccagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D030 || hsa-mir-122_BBB(rand9-12) || ttttgaattcgcggccgcactagtcaaacaccatnnnnacactccagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D031 || hsa-mir-122_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnnacactccagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D032 || hsa-mir-122_Sgf_Not(perf) || ttttgcgatcgccaaacaccattgtcacactccagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D033 || hsa-mir-122_Sgf_Not(rand9-12) || ttttgcgatcgccaaacaccatnnnnacactccagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D034 || hsa-mir-122_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnnnacactccagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D035 || hsa-mir-375_BBB(perf) || ttttgaattcgcggccgcactagttcacgcgagccgaacgaacaaagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D036 || hsa-mir-375_BBB(rand9-12) || ttttgaattcgcggccgcactagttcacgcgagcnnnncgaacaaagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D037 || hsa-mir-375_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnncgaacaaagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D038 || hsa-mir-375_Sgf_Not(perf) || ttttgcgatcgctcacgcgagccgaacgaacaaagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D039 || hsa-mir-375_Sgf_Not(rand9-12) || ttttgcgatcgctcacgcgagcnnnncgaacaaagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D040 || hsa-mir-375_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnnncgaacaaagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D041 || hsa-mir-376a_BBB(perf) || ttttgaattcgcggccgcactagtacgtggattttcctctatgatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D042 || hsa-mir-376a_BBB(rand9-12) || ttttgaattcgcggccgcactagtacgtggattnnnntctatgatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D043 || hsa-mir-376a_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnntctatgatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D044 || hsa-mir-376a_Sgf_Not(perf) || ttttgcgatcgcacgtggattttcctctatgatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D045 || hsa-mir-376a_Sgf_Not(rand9-12) || ttttgcgatcgcacgtggattnnnntctatgatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D046 || hsa-mir-376a_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnntctatgatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D047 || igem20100723_01 || tgccacctgacgtctaagaa <br />
|-<br />
|align="right"| D048 || igem20100723_02 || attaccgcctttgagtgagc <br />
|-<br />
|align="right"| D049 || Luc2_ter_BamHI_BBB_rev || ttttctgcagcggccgcgctagcggatcctaccacatttgtagaggttttac <br />
|-<br />
|align="right"| D050 || Luc2_ter_BamHI_BBB_rev || ttttctgcagcggccgcgctagcggatcctaccacatttgtagaggttttac <br />
|-<br />
|align="right"| D051 || Luc2_ter_BBB_fw || ttttgaattcgcggccgcactagtgccaccatggaagatgcc <br />
|-<br />
|align="right"| D052 || mir122_miMeasure_screen_fev || ccgcgctagctggagtgt <br />
|-<br />
|align="right"| D053 || Oligo_Xba_mut_fw || ctagcctcgagttctgaccgccccgggg <br />
|-<br />
|align="right"| D054 || Oligo_Xba_mut_rev || ctagccccggggcggtcagaactcgagg <br />
|-<br />
|align="right"| D055 || pSMB_miMeasure_Screen_fw || gcacaagctggagtacaactac <br />
|-<br />
|align="right"| D056 || pSMB_miMeasure_Screen_rev || ggtttcccgactggaaagcg <br />
|-<br />
|align="right"| D057 || RSV_fw || ttttgaattcgcggccgcactagtcaattctcatgtttgacagc <br />
|-<br />
|align="right"| D058 || RSV_rev || ttttctgcagcggccgcgctagccagcttggaggtgcacacc <br />
|-<br />
|align="right"| D059 || RSV_rc_fw || ttttgaattcgcggccgcactagtcagcttggaggtgcacacc <br />
|-<br />
|align="right"| D060 || RSV_rc_rev || ttttctgcagcggccgcgctagccaattctcatgtttgacagc <br />
|-<br />
|align="right"| D061 || RSV_fw_midcomp || cgaaccactgaataccgcattgcag <br />
|-<br />
|align="right"| D062 || RSV_rev_midcomp || ctgcaatgcggtattcagtggttcg <br />
|-<br />
|align="right"| D063 || SB-prep-3P || gccgctgcagtccggcaaaaaaacg <br />
|-<br />
|align="right"| D064 || SB-prep-2Ea || atgaattccagaaatcatccttagcg <br />
|-<br />
|align="right"| D065 || second_strand_notI || agttgtgacatagcggccgc <br />
|-<br />
|align="right"| D066 || shRNA-6th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnncgtcaatagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D067 || shRNA-7th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnntcaatagagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D068 || shRNA-8th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnngctgatgtgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D069 || shRNA-9th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnnctagtttagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D070 || shRNA-10th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnngctataatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D071 || shRNA-6th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcgcaacctcactgccgtcaatagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D072 || shRNA-7th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcaacctcactgccgtcaatagagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D073 || shRNA-8th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcaacgacgtatttggctgatgtgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D074 || shRNA-9th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcgcgacatagcgacctagtttagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D075 || shRNA-10th-bs(perf)_BBB || ttttgaattcgcggccgcactagtctgtggtgccggtggctataatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D076 || shRNA-6th-bs(rand9-12)_BBB || gcgatcgccgcaacctcannnncgtcaatagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D077 || shRNA-7th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcaacctcactnnnntcaatagagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D078 || shRNA-8th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcaacgacgtannnngctgatgtgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D079 || shRNA-9th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcgcgacatagnnnnctagtttagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D080 || shRNA-10th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtctgtggtgccnnnngctataatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D081 || shRNA-6th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnncgtcaatagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D082 || shRNA-7th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnntcaatagagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D083 || shRNA-8th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnngctgatgtgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D084 || shRNA-9th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnnctagtttagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D085 || shRNA-10th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnngctataatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D086 || shRNA-6th-bs(perf)_SgfI_NotI || gcgatcgccgcaacctcactgccgtcaatagcggccgctatgtcacaact<br />
|-<br />
|align="right"| D087 || shRNA-7th-bs(perf)_SgfI_NotI || gcgatcgccaacctcactgccgtcaatagagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D088 || shRNA-8th-bs(perf)_SgfI_NotI || gcgatcgccaacgacgtatttggctgatgtgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D089 || shRNA-9th-bs(perf)_SgfI_NotI || gcgatcgccgcgacatagcgacctagtttagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D090 || shRNA-10th-bs(perf)_SgfI_NotI || gcgatcgcctgtggtgccggtggctataatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D091 || shRNA-6th-bs(rand9-12)_SgfI_NotI || gcgatcgccgcaacctcannnncgtcaatagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D092 || shRNA-7th-bs(rand9-12)_SgfI_NotI || gcgatcgccaacctcactnnnntcaatagagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D093 || shRNA-8th-bs(rand9-12)_SgfI_NotI || gcgatcgccaacgacgtannnngctgatgtgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D094 || shRNA-9th-bs(rand9-12)_SgfI_NotI || gcgatcgccgcgacatagnnnnctagtttagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D095 || shRNA-10th-bs(rand9-12)_SgfI_NotI || gcgatcgcctgtggtgccnnnngctataatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D096 || shRNA_AflII_BBB_fw || ttttctgcagcggccgcgcgctagccttaagtggaggtgaagttaacaccttcgtg <br />
|-<br />
|align="right"| D097 || shRNA_HindIII_BBB_rev || ttttgaattcgcggccgcactagtaagcttaagcaaacgatgccaagacatttatcg <br />
|-<br />
|align="right"| D098 || SV40_BamHI_BBB_fw || ctgcagcggccgcgctagcggatccaagctttttgcaaaagcctagg <br />
|-<br />
|align="right"| D099 || SV40_BBB_rev || ttttctgcagcggccgcgctagcaagctttttgcaaaagcctaggc <br />
|-<br />
|align="right"| D100 || SV40_rc_BBB_fw || ttttgaattcgcggccgcactagtaagctttttgcaaaagcc <br />
|-<br />
|align="right"| D101 || SV40_rc_BBB_rev || ttttctgcagcggccgcgctagcgcgcagcaccatggcctg <br />
|-<br />
|align="right"| D102 || SV40_term_fw || ttttgaattcgcggccgcactagtcagacatgataagatacattg <br />
|-<br />
|align="right"| D103 || SV40_Xho_Xma_BBB_fw || gaattcgcggccgcactagtctcgagtttctcccggggcgcagcaccatggcctg <br />
|-<br />
|align="right"| D104 || TetRepressor (from pcDNA6)fw || ttttgaattcgcggccgcactagtgccaccatgtctagattagataaaag <br />
|-<br />
|align="right"| D105 || TetRepressor (from pcDNA6)rew || ttttctgcagcggccgcgctagcttaataagatctaaattcccgcgatccgc <br />
|}<br />
<br />
==ViroBytes primers==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified fragment !! direction !! cap gene of AAV<br />
|-<br />
|align="right"| R001 || Anchor12689 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaacTACCG || anchor || - ||<br />
|-<br />
|align="right"| R002 || Anchor4 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaactactg || anchor || - ||<br />
|-<br />
|align="right"| R003 || Anchor5 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaactacag || anchor || - ||<br />
|-<br />
|align="right"| R004 || Anchor_comp_all || gttaattaacgaatgctagtcactcagacaagctt || anchor || - ||<br />
|-<br />
|align="right"| R005 || F1_for_cap12689 || gctacggtctcaatggctgccgatggttatcttccag || 1 || forward || 1,2,6,8,9<br />
|-<br />
|align="right"| R006 || F1_for_cap5 || gctacggtctcaatggctgccgatggttatcttccag || 1 || forward || 5<br />
|-<br />
|align="right"| R007 || F1_rev_cap2 || gctacggtctcgctcctgaaactcggcgtcggcgtgg || 1 || reverse || 2<br />
|-<br />
|align="right"| R008 || F1_rev_cap5 || gctacggtctctctcctgaaactcggcgtccgcgtgg || 1 || reverse || 5<br />
|-<br />
|align="right"| R009 || F1_rev_cap9 || gctacggtctcgctcctggaactcggcgtcggcgtgg || 1 || reverse || 9<br />
|-<br />
|align="right"| R010 || F1_rev_cap168 || gctacggtctcgctcctgaaactcggcgtcggcgtgg || 1 || reverse || 1,6,8<br />
|-<br />
|align="right"| R011 || F2_for_cap2 || gctacggtctctggagcgccttaaagaagatacgtcttttggggg || 2 || forward || 2<br />
|-<br />
|align="right"| R012 || F2_for_cap5 || gctacggtctctggagaagctcgccgacgacacatccttcggggg || 2 || forward || 5<br />
|-<br />
|align="right"| R013 || F2_for_cap9 || gctacggtctctggagcggctcaaagaagatacgtcttttggggg || 2 || forward || 9<br />
|-<br />
|align="right"| R014 || F2_for_cap168 || gctacggtctctggagcgtctgcaagaagatacgtcttttggggg || 2 || forward || 1,6,8<br />
|-<br />
|align="right"| R015 || F2_rev_cap2 || gctacggtctcgtgtcgcccatccatgtggaatcgcaatgc || 2 || reverse || 2<br />
|-<br />
|align="right"| R016 || F2_rev_cap5 || gctacggtctcgtgtcccccatccacgtggaatcgcaatgc || 2 || reverse || 5<br />
|-<br />
|align="right"| R017 || F2_rev_cap9 || gctacggtctcgtgtcccccagccattgggaatcgcaatgc || 2 || reverse || 9<br />
|-<br />
|align="right"| R018 || F2_rev_cap168 || gctacggtctcgtgtcgcccagccatgtggaatcgcaatgc || 2 || reverse || 1,6,8<br />
|-<br />
|align="right"| R019 || F3_for_cap5 || gctacggtctccgacagagtcatcaccaccagcacccg || 3 || forward || 5<br />
|-<br />
|align="right"| R020 || F3_for_cap9 || gctacggtctccgacagagtcatcaccaccagcacccg || 3 || forward || 9<br />
|-<br />
|align="right"| R021 || F3_for_cap1268 || gctacggtctccgacagagtcatcaccaccagcacccg || 3 || forward || 1,2,6,8<br />
|-<br />
|align="right"| R022 || F3_rev_cap1 || gctacggtctcaggttattagcgatggttgtgacgccatcattcgtc || 3 || reverse || 1<br />
|-<br />
|align="right"| R023 || F3_rev_cap2 || gctacggtctcaggttattggcaatcgtcgtcgtaccgtcattctgc || 3 || reverse || 2<br />
|-<br />
|align="right"| R024 || F3_rev_cap5 || gctacggtctcaggttgttggcgatggtggtggtggagtcctgcac || 3 || reverse || 5<br />
|-<br />
|align="right"| R025 || F3_rev_cap6 || gctacggtctcaggttattagcgatggtcgtgacgccatcattcgtc || 3 || reverse || 6<br />
|-<br />
|align="right"| R026 || F3_rev_cap8 || gctacggtctcaggttattggcgatggtcttggtgccttcattctgc || 3 || reverse || 8<br />
|-<br />
|align="right"| R027 || F3_rev_cap9 || gctacggtctcaggttattggcgatggtcttgactccattgttgtcc || 3 || reverse || 9<br />
|-<br />
|align="right"| R028 || F4_for_cap2 || gctacggtctctaaccttaccagcacggttcaggtgtttactgactc || 4 || forward || 2<br />
|-<br />
|align="right"| R029 || F4_for_cap5 || gctacggtctccaacctcacctccaccgtccaagtgtttacggacga || 4 || forward || 5<br />
|-<br />
|align="right"| R030 || F4_for_cap8 || gctacggtctctaacctcaccagcaccatccaggtgtttacggactc || 4 || forward || 8<br />
|-<br />
|align="right"| R031 || F4_for_cap9 || gctacggtctctaaccttaccagcacggtccaggtcttcacggactc || 4 || forward || 9<br />
|-<br />
|align="right"| R032 || F4_for_cap16 || gctacggtctctaaccttaccagcacggttcaagtcttctcggactc || 4 || forward || 1,6<br />
|-<br />
|align="right"| R033 || F4_reverse_cap1 || gctacggtctcagctgctgtggaaaggcacttcctcaaaggtg || 4 || reverse || 1<br />
|-<br />
|align="right"| R034 || F4_reverse_cap2 || gctacggtctcagctgctgtggaaaggaacgtcctcaaaagtg || 4 || reverse || 2<br />
|-<br />
|align="right"| R035 || F4_reverse_cap5 || gctacggtctcagctggagtggaagggcacctcctcaaagttg || 4 || reverse || 5<br />
|-<br />
|align="right"| R036 || F4_reverse_cap9 || gctacggtctcagctgctatggaaaggtacgttctcaaactcg || 4 || reverse || 9<br />
|-<br />
|align="right"| R037 || F4_reverse_cap68 || gctacggtctcagctgctgtggaaaggcacgtcctcgaaggtg || 4 || reverse || 6,8<br />
|-<br />
|align="right"| R038 || F5_for_cap2 || gctacggtctcgcagctacgctcacagccagagtctggaccgtc || 5 || forward || 2<br />
|-<br />
|align="right"| R039 || F5_for_cap5 || gctacggtctcccagcttcgctcccagtcagaacctgttcaagc || 5 || forward || 5<br />
|-<br />
|align="right"| R040 || F5_for_cap8 || gctacggtctcgcagctacgcccacagccagagcttggaccggc || 5 || forward || 8<br />
|-<br />
|align="right"| R041 || F5_for_cap9 || gctacggtctcgcagctacgctcacagccaaagcctggaccgac || 5 || forward || 9<br />
|-<br />
|align="right"| R042 || F5_for_cap16 || gctacggtctcgcagctacgcgcacagccagagcctggaccggc || 5 || forward || 1,6<br />
|-<br />
|align="right"| R043 || F5_rev_cap2 || gctacggtctccagttcctagactggtcccgaatgtcactcg || 5 || reverse || 2<br />
|-<br />
|align="right"| R044 || F5_rev_cap5 || gctacggtctccagtttttgtaggtgttggcgtatctcccgg || 5 || reverse || 5<br />
|-<br />
|align="right"| R045 || F5_rev_cap8 || gctacggtctccagttctttgcctgattggccattgtattag || 5 || reverse || 8<br />
|-<br />
|align="right"| R046 || F5_rev_cap9 || gctacggtctctagtttcttccctggacagccatgttgctgg || 5 || reverse || 9<br />
|-<br />
|align="right"| R047 || F5_rev_cap16 || gctacggtctccagtttttgggctgaacagacatgccagctg || 5 || reverse || 1,6<br />
|-<br />
|align="right"| R048 || F6_for_cap2 || gctacggtctcgaactggcttcctggaccctgttaccgccagc || 6 || forward || 2<br />
|-<br />
|align="right"| R049 || F6_for_cap5|| gctacggtctcaaactggttcccggggcccatgggccgaaccc || 6 || forward || 5<br />
|-<br />
|align="right"| R050 || F6_for_cap8 || gctacggtctcgaactggctgccaggaccctgttaccgccaac || 6 || forward || 8<br />
|-<br />
|align="right"| R051 || F6_for_cap9 || gctacggtctcaaactacatacctggacccagctaccgacaac || 6 || forward || 9<br />
|-<br />
|align="right"| R052 || F6_for_cap16 || gctacggtctcaaactggctacctggaccctgttatcggcagc || 6 || forward || 1,6<br />
|-<br />
|align="right"| R053 || F6_rev_cap1 || gctacggtctcgccacagggttagtggctttaatttcctcttcgtctg || 6 || reverse || 1<br />
|-<br />
|align="right"| R054 || F6_rev_cap2 || gctacggtctcgccacgggattggttgtcctgatttcctcttcgtctg || 6 || reverse || 2<br />
|-<br />
|align="right"| R055 || F6_rev_cap5 || gctacggtctcgccacgcggttcaccggctgcgtctcgctctcgctgg || 6 || reverse || 5<br />
|-<br />
|align="right"| R056 || F6_rev_cap6 || gctacggtctcgccacggggttagtggctttgatttcctcttcgtctg || 6 || reverse || 6<br />
|-<br />
|align="right"| R057 || F6_rev_cap8 || gctacggtctcgccacagggttagtggttttgatttcttctcgctgg || 6 || reverse || 8<br />
|-<br />
|align="right"| R058 || F6_rev_cap9 || gctacggtctcgccaccgggttagtagttttaatttcttcttcgttggttatc || 6 || reverse || 9<br />
|-<br />
|align="right"| R059 || F7_for_cap1 || gctacggtctctgtggccaccgaaagatttgggaccgtggcagtcaatttc || 7 || forward || 1<br />
|-<br />
|align="right"| R060 || F7_for_cap2 || gctacggtctccgtggctacggagcagtatggttctgtatctaccaacctc || 7 || forward || 2<br />
|-<br />
|align="right"| R061 || F7_for_cap5 || gctacggtctccgtggcgtacaacgtcggcgggcagatg || 7 || forward || 5<br />
|-<br />
|align="right"| R062 || F7_for_cap6 || gctacggtctccgtggccaccgaaagatttgggactgtggcagtcaatctc || 7 || forward || 6<br />
|-<br />
|align="right"| R063 || F7_for_cap8 || gctacggtctctgtggctacagaggaatacggtatcgtggcagataacttg || 7 || forward || 8<br />
|-<br />
|align="right"| R064 || F7_for_cap9 || gctacggtctcggtagcaacggagtcctatggacaagtggccacaaaccac || 7 || forward || 9<br />
|-<br />
|align="right"| R065 || F7_rev_cap1 || gctacggtctcggtgatgaatgaagcaaactttgtagctgaaaac || 7 || reverse || 1<br />
|-<br />
|align="right"| R066 || F7_rev_cap2 || gctacggtctctgtgatgaaggaagcaaactttgccgcactgaag || 7 || reverse || 2<br />
|-<br />
|align="right"| R067 || F7_rev_cap5 || gctacggtctcggtgatgaagctgctgacgggcacgtccgagaag || 7 || reverse || 5<br />
|-<br />
|align="right"| R068 || F7_rev_cap6 || gctacggtctcggtgatgaatgaagcaaactttgtagccgaaaac || 7 || reverse || 6<br />
|-<br />
|align="right"| R069 || F7_rev_cap8 || gctacggtctccgtgatgaaagagttcagctttgactggttgaag || 7 || reverse || 8<br />
|-<br />
|align="right"| R070 || F7_rev_cap9 || gctacggtctcggtgatgaaagagttcagcttgtccttgttgaag || 7 || reverse || 9<br />
|-<br />
|align="right"| R071 || F8_for_cap1 || gctacggtctcatcacccaatactccacaggacaagtgagtgtgg || 8 || forward || 1<br />
|-<br />
|align="right"| R072 || F8_for_cap2 || gctacggtctcatcacacagtactccacgggacaggtcagcgtgg || 8 || forward || 2<br />
|-<br />
|align="right"| R073 || F8_for_cap5 || gctacggtctcatcacccagtacagcaccgggcaggtcaccgtgg || 8 || forward || 5<br />
|-<br />
|align="right"| R074 || F8_for_cap6 || gctacggtctcatcacccagtattccacaggacaagtgagcgtgg || 8 || forward || 6<br />
|-<br />
|align="right"| R075 || F8_for_cap8 || gctacggtctcatcacgcaatacagcaccggacaggtcagcgtgg || 8 || forward || 8<br />
|-<br />
|align="right"| R076 || F8_for_cap9 || gctacggtctcatcacccagtattctactggccaagtcagcgtgg || 8 || forward || 9<br />
|-<br />
|align="right"| R077 || F8_rev_cap1 || gctacggcgcgccttacaggggacgggtaaggtaacgggtgcc || 8 || reverse || 1<br />
|-<br />
|align="right"| R078 || F8_rev_cap2 || gctacggcgcgccttacagattacgagtcaggtatctggtgccaatggg || 8 || reverse || 2<br />
|-<br />
|align="right"| R079 || F8_rev_cap5 || gctacggcgcgccttaaaggggtcgggtaaggtatcgggttccgatagg || 8 || reverse || 5<br />
|-<br />
|align="right"| R080 || F8_rev_cap6 || gctacggcgcgccttacaggggacgggtgaggtaacgggtgcc || 8 || reverse || 6<br />
|-<br />
|align="right"| R081 || F8_rev_cap8 || gctacggcgcgccttacagattacgggtgaggtaacgggtgccaatggg || 8 || reverse || 8<br />
|-<br />
|align="right"| R082 || F8_rev_cap9 || gctacggcgcgccttacagattacgagtcaggtatctggtgccaatggg || 8 || reverse || 9<br />
|-<br />
|align="right"| R083 || Virbyte_for || gtctgagtgactagcattcg || - || forward ||<br />
|-<br />
|align="right"| R084 || Virobyte_rev || gctacggcgcgcctta || - || reverse ||<br />
|-<br />
|align="right"| R085 || Anchor F4F5 12689 || || anchor || - ||<br />
|-<br />
|align="right"| R086 || Anchor F4F5 5 || || anchor || - ||<br />
|-<br />
|align="right"| R087 || Anchor_F4F5 comp_all || || anchor || - ||<br />
|-<br />
|}<br />
<br />
==Primer Table Quick 'n' Dirty==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified !! origin !! for backbone<br />
|-<br />
|align="right"| L001 || CMV_AgeI_fw || ttttaccggtagaatctgcttagggttagg || for use with L11 || from pcDNA5+miRNA || to tuning construct-pTR-UF3 KpnI/SalI<br />
|-<br />
|align="right"| L002 || CMVshRNApA_KpnI_rv || taatggtacccagaagccatagagcccacc || - || from pcDNA5+miRNA || to tuning construct-pTR-UF3 KpnI/SalI <br />
|-<br />
|align="right"| L003 || HSVluc_norm_BglII_fw || tttttagatcttgcaggagcttcagggagtg || for use with L8 || from PsiCheck2 || to pTR-UF3 BglII <br />
|-<br />
|align="right"| L004 || HSVluc_norm_BglII_rv || ttttagatctggttccgcgcacatttccc || for use with L7 || from PsiCheck2 || to pTR-UF3 BglII <br />
|-<br />
|align="right"| L005 || HSVluc_norm_KpnI_fw || tttttggtagcaggagcttcagggagtg || for use with L16 || from PsiCheck2 || to pTR-UF3 KpnI/SalI <br />
|-<br />
|align="right"| L006 || HSVluc_norm_SalI_rv || ttttgtcgacggttccgcgcacatttccc || for use with L15 || from PsiCheck2 || to pTR-UF3 KpnI/SalI <br />
|-<br />
|align="right"| L007 || Sv40lucmcs_AgeI_fw || ttttaccggtgtggaatgtgtgtcagttag || for use with L13 || from PsiCheck2 || to tuning construct-pTR-UF3 KpnI/SalI <br />
|-<br />
|align="right"| L008 || SV40luc_SalI_rv || tattgtcgacccgcgtcagacaaaccctaac || for use with L1 || from PsiCheck2 || to tuning construct-pTR-UF3 KpnI/SalI <br />
|-<br />
|align="right"| L009 || TetO2_StuI_NheI || ttttaggccttccctatcagtgatagagatctccctatcagtgatagagagctagctaac || Tet Repressor|| Oligo || to final tuning construct <br />
|-<br />
|align="right"| L010 || TetR_BspEI_fw || tttttccggaggcgaattgatatgtctagattag || for use with L14 || from pcDNA6/TR || pTR-UF3 BspEI/NotI <br />
|-<br />
|align="right"| L011 || TetR_SgfI_NotI_rv || ttttgcggccgctggcgatcgctaataagatctgaattcccgggatc || for use with L12 || from pcDNA6/TR || to pTR-UF3 BspEI/NotI <br />
|}<br />
<br />
<br />
==Primer Table raPCR ==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3') !! target !! Assembly Site !! <br />
|-<br />
|align="right"| ra001 || psicheck2_MCS_min_200_fw || cagcgacgatctgcctaa || sequencing fw || || sequencing Primer for binding-sites in pSiCheck vector<br />
|-<br />
|align="right"| ra002 || psicheck2_MCS_plu_200_rv || gtggccaccaagaccaaa || sequencing rv || || sequencing Primer for binding-sites in pSiCheck vector<br />
|-<br />
|align="right"| ra003 || raPCR_AS13-hsa-mir-122 || cactgaatccaactgcaaacaccattgtcacactccagcatacatggactgc || hsa-mir-122 || 13 bp || <br />
|-<br />
|align="right"| ra004 || raPCR_AS13-has-mir122(ran9-12) || cactgaatccaactgcaaacaccatnnnnacactccagcatacatggactgc || has-mir122 (ran9-12) || 13 bp || randomised nucleotides 9-12<br />
|-<br />
|align="right"| ra005 || raPCR_AS13-hsa-mir-320b || cactgaatccaactgttgccctctcaacccagcttttgcatacatggactgc || hsa-mir-320b || 13 bp || <br />
|-<br />
|align="right"| ra006 || raPCR_AS13-has-mir-221 || cactgaatccaactggaaacccagcagacaatgtagctgcatacatggactgc || has-mir-221 || 13 bp || <br />
|-<br />
|align="right"| ra007 || raPCR_AS13-has-mir-221(ran9-12 || cactgaatccaactggaaacccagcannnnatgtagctgcatacatggactgc || has-mir-221 (ran9-12) || 13 bp || randomised nucleotides 9-12<br />
|-<br />
|align="right"| ra008 || raPCR_AS13-has-mir-1179 || cactgaatccaactgccaaccaatgaaagaatgcttgcatacatggactgc || has-mir-1179 || 13 bp || <br />
|-<br />
|align="right"| ra009 || raPCR_AS13-has-mir-1179ran9-12 || cactgaatccaactgccaaccaatnnnngaatgcttgcatacatggactgc || has-mir-1179 (ran9-12) || 13 bp || randomised nucleotides 9-12<br />
|-<br />
|align="right"| ra010 || raPCR_AS13-has-mir4286 || cactgaatccaactgggtaccaggagtggggtgcatacatggactgc || has-mir4286 || 13 bp || <br />
|-<br />
|align="right"| ra011 || raPCR_AS13-mm-mir-375 || cactgaatccaactgtcacgcgagccgaacgaacaaagcatacatggactgc || mm-mir-375 || 13 bp || <br />
|-<br />
|align="right"| ra012 || raPCR_AS13-mm-mir-375(ran9-12) || cactgaatccaactgtcacgcgagcnnnncgaacaaagcatacatggactgc || mm-mir-375 (ran9-12) || 13 bp || randomised nucleotides 9-12<br />
|-<br />
|align="right"| ra013 || raPCR_AS13-mm-mir-376a || cactgaatccaactgacgtggattttcctctacgatgcatacatggactgc || mm-mir-376a || 13 bp || <br />
|-<br />
|align="right"| ra014 || raPCR_AS13-spacer(0) || cagttggattcagtggcagtccatgtatgc || spacer || 13 bp || <br />
|-<br />
|align="right"| ra015 || raPCR_AS13-spacer(10) || cagttggattcagtggctatttctcgcagtccatgtatgc || spacer || 13 bp || <br />
|-<br />
|align="right"| ra016 || raPCR_AS13-spacer(20) || cagttggattcagtgatgacaggtagctatttctcgcagtccatgtatgc || spacer || 13 bp || <br />
|-<br />
|align="right"| ra017 || raPCR_AS13-stop_fw_BBB || ttttgaattcgcggccgcactagtcactgaatccaactg || stop fw || 13 bp || <br />
|-<br />
|align="right"| ra018 || raPCR_AS13-stop_rev_BBB || ttttctgcagcggccgcgctagcgcagtccatgtatgc || stop rev || 13 bp || <br />
|-<br />
|align="right"| ra019 || raPCR_AS13-stop_rev_NotI || ttttgcggccgctggagtgtgacaatggtgtttg || stop rev || 13 bp || <br />
|-<br />
|align="right"| ra020 || raPCR_AS13-stop_fw_XhoI || ttttctcgagcactgaatccaactg || stop fw || 13 bp || <br />
|}<br />
<br />
<br />
==mouse oligos==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3')<br />
|-<br />
|align="right"| mouse1 || CMV_TetR_122bs_SalI_fw ||ttttgtcgaccgttgacattgattattgac <br />
|- <br />
|align="right"| mouae2 || CMV_TetR_both_MluI_rev || ttttacgcgttaacacacaaaaaaccaacac <br />
|-<br />
|align="right"| mouse3 || CMV_TetR_control_SalI_fw || ttttgtcgaccgttgacattgattattgac <br />
|-<br />
|align="right"| mouse4 || CMV_TetO2_EcoRI_fw || ttttgaattcgttgacattgattattgtctag <br />
|-<br />
|align="right"| mouse5 || Luc2_Ter_PstI_rev || ttttctgcagtaccacatttgtagaggttttac <br />
|-<br />
|align="right"| mouse6XXX || haat_bs_p_fw || tcgaggaagcgtttaggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse7 || haat_bs_p_rev || ggccgctctagagatgttaaacatgcctaaacgcttcc <br />
|-<br />
|align="right"| mouse8 || haat_bs_r10_12_aat_fw || tcgaggaagcgtaatggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse9 || haat_bs_r10_12_aat_rev || ggccgctctagagatgttaaacatgccattacgcttcc <br />
|-<br />
|align="right"| mouse10 || haat_bs_r10_12_agc_fw || tcgaggaagcgtagcggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse11 || haat_bs_r10_12_agc_rev || ggccgctctagagatgttaaacatgccgctacgcttcc <br />
|-<br />
|align="right"| mouse12 || haat_bs_m10at_fw || tcgaggaagcgttttggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse13 || haat_bs_m10at_rev || ggccgctctagagatgttaaacatgccaaaacgcttcc <br />
|-<br />
|align="right"| mouse14 || haat_bs_m10ac_fw || tcgaggaagcgtttcggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse15 || haat_bs_m10ac_rev || ggccgctctagagatgttaaacatgccgaaacgcttcc <br />
|-<br />
|align="right"| mouse16 || haat_bs_m11ta_fw || tcgaggaagcgttaaggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse17 || haat_bs_m11ta_rev || ggccgctctagagatgttaaacatgccttaacgcttcc <br />
|-<br />
|align="right"| mouse18 || haat_bs_m11tg_fw || tcgaggaagcgttgaggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse19 || haat_bs_m11tg_rev || ggccgctctagagatgttaaacatgcctcaacgcttcc <br />
|-<br />
|align="right"| mouse20 || haat_bs_r9_12_aatc_fw || tcgaggaagcgtaatcgcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse21 || haat_bs_r9_12_aatc_rev || ggccgctctagagatgttaaacatgcgattacgcttcc <br />
|-<br />
|align="right"| mouse22 || haat_bs_r9_12_agcc_fw || tcgaggaagcgtagccgcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse23 || haat_bs_r9_12_agcc_rev || ggccgctctagagatgttaaacatgcggctacgcttcc <br />
|-<br />
|align="right"| mouse24 || haat_bs_onlyseed_fw || tcgagcttcgcaaatcgcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse25 || haat_bs_onlyseed_rev || ggccgctctagagatgttaaacatgcgatttgcgaagc <br />
|-<br />
|align="right"| mouse26 || haat_bs_r16-18_fw || tcgaggttccgtttaggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse27 || haat_bs_r16-18_rev || ggccgctctagagatgttaaacatgcctaaacggaacc <br />
|-<br />
|align="right"| mouse28XXX || sAg_bs_p_fw || tcgagctcagtttactagtgccatttgttctctagagc <br />
|-<br />
|align="right"| mouse29 || sAg_bs_p_rev || ggccgctctagagaacaaatggcactagtaaactgagc <br />
|-<br />
|align="right"| mouse30 || sAg_bs_r10_12_acg_fw || tcgagctcagtttactagacgcatttgttctctagagc <br />
|-<br />
|align="right"| mouse31 || sAg_bs_r10_12_acg_rev || ggccgctctagagaacaaatgcgtctagtaaactgagc <br />
|-<br />
|align="right"| mouse32 || sAg_bs_r10_12_taa_fw || tcgagctcagtttactagtaacatttgttctctagagc <br />
|-<br />
|align="right"| mouse33 || sAg_bs_r10_12_taa_rev || ggccgctctagagaacaaatgttactagtaaactgagc <br />
|-<br />
|align="right"| mouse34 || sAg_bs_r9_12_acgg_fw || tcgagctcagtttactagacggatttgttctctagagc <br />
|-<br />
|align="right"| mouse35 || sAg_bs_r9_12_acgg_rev || ggccgctctagagaacaaatccgtctagtaaactgagc <br />
|-<br />
|align="right"| mouse36 || sAg_bs_r9_12_atgt_fw || tcgagctcagtttactagatgtatttgttctctagagc <br />
|-<br />
|align="right"| mouse37 || sAg_bs_r9_12_atgt_rev || ggccgctctagagaacaaatacatctagtaaactgagc <br />
|-<br />
|align="right"| mouse38 || sAg_bs_m10cg_fw || tcgagctcagtttactagtggcatttgttctctagagc <br />
|-<br />
|align="right"| mouse39 || sAg_bs_m10cg_rev || ggccgctctagagaacaaatgccactagtaaactgagc <br />
|-<br />
|align="right"| mouse40 || sAg_bs_m10ca_fw || tcgagctcagtttactagtgacatttgttctctagagc <br />
|-<br />
|align="right"| mouse41 || sAg_bs_m10ca_rev || ggccgctctagagaacaaatgtcactagtaaactgagc <br />
|-<br />
|align="right"| mouse42 || sAg_bs_m11gc_fw || tcgagctcagtttactagtcccatttgttctctagagc <br />
|-<br />
|align="right"| mouse43 || sAg_bs_m11gc_rev || ggccgctctagagaacaaatgggactagtaaactgagc <br />
|-<br />
|align="right"| mouse44 || sAg_bs_m11ga_fw || tcgagctcagtttactagtaccatttgttctctagagc <br />
|-<br />
|align="right"| mouse45 || sAg_bs_m11ga_rev || ggccgctctagagaacaaatggtactagtaaactgagc <br />
|-<br />
|align="right"| mouse46 || sAg_bs_onlyseed_fw || tcgagctcagtaatgatcacggatttgttctctagagc <br />
|-<br />
|align="right"| mouse47 || sAg_bs_onlyseed_rev || ggccgctctagagaacaaatccgtgatcattactgagc <br />
|-<br />
|align="right"| mouse48 || sAg_bs_r16-18_fw || tcgagctcagttatgtagtgccatttgttctctagagc <br />
|-<br />
|align="right"| mouse49 || sAg_bs_r16-18_rev || ggccgctctagagaacaaatggcactacataactgagc <br />
|-<br />
|align="right"| mouse50XXX || hAAT_cDNA_SalI_Bluescript_fw || ttttgtcgacgaccatgattacgccaagcg <br />
|-<br />
|align="right"| mouse51 || hAAT_cDNA_SalI_fw || ttttgtcgacgggtaccgggccccccgtcgaggatg <br />
|-<br />
|align="right"| mouse52 || hAAT_cDNA_XhoI_NotI_NheI_rev || ttttgctagcgcggccgcgtatctcgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse53 || hAAT_cDNA_sAg_bs_p_NheI_rev || ttttgctagcgaacaaatggcactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse54 || hAAT_cDNA_sAg_bs_r10_12_acg_NheI_rev || ttttgctagcgaacaaatgcgtctagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse55 || hAAT_cDNA_sAg_bs_r10_12_taa_NheI_rev || ttttgctagcgaacaaatgttactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse56 || hAAT_cDNA_bs_r9_12_acgg_NheI_rev || ttttgctagcgaacaaatccgtctagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse57 || hAAT_cDNA_sAg_bs_r9_12_atgt_NheI_rev || ttttgctagcgaacaaatacatctagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse58 || hAAT_cDNA_sAg_bs_m10cg_NheI_rev || ttttgctagcgaacaaatgccactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse59 || hAAT_cDNA_sAg_bs_m10ca_NheI_rev || ttttgctagcgaacaaatgtcactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse60 || hAAT_cDNA_sAg_bs_m11gc_NheI_rev || ttttgctagcgaacaaatgggactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse61 || hAAT_cDNA_sAg_bs_m11ga_NheI_rev || ttttgctagcgaacaaatggtactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse62 || hAAT_cDNA_sAg_bs_onlyseed_NheI_rev || ttttgctagcgaacaaatccgtgatcattactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse63 || hAAT_cDNA_sAg_bs_r16-18_NheI_rev || ttttgctagcgaacaaatggcactacataactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse64XXX || sAg_bs_p_fw_E || aattcctcagtttactagtgccatttgttcctgca <br />
|-<br />
|align="right"| mouse65 || sAg_bs_p_rev_P || ggaacaaatggcactagtaaactgagg <br />
|-<br />
|align="right"| mouse66 || sAg_bs_r10_12_acg_fw_E || aattcctcagtttactagacgcatttgttcctgca <br />
|-<br />
|align="right"| mouse67 || sAg_bs_r10_12_acg_rev_P || ggaacaaatgcgtctagtaaactgagg <br />
|-<br />
|align="right"| mouse68 || sAg_bs_r10_12_taa_fw_E || aattcctcagtttactagtaacatttgttcctgca <br />
|-<br />
|align="right"| mouse69 || sAg_bs_r10_12_taa_rev_P || ggaacaaatgttactagtaaactgagg <br />
|-<br />
|align="right"| mouse70 || sAg_bs_r9_12_acgg_fw_E || aattcctcagtttactagacggatttgttcctgca <br />
|-<br />
|align="right"| mouse71 || sAg_bs_r9_12_acgg_rev_P || ggaacaaatccgtctagtaaactgagg <br />
|-<br />
|align="right"| mouse72 || sAg_bs_r9_12_atgt_fw_E || aattcctcagtttactagatgtatttgttcctgca <br />
|-<br />
|align="right"| mouse73 || sAg_bs_r9_12_atgt_rev_P || ggaacaaatacatctagtaaactgagg <br />
|-<br />
|align="right"| mouse74 || sAg_bs_m10cg_fw_E || aattcctcagtttactagtggcatttgttcctgca <br />
|-<br />
|align="right"| mouse75 || sAg_bs_m10cg_rev_P || ggaacaaatgccactagtaaactgagg <br />
|-<br />
|align="right"| mouse76 || sAg_bs_m10ca_fw_E || aattcctcagtttactagtgacatttgttcctgca <br />
|-<br />
|align="right"| mouse77 || sAg_bs_m10ca_rev_P || ggaacaaatgtcactagtaaactgagg <br />
|-<br />
|align="right"| mouse78 || sAg_bs_m11gc_fw_E || aattcctcagtttactagtcccatttgttcctgca <br />
|-<br />
|align="right"| mouse79 || sAg_bs_m11gc_rev_P || ggaacaaatgggactagtaaactgagg <br />
|-<br />
|align="right"| mouse80 || sAg_bs_m11ga_fw_E || aattcctcagtttactagtaccatttgttcctgca <br />
|-<br />
|align="right"| mouse81 || sAg_bs_m11ga_rev_P || ggaacaaatggtactagtaaactgagg <br />
|-<br />
|align="right"| mouse82 || sAg_bs_onlyseed_fw_E || aattcctcagtaatgatcacggatttgttcctgca <br />
|-<br />
|align="right"| mouse83 || sAg_bs_onlyseed_rev_P || ggaacaaatccgtgatcattactgagg <br />
|-<br />
|align="right"| mouse84 || sAg_bs_r16-18_fw_E || aattcctcagttatgtagtgccatttgttcctgca <br />
|-<br />
|align="right"| mouse85 || sAg_bs_r16-18_rev_P || ggaacaaatggcactacataactgagg <br />
|}<br />
<br />
==Modeling Training and Validation Binding Site Set-miRsAg==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3')<br />
|-<br />
|align="right"| miRsAg001 || fw_model_sAg_Bs_1 || ccgggataatttgttcatttgttctctagagc<br />
|-<br />
|align="right"| miRsAg002 || fw_model_sAg_Bs_2 || ccgggataatttgttcatttgttcatttgttctctagagc<br />
|-<br />
|align="right"| miRsAg003 || fw_model_sAg_Bs_3 || ccgggagtttactagtgccatttgttcaaatatagcctctagagc<br />
|-<br />
|align="right"| miRsAg004 || fw_model_sAg_Bs_4 || ccgggagtttactagtgcaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg005 || fw_model_sAg_Bs_5 || ccgggagtttactagtgaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg006 || fw_model_sAg_Bs_6 || ccgggagtttactagtaaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg007 || fw_model_sAg_Bs_7 || ccgggagtttactagaaaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg008 || fw_model_sAg_Bs_8 || ccgggctgggcaattataaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg009 || fw_model_sAg_Bs_9 || ccgggctgggcagccgcaaatttgttaaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg010 || fw_model_sAg_Bs_10 || ccgggctgggcagctataattttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg011 || fw_model_sAg_Bs_11 || ccgggagtttacgccgtaaatttgttgaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg012 || fw_model_sAg_Bs_12 || ccgggctgggcaattataaatttgttgaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg013 || fw_model_sAg_Bs_13 || ccgggtccttactagtgcaatttgttaaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg014 || fw_model_sAg_Bs_14 || ccgggctgaatatagtgaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg015 || fw_model_sAg_Bs_15 || ccgggagtttactacctaattttgttaaaatccggcctctagagc<br />
|-<br />
|align="right"| miRsAg016 || fw_model_sAg_Bs_16 || ccgggctgggcctagtggattttgttaaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg017 || fw_model_sAg_Bs_17 || ccgggagtttacattgcaaatttgttgaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg018 || fw_model_sAg_Bs_18 || ccgggctgggactagtgcaatttgttgaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg019 || fw_model_sAg_Bs_20 || ccgggagtttactagaaaattttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg020 || fw_model_sAg_Bs_21 || ccgggagtttactagaaaaatttgttgaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg021 || fw_model_sAg_Bs_22 || ccgggagtttactccgcaaccgctaggaaagcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg022 || fw_model_sAg_Bs_23 || ccgggctgggcatagataattttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg023 || fw_model_sAg_Bs_24 || ccgggctggtactagctaattttgttaaaatccggcctctagagc<br />
|-<br />
|align="right"| miRsAg024 || fw_model_sAg_Bs_25 || ccgggagtttactagccgattttgttaaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg025 || fw_model_sAg_Bs_26 || ccgggctgggcctagaaaaatttgttgaaatccggcctctagagc<br />
|-<br />
|align="right"| miRsAg026 || fw_model_sAg_Bs_27 || ccgggcttttactagaaaaatttgttgaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg027 || fw_model_sAg_Bs_28 || ccgggctggtactaggcaaatttgttgaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg028 || fw_model_sAg_Bs_29 || ccggggctttactagaaaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg029 || fw_model_sAg_Bs_30 || ccgggagtttactttaaaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg030 || rev_model_sAg_Bs_1 || tcgagctctagagaacaaatgaacaaattatc<br />
|-<br />
|align="right"| miRsAg031 || rev_model_sAg_Bs_2 || tcgagctctagagaacaaatgaacaaatgaacaaattatc<br />
|-<br />
|align="right"| miRsAg032 || rev_model_sAg_Bs_3 || tcgagctctagaggctatatttgaacaaatggcactagtaaactc<br />
|-<br />
|align="right"| miRsAg033 || rev_model_sAg_Bs_4 || tcgagctctagaggctaaattttaacaaattgcactagtaaactc<br />
|-<br />
|align="right"| miRsAg034 || rev_model_sAg_Bs_5 || tcgagctctagaggctaaattttaacaaatttcactagtaaactc<br />
|-<br />
|align="right"| miRsAg035 || rev_model_sAg_Bs_6 || tcgagctctagaggctaaattttaacaaattttactagtaaactc<br />
|-<br />
|align="right"| miRsAg036 || rev_model_sAg_Bs_7 || tcgagctctagaggctaaattttaacaaatttttctagtaaactc<br />
|-<br />
|align="right"| miRsAg037 || rev_model_sAg_Bs_8 || tcgagctctagaggctaaattttaacaaatttataattgcccagc<br />
|-<br />
|align="right"| miRsAg038 || rev_model_sAg_Bs_9 || tcgagctctagaggcgggcctttaacaaatttgcggctgcccagc<br />
|-<br />
|align="right"| miRsAg039 || rev_model_sAg_Bs_10 || tcgagctctagaggctaaattttaacaaaattatagctgcccagc<br />
|-<br />
|align="right"| miRsAg040 || rev_model_sAg_Bs_11 || tcgagctctagaggcgggccttcaacaaatttacggcgtaaactc<br />
|-<br />
|align="right"| miRsAg041 || rev_model_sAg_Bs_12 || tcgagctctagaggctaaatttcaacaaatttataattgcccagc<br />
|-<br />
|align="right"| miRsAg042 || rev_model_sAg_Bs_13 || tcgagctctagaggcgggcctttaacaaattgcactagtaaggac<br />
|-<br />
|align="right"| miRsAg043 || rev_model_sAg_Bs_14 || tcgagctctagaggctaaattttaacaaatttcactatattcagc<br />
|-<br />
|align="right"| miRsAg044 || rev_model_sAg_Bs_15 || tcgagctctagaggccggattttaacaaaattaggtagtaaactc<br />
|-<br />
|align="right"| miRsAg045 || rev_model_sAg_Bs_16 || tcgagctctagaggcgggcctttaacaaaatccactaggcccagc<br />
|-<br />
|align="right"| miRsAg046 || rev_model_sAg_Bs_17 || tcgagctctagaggcgggccttcaacaaatttgcaatgtaaactc<br />
|-<br />
|align="right"| miRsAg047 || rev_model_sAg_Bs_18 || tcgagctctagaggcgggccttcaacaaattgcactagtcccagc<br />
|-<br />
|align="right"| miRsAg048 || rev_model_sAg_Bs_20 || tcgagctctagaggctaaattttaacaaaattttctagtaaactc<br />
|-<br />
|align="right"| miRsAg049 || rev_model_sAg_Bs_21 || tcgagctctagaggctaaatttcaacaaatttttctagtaaactc<br />
|-<br />
|align="right"| miRsAg050 || rev_model_sAg_Bs_22 || tcgagctctagaggcgggctttcctagcggttgcggagtaaactc<br />
|-<br />
|align="right"| miRsAg051 || rev_model_sAg_Bs_23 || tcgagctctagaggctaaattttaacaaaattatctatgcccagc<br />
|-<br />
|align="right"| miRsAg052 || rev_model_sAg_Bs_24 || tcgagctctagaggccggattttaacaaaattagctagtaccagc<br />
|-<br />
|align="right"| miRsAg053 || rev_model_sAg_Bs_25 || tcgagctctagaggcgggcctttaacaaaatcggctagtaaactc<br />
|-<br />
|align="right"| miRsAg054 || rev_model_sAg_Bs_26 || tcgagctctagaggccggatttcaacaaatttttctaggcccagc<br />
|-<br />
|align="right"| miRsAg055 || rev_model_sAg_Bs_27 || tcgagctctagaggctaaattcaacaaatttttctagtaaaagc<br />
|-<br />
|align="right"| miRsAg056 || rev_model_sAg_Bs_28 || tcgagctctagaggcgggccttcaacaaatttgcctagtaccagc<br />
|-<br />
|align="right"| miRsAg057 || rev_model_sAg_Bs_29 || tcgagctctagaggctaaattttaacaaatttttctagtaaagcc<br />
|-<br />
|align="right"| miRsAg058 || rev_model_sAg_Bs_30 || tcgagctctagaggctaaattttaacaaatttttaaagtaaactc<br />
|-<br />
|align="right"| miRsAg059 || Luc2_BS_seq_screen || acgacgatgccggcgagctg<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:57:31Z<p>Rudolf: /* 18/10/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
<br />
==15/10/2010==<br />
<br />
*Fragments 1-4; 5-8 assembly.<br />
**ligation time 20-25min @ 16°C <br />
**60ul of beads<br />
**60ul Anchor solution (Nanodrop - 196ng/ul)<br />
**2x wash with 100ul w/b buffer<br />
**1x wash with 100ul 1x T4 ligase buffer<br />
**gentle flicking only to dissolve the bead pellet from the wall<br />
<br />
[[Image:Gel_546.jpg|thumb|400px|center|]]<br />
<br />
*1 - fragments 1-4 assembly.<br />
*2 - fragments control.<br />
*3 - assembly ligation mix<br />
*M - DNA 1kb ladder<br />
*4 - fragments 5-8 assembly.<br />
*5 - fragments control.<br />
*6 - assembly ligation mix<br />
<br />
----<br />
<br />
==18/10/2010==<br />
<br />
*Fragments 1-4 assembly<br />
<br />
<br />
Gel map:<br />
<br />
*M - DNA 1kb ladder<br />
*1 - control (fragments 1-4 from AAV1).<br />
*2 - fragments 1-4 assembly<br />
*3 - fragments 1-4 assembly (2nd reaction)<br />
*4 - negative control<br />
<br />
<br />
[[Image:Gel_547.png|thumb|500px|center|]]<br />
<br />
----<br />
<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s<br />
<br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
<br /><br />
<br />
==26/10/2010==<br />
<br />
*Fragment digest, Bsa1, 3hrs, purified from gel <br />
**7ul fragment DNA<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**1ul Bsa1<br />
**16ul nuclease free water<br />
<br />
==27/10/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
<br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T03:57:05Z<p>Rudolf: /* Protocols */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final_1.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br /><br />
<br />
===Anchor===<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes#Protocols Protocols]). The final Anchor construct contains important restriction sites as well as the VirByte_for sequence used for final PCR amplification. First recognition site is HindIII which we used for separating the beads from the assembled DNA before PCR. Second restriction sequence corresponds to PacI which is a common non-cutter within all AAV serotypes used and can be emplyed for further ligation into an appropriate vector. Most importantly the 3'-end forms a sticky end compatible with the so-called "start overhang" of all fragments'''1'''.<br />
<br />
Annotated sequence of anchor oligos:<br />
<br />
<br /><br />
<br />
Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+4nt(cap specific)<br />
<br />
*first 15nt form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
* ''italicized'' is HindIII recognition site<br />
<br />
* '''bold''' is amplification (VirByte_for) sequence<br />
<br />
* '''''bold italicized''''' is PacI recognition site<br />
<br />
Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
* reverse complimentary strand to Anchors<br />
<br />
<br />
Final Anchor construct used:<br />
<br />
5'-Biotin-tctctctctctctctaagcttgtctgagtgactagcattcgttaattaac+4nt-3'<br />
3'-ttcgaacagactcactgatcgtaagcaattaattg-5' <br />
<br />
===Primers===<br />
<br />
Fragment X forward [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers]:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
* NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI) forming the 5'-overhang<br />
<br />
<br />
Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
==Protocols==<br />
<br />
==='''ViroByte construction'''===<br />
<br />
*perform ViroByte Phusion HiFi Hot Start PCR to obtain desired fragments with complementary ends<br />
**98°C 30s 1x<br />
**98°C 10s<br />
**72°C 45s 35x<br />
**72°C 10min 1x<br />
**4°C hold <br />
<br />
<br />
*digestion with Bsa1 - leave digesting longer than in standard protocol (at least ~3hrs)<br />
<br />
==='''Anchor preparation'''===<br />
<br />
*Mix 10ul of Anchor 5 (100uM stock) with 50ul of Anchor 12689 (100ul stock); add 1.08ml of nuclease free water; mix gently<br />
<br />
*heat on the block to 95degrees for 2 minutes and let cool slowly to room temperature<br />
<br />
==='''Anchor docking'''===<br />
<br />
*after washing the beads and aspiration of the cleared solution the beads are ready for adding of the Anchor <br />
<br />
*add 40ul of the Anchor solution (~200ng/ul) <br />
<br />
*resuspend the beads and let incubate at room temperature for 15-20 minutes with occasional flicking in order to maintain the homogeneity of the solution <br />
<br />
*applying magnet, wash twice with 80ul of wash/binding buffer (0.5 M NaCl; 20 mM Tris HCl (pH 7.5); 1 mM EDTA) and once with 80ul of 1X T4 ligase buffer <br />
<br />
==='''BioByte-like assembly'''===<br />
<br />
*Bead preparation <br />
<br />
*Quickly vortex beads stock solution to obtain homogeneous suspension <br />
<br />
*Aliquot 40 µl of the beads into 1.5ml Eppendorf tubes - gently tap the tubes to collect all the beads at the bottom.<br />
<br />
*Place the tubes on the magnetic rack (or place a magnet on the side of each tube) and wait for the beads to be cleared out from the solution <br />
<br />
*Carefully discard the supernatant whilst beads are still attached to the side wall <br />
<br />
*Resuspend beads in 80ul of wash/binding buffer by gentle flicking (vortexing at high speed is not recommended) <br />
<br />
*Wash the beads once with 80 µl of 1X T4 Ligase buffer, before addition of ligation premix.<br />
<br />
*Add the DNA fragments using the ligation premix: 1) 25 µl of Quick Ligase (2X buffer); 2) Amount of DNA corresponding to 200 ng. The optimal DNA concentration for the ViroByte fragments assembly was experimentally established and was in range of 200 ng per fragment. Using higher and lower DNA concentrations did not give any positive assembly results; 3) Fill up with water to obtain the 50 µl total volume.<br />
<br />
*For the ligation procedure the Quick Ligase was used that showed to be more efficient during the experimental procedure in comparison to the ordinary T4 Ligase. Optimal ligation time for the Virobytes ligation was between 15-25 minutes.<br />
<br />
*After the last DNA fragment ligation wash the beads once with Wash/Binding buffer. Moreover the DNA should be cleaved from the beads by using HindIII restriction enzyme (or the other one depending on your designed cleavage site). For the restriction a standard protocol for the DNA digestion should be used.<br />
<br />
==Notebook==<br />
<br />
For further reference please find our lab notebook [https://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytes here].<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:56:33Z<p>Rudolf: /* 15/10/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
<br />
==15/10/2010==<br />
<br />
*Fragments 1-4; 5-8 assembly.<br />
**ligation time 20-25min @ 16°C <br />
**60ul of beads<br />
**60ul Anchor solution (Nanodrop - 196ng/ul)<br />
**2x wash with 100ul w/b buffer<br />
**1x wash with 100ul 1x T4 ligase buffer<br />
**gentle flicking only to dissolve the bead pellet from the wall<br />
<br />
[[Image:Gel_546.jpg|thumb|400px|center|]]<br />
<br />
*1 - fragments 1-4 assembly.<br />
*2 - fragments control.<br />
*3 - assembly ligation mix<br />
*M - DNA 1kb ladder<br />
*4 - fragments 5-8 assembly.<br />
*5 - fragments control.<br />
*6 - assembly ligation mix<br />
<br />
----<br />
<br />
==18/10/2010==<br />
<br />
**Fragments 1-4 assembly<br />
<br />
<br />
Gel map:<br />
<br />
*M - DNA 1kb ladder<br />
*1 - control (fragments 1-4 from AAV1).<br />
*2 - fragments 1-4 assembly<br />
*3 - fragments 1-4 assembly (2nd reaction)<br />
*4 - negative control<br />
<br />
<br />
[[Image:Gel_547.png|thumb|500px|center|]]<br />
<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s<br />
<br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
<br /><br />
<br />
==26/10/2010==<br />
<br />
*Fragment digest, Bsa1, 3hrs, purified from gel <br />
**7ul fragment DNA<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**1ul Bsa1<br />
**16ul nuclease free water<br />
<br />
==27/10/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
<br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:55:07Z<p>Rudolf: /* 18/10/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
<br />
==15/10/2010==<br />
<br />
**Fragments 1-4; 5-8 assembly.<br />
<br />
*ligation time 20-25min @ 16°C <br />
*60ul of beads<br />
*60ul Anchor solution (Nanodrop - 196ng/ul)<br />
*2x wash with 100ul w/b buffer<br />
*1x wash with 100ul 1x T4 ligase buffer<br />
*gentle flicking only to dissolve the bead pellet from the wall<br />
<br />
[[Image:Gel_546.jpg|thumb|400px|right|]]<br />
<br />
*1 - fragments 1-4 assembly.<br />
*2 - fragments control.<br />
*3 - assembly ligation mix<br />
M - DNA 1kb ladder<br />
*4 - fragments 5-8 assembly.<br />
*5 - fragments control.<br />
*6 - assembly ligation mix<br />
<br />
==18/10/2010==<br />
<br />
**Fragments 1-4 assembly<br />
<br />
<br />
Gel map:<br />
<br />
*M - DNA 1kb ladder<br />
*1 - control (fragments 1-4 from AAV1).<br />
*2 - fragments 1-4 assembly<br />
*3 - fragments 1-4 assembly (2nd reaction)<br />
*4 - negative control<br />
<br />
<br />
[[Image:Gel_547.png|thumb|500px|center|]]<br />
<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s<br />
<br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
<br /><br />
<br />
==26/10/2010==<br />
<br />
*Fragment digest, Bsa1, 3hrs, purified from gel <br />
**7ul fragment DNA<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**1ul Bsa1<br />
**16ul nuclease free water<br />
<br />
==27/10/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
<br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:54:05Z<p>Rudolf: /* 25/10/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
<br />
==15/10/2010==<br />
<br />
**Fragments 1-4; 5-8 assembly.<br />
<br />
*ligation time 20-25min @ 16°C <br />
*60ul of beads<br />
*60ul Anchor solution (Nanodrop - 196ng/ul)<br />
*2x wash with 100ul w/b buffer<br />
*1x wash with 100ul 1x T4 ligase buffer<br />
*gentle flicking only to dissolve the bead pellet from the wall<br />
<br />
[[Image:Gel_546.jpg|thumb|400px|right|]]<br />
<br />
*1 - fragments 1-4 assembly.<br />
*2 - fragments control.<br />
*3 - assembly ligation mix<br />
M - DNA 1kb ladder<br />
*4 - fragments 5-8 assembly.<br />
*5 - fragments control.<br />
*6 - assembly ligation mix<br />
<br />
==18/10/2010==<br />
<br />
**Fragments 1-4;<br />
<br />
<br />
[[Image:Gel_547.png|thumb|500px|right|]]<br />
<br />
M - DNA 1kb ladder<br />
*1 - control (fragments 1-4 from AAV1).<br />
*2 - fragments 1-4 assembly<br />
*3 - fragments 1-4 assembly (2nd reaction)<br />
*4 - negative control<br />
<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s<br />
<br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
<br /><br />
<br />
==26/10/2010==<br />
<br />
*Fragment digest, Bsa1, 3hrs, purified from gel <br />
**7ul fragment DNA<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**1ul Bsa1<br />
**16ul nuclease free water<br />
<br />
==27/10/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
<br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T03:52:17Z<p>Rudolf: /* ViroByte construction */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final_1.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br /><br />
<br />
===Anchor===<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes#Protocols Protocols]). The final Anchor construct contains important restriction sites as well as the VirByte_for sequence used for final PCR amplification. First recognition site is HindIII which we used for separating the beads from the assembled DNA before PCR. Second restriction sequence corresponds to PacI which is a common non-cutter within all AAV serotypes used and can be emplyed for further ligation into an appropriate vector. Most importantly the 3'-end forms a sticky end compatible with the so-called "start overhang" of all fragments'''1'''.<br />
<br />
Annotated sequence of anchor oligos:<br />
<br />
<br /><br />
<br />
Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+4nt(cap specific)<br />
<br />
*first 15nt form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
* ''italicized'' is HindIII recognition site<br />
<br />
* '''bold''' is amplification (VirByte_for) sequence<br />
<br />
* '''''bold italicized''''' is PacI recognition site<br />
<br />
Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
* reverse complimentary strand to Anchors<br />
<br />
<br />
Final Anchor construct used:<br />
<br />
5'-Biotin-tctctctctctctctaagcttgtctgagtgactagcattcgttaattaac+4nt-3'<br />
3'-ttcgaacagactcactgatcgtaagcaattaattg-5' <br />
<br />
===Primers===<br />
<br />
Fragment X forward [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers]:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
* NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI) forming the 5'-overhang<br />
<br />
<br />
Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
==Protocols==<br />
<br />
==='''ViroByte construction'''===<br />
<br />
*perform ViroByte Phusion HiFi Hot Start PCR to obtain desired fragments with complementary ends<br />
**98°C 30s 1x<br />
**98°C 10s<br />
**72°C 45s 35x<br />
**72°C 10min 1x<br />
**4°C hold <br />
<br />
<br />
*digestion with Bsa1 - leave digesting longer than in standard protocol (at least ~3hrs)<br />
<br />
==='''Anchor preparation'''===<br />
<br />
*Mix 10ul of Anchor 5 (100uM stock) with 50ul of Anchor 12689 (100ul stock); add 1.08ml of nuclease free water; mix gently<br />
<br />
*heat on the block to 95degrees for 2 minutes and let cool slowly to room temperature<br />
<br />
'''Anchor docking'''<br />
<br />
*after washing the beads and aspiration of the cleared solution the beads are ready for adding of the Anchor <br />
<br />
*add 40ul of the Anchor solution (~200ng/ul) <br />
<br />
*resuspend the beads and let incubate at room temperature for 15-20 minutes with occasional flicking in order to maintain the homogeneity of the solution <br />
<br />
*applying magnet, wash twice with 80ul of wash/binding buffer (0.5 M NaCl; 20 mM Tris HCl (pH 7.5); 1 mM EDTA) and once with 80ul of 1X T4 ligase buffer <br />
<br />
'''BioByte-like assembly'''<br />
<br />
*Bead preparation <br />
<br />
*Quickly vortex beads stock solution to obtain homogeneous suspension <br />
<br />
*Aliquot 40 µl of the beads into 1.5ml Eppendorf tubes - gently tap the tubes to collect all the beads at the bottom.<br />
<br />
*Place the tubes on the magnetic rack (or place a magnet on the side of each tube) and wait for the beads to be cleared out from the solution <br />
<br />
*Carefully discard the supernatant whilst beads are still attached to the side wall <br />
<br />
*Resuspend beads in 80ul of wash/binding buffer by gentle flicking (vortexing at high speed is not recommended) <br />
<br />
*Wash the beads once with 80 µl of 1X T4 Ligase buffer, before addition of ligation premix.<br />
<br />
*Add the DNA fragments using the ligation premix: 1) 25 µl of Quick Ligase (2X buffer); 2) Amount of DNA corresponding to 200 ng. The optimal DNA concentration for the ViroByte fragments assembly was experimentally established and was in range of 200 ng per fragment. Using higher and lower DNA concentrations did not give any positive assembly results; 3) Fill up with water to obtain the 50 µl total volume.<br />
<br />
*For the ligation procedure the Quick Ligase was used that showed to be more efficient during the experimental procedure in comparison to the ordinary T4 Ligase. Optimal ligation time for the Virobytes ligation was between 15-25 minutes.<br />
<br />
*After the last DNA fragment ligation wash the beads once with Wash/Binding buffer. Moreover the DNA should be cleaved from the beads by using HindIII restriction enzyme (or the other one depending on your designed cleavage site). For the restriction a standard protocol for the DNA digestion should be used.<br />
<br />
==Notebook==<br />
<br />
For further reference please find our lab notebook [https://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytes here].<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:52:15Z<p>Rudolf: /* 25/10/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
<br />
==15/10/2010==<br />
<br />
**Fragments 1-4; 5-8 assembly.<br />
<br />
*ligation time 20-25min @ 16°C <br />
*60ul of beads<br />
*60ul Anchor solution (Nanodrop - 196ng/ul)<br />
*2x wash with 100ul w/b buffer<br />
*1x wash with 100ul 1x T4 ligase buffer<br />
*gentle flicking only to dissolve the bead pellet from the wall<br />
<br />
[[Image:Gel_546.jpg|thumb|400px|right|]]<br />
<br />
*1 - fragments 1-4 assembly.<br />
*2 - fragments control.<br />
*3 - assembly ligation mix<br />
M - DNA 1kb ladder<br />
*4 - fragments 5-8 assembly.<br />
*5 - fragments control.<br />
*6 - assembly ligation mix<br />
<br />
==18/10/2010==<br />
<br />
**Fragments 1-4;<br />
<br />
<br />
[[Image:Gel_547.png|thumb|500px|right|]]<br />
<br />
M - DNA 1kb ladder<br />
*1 - control (fragments 1-4 from AAV1).<br />
*2 - fragments 1-4 assembly<br />
*3 - fragments 1-4 assembly (2nd reaction)<br />
*4 - negative control<br />
<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
==26/10/2010==<br />
<br />
*Fragment digest, Bsa1, 3hrs, purified from gel <br />
**7ul fragment DNA<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**1ul Bsa1<br />
**16ul nuclease free water<br />
<br />
==27/10/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
<br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T03:48:40Z<p>Rudolf: /* ViroByte construction */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final_1.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br /><br />
<br />
===Anchor===<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes#Protocols Protocols]). The final Anchor construct contains important restriction sites as well as the VirByte_for sequence used for final PCR amplification. First recognition site is HindIII which we used for separating the beads from the assembled DNA before PCR. Second restriction sequence corresponds to PacI which is a common non-cutter within all AAV serotypes used and can be emplyed for further ligation into an appropriate vector. Most importantly the 3'-end forms a sticky end compatible with the so-called "start overhang" of all fragments'''1'''.<br />
<br />
Annotated sequence of anchor oligos:<br />
<br />
<br /><br />
<br />
Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+4nt(cap specific)<br />
<br />
*first 15nt form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
* ''italicized'' is HindIII recognition site<br />
<br />
* '''bold''' is amplification (VirByte_for) sequence<br />
<br />
* '''''bold italicized''''' is PacI recognition site<br />
<br />
Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
* reverse complimentary strand to Anchors<br />
<br />
<br />
Final Anchor construct used:<br />
<br />
5'-Biotin-tctctctctctctctaagcttgtctgagtgactagcattcgttaattaac+4nt-3'<br />
3'-ttcgaacagactcactgatcgtaagcaattaattg-5' <br />
<br />
===Primers===<br />
<br />
Fragment X forward [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers]:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
* NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI) forming the 5'-overhang<br />
<br />
<br />
Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
==Protocols==<br />
<br />
==='''ViroByte construction'''===<br />
<br />
*perform ViroByte Phusion HiFi Hot Start PCR to obtain desired fragments with complementary ends<br />
**98°C 30s 1x<br />
**98°C 10s<br />
**72°C 45s 35x<br />
**72°C 10min 1x<br />
**4°C hold <br />
<br />
<br />
*digestion with Bsa1<br />
<br />
==='''Anchor preparation'''===<br />
<br />
*Mix 10ul of Anchor 5 (100uM stock) with 50ul of Anchor 12689 (100ul stock); add 1.08ml of nuclease free water; mix gently<br />
<br />
*heat on the block to 95degrees for 2 minutes and let cool slowly to room temperature<br />
<br />
'''Anchor docking'''<br />
<br />
*after washing the beads and aspiration of the cleared solution the beads are ready for adding of the Anchor <br />
<br />
*add 40ul of the Anchor solution (~200ng/ul) <br />
<br />
*resuspend the beads and let incubate at room temperature for 15-20 minutes with occasional flicking in order to maintain the homogeneity of the solution <br />
<br />
*applying magnet, wash twice with 80ul of wash/binding buffer (0.5 M NaCl; 20 mM Tris HCl (pH 7.5); 1 mM EDTA) and once with 80ul of 1X T4 ligase buffer <br />
<br />
'''BioByte-like assembly'''<br />
<br />
*Bead preparation <br />
<br />
*Quickly vortex beads stock solution to obtain homogeneous suspension <br />
<br />
*Aliquot 40 µl of the beads into 1.5ml Eppendorf tubes - gently tap the tubes to collect all the beads at the bottom.<br />
<br />
*Place the tubes on the magnetic rack (or place a magnet on the side of each tube) and wait for the beads to be cleared out from the solution <br />
<br />
*Carefully discard the supernatant whilst beads are still attached to the side wall <br />
<br />
*Resuspend beads in 80ul of wash/binding buffer by gentle flicking (vortexing at high speed is not recommended) <br />
<br />
*Wash the beads once with 80 µl of 1X T4 Ligase buffer, before addition of ligation premix.<br />
<br />
*Add the DNA fragments using the ligation premix: 1) 25 µl of Quick Ligase (2X buffer); 2) Amount of DNA corresponding to 200 ng. The optimal DNA concentration for the ViroByte fragments assembly was experimentally established and was in range of 200 ng per fragment. Using higher and lower DNA concentrations did not give any positive assembly results; 3) Fill up with water to obtain the 50 µl total volume.<br />
<br />
*For the ligation procedure the Quick Ligase was used that showed to be more efficient during the experimental procedure in comparison to the ordinary T4 Ligase. Optimal ligation time for the Virobytes ligation was between 15-25 minutes.<br />
<br />
*After the last DNA fragment ligation wash the beads once with Wash/Binding buffer. Moreover the DNA should be cleaved from the beads by using HindIII restriction enzyme (or the other one depending on your designed cleavage site). For the restriction a standard protocol for the DNA digestion should be used.<br />
<br />
==Notebook==<br />
<br />
For further reference please find our lab notebook [https://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytes here].<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T03:47:44Z<p>Rudolf: /* Protocols */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final_1.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br /><br />
<br />
===Anchor===<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes#Protocols Protocols]). The final Anchor construct contains important restriction sites as well as the VirByte_for sequence used for final PCR amplification. First recognition site is HindIII which we used for separating the beads from the assembled DNA before PCR. Second restriction sequence corresponds to PacI which is a common non-cutter within all AAV serotypes used and can be emplyed for further ligation into an appropriate vector. Most importantly the 3'-end forms a sticky end compatible with the so-called "start overhang" of all fragments'''1'''.<br />
<br />
Annotated sequence of anchor oligos:<br />
<br />
<br /><br />
<br />
Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+4nt(cap specific)<br />
<br />
*first 15nt form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
* ''italicized'' is HindIII recognition site<br />
<br />
* '''bold''' is amplification (VirByte_for) sequence<br />
<br />
* '''''bold italicized''''' is PacI recognition site<br />
<br />
Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
* reverse complimentary strand to Anchors<br />
<br />
<br />
Final Anchor construct used:<br />
<br />
5'-Biotin-tctctctctctctctaagcttgtctgagtgactagcattcgttaattaac+4nt-3'<br />
3'-ttcgaacagactcactgatcgtaagcaattaattg-5' <br />
<br />
===Primers===<br />
<br />
Fragment X forward [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers]:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
* NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI) forming the 5'-overhang<br />
<br />
<br />
Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
==Protocols==<br />
<br />
==='''ViroByte construction'''===<br />
<br />
*perform ViroByte Phusion HiFi Hot Start PCR to obtain desired fragments with complementary ends<br />
<br />
**98°C 30s 1x<br />
**98°C 10s<br />
**72°C 45s 35x<br />
**72°C 10min 1x<br />
**4°C hold <br />
<br />
<br />
*digestion with Bsa1 <br />
<br />
==='''Anchor preparation'''===<br />
<br />
*Mix 10ul of Anchor 5 (100uM stock) with 50ul of Anchor 12689 (100ul stock); add 1.08ml of nuclease free water; mix gently<br />
<br />
*heat on the block to 95degrees for 2 minutes and let cool slowly to room temperature<br />
<br />
'''Anchor docking'''<br />
<br />
*after washing the beads and aspiration of the cleared solution the beads are ready for adding of the Anchor <br />
<br />
*add 40ul of the Anchor solution (~200ng/ul) <br />
<br />
*resuspend the beads and let incubate at room temperature for 15-20 minutes with occasional flicking in order to maintain the homogeneity of the solution <br />
<br />
*applying magnet, wash twice with 80ul of wash/binding buffer (0.5 M NaCl; 20 mM Tris HCl (pH 7.5); 1 mM EDTA) and once with 80ul of 1X T4 ligase buffer <br />
<br />
'''BioByte-like assembly'''<br />
<br />
*Bead preparation <br />
<br />
*Quickly vortex beads stock solution to obtain homogeneous suspension <br />
<br />
*Aliquot 40 µl of the beads into 1.5ml Eppendorf tubes - gently tap the tubes to collect all the beads at the bottom.<br />
<br />
*Place the tubes on the magnetic rack (or place a magnet on the side of each tube) and wait for the beads to be cleared out from the solution <br />
<br />
*Carefully discard the supernatant whilst beads are still attached to the side wall <br />
<br />
*Resuspend beads in 80ul of wash/binding buffer by gentle flicking (vortexing at high speed is not recommended) <br />
<br />
*Wash the beads once with 80 µl of 1X T4 Ligase buffer, before addition of ligation premix.<br />
<br />
*Add the DNA fragments using the ligation premix: 1) 25 µl of Quick Ligase (2X buffer); 2) Amount of DNA corresponding to 200 ng. The optimal DNA concentration for the ViroByte fragments assembly was experimentally established and was in range of 200 ng per fragment. Using higher and lower DNA concentrations did not give any positive assembly results; 3) Fill up with water to obtain the 50 µl total volume.<br />
<br />
*For the ligation procedure the Quick Ligase was used that showed to be more efficient during the experimental procedure in comparison to the ordinary T4 Ligase. Optimal ligation time for the Virobytes ligation was between 15-25 minutes.<br />
<br />
*After the last DNA fragment ligation wash the beads once with Wash/Binding buffer. Moreover the DNA should be cleaved from the beads by using HindIII restriction enzyme (or the other one depending on your designed cleavage site). For the restriction a standard protocol for the DNA digestion should be used.<br />
<br />
==Notebook==<br />
<br />
For further reference please find our lab notebook [https://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytes here].<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:42:09Z<p>Rudolf: /* 15/10/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
<br />
==15/10/2010==<br />
<br />
**Fragments 1-4; 5-8 assembly.<br />
<br />
*ligation time 20-25min @ 16°C <br />
*60ul of beads<br />
*60ul Anchor solution (Nanodrop - 196ng/ul)<br />
*2x wash with 100ul w/b buffer<br />
*1x wash with 100ul 1x T4 ligase buffer<br />
*gentle flicking only to dissolve the bead pellet from the wall<br />
<br />
[[Image:Gel_546.jpg|thumb|400px|right|]]<br />
<br />
*1 - fragments 1-4 assembly.<br />
*2 - fragments control.<br />
*3 - assembly ligation mix<br />
M - DNA 1kb ladder<br />
*4 - fragments 5-8 assembly.<br />
*5 - fragments control.<br />
*6 - assembly ligation mix<br />
<br />
==18/10/2010==<br />
<br />
**Fragments 1-4;<br />
<br />
<br />
[[Image:Gel_547.png|thumb|500px|right|]]<br />
<br />
M - DNA 1kb ladder<br />
*1 - control (fragments 1-4 from AAV1).<br />
*2 - fragments 1-4 assembly<br />
*3 - fragments 1-4 assembly (2nd reaction)<br />
*4 - negative control<br />
<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
[[Image:hot start 25102010 a.png|thumb|350px|center|fragments 1-8 of AAV1 and 1-4 of AAV2]]<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
<br />
[[Image:hot start 25102010 c.png|thumb|350px|center|fragments 1-8 of AAV8 and 1-4 of AAV5]]<br />
<br />
==26/10/2010==<br />
<br />
*Fragment digest, Bsa1, 3hrs, purified from gel <br />
**7ul fragment DNA<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**1ul Bsa1<br />
**16ul nuclease free water<br />
<br />
==27/10/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
<br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T03:38:34Z<p>Rudolf: /* Protocols */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final_1.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br /><br />
<br />
===Anchor===<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes#Protocols Protocols]). The final Anchor construct contains important restriction sites as well as the VirByte_for sequence used for final PCR amplification. First recognition site is HindIII which we used for separating the beads from the assembled DNA before PCR. Second restriction sequence corresponds to PacI which is a common non-cutter within all AAV serotypes used and can be emplyed for further ligation into an appropriate vector. Most importantly the 3'-end forms a sticky end compatible with the so-called "start overhang" of all fragments'''1'''.<br />
<br />
Annotated sequence of anchor oligos:<br />
<br />
<br /><br />
<br />
Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+4nt(cap specific)<br />
<br />
*first 15nt form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
* ''italicized'' is HindIII recognition site<br />
<br />
* '''bold''' is amplification (VirByte_for) sequence<br />
<br />
* '''''bold italicized''''' is PacI recognition site<br />
<br />
Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
* reverse complimentary strand to Anchors<br />
<br />
<br />
Final Anchor construct used:<br />
<br />
5'-Biotin-tctctctctctctctaagcttgtctgagtgactagcattcgttaattaac+4nt-3'<br />
3'-ttcgaacagactcactgatcgtaagcaattaattg-5' <br />
<br />
===Primers===<br />
<br />
Fragment X forward [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers]:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
* NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI) forming the 5'-overhang<br />
<br />
<br />
Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
==Protocols==<br />
<br />
'''ViroByte construction'''<br />
<br />
*perform ViroByte PCR to obtain desired fragments with complementary ends <br />
<br />
*digestion with Bsa1 <br />
<br />
'''Anchor preparation'''<br />
<br />
*Mix 10ul of Anchor 5 (100uM stock) with 50ul of Anchor 12689 (100ul stock); add 1.08ml of nuclease free water; mix gently<br />
<br />
*heat on the block to 95degrees for 2 minutes and let cool slowly to room temperature<br />
<br />
'''Anchor docking'''<br />
<br />
*after washing the beads and aspiration of the cleared solution the beads are ready for adding of the Anchor <br />
<br />
*add 40ul of the Anchor solution (~200ng/ul) <br />
<br />
*resuspend the beads and let incubate at room temperature for 15-20 minutes with occasional flicking in order to maintain the homogeneity of the solution <br />
<br />
*applying magnet, wash twice with 80ul of wash/binding buffer (0.5 M NaCl; 20 mM Tris HCl (pH 7.5); 1 mM EDTA) and once with 80ul of 1X T4 ligase buffer <br />
<br />
'''BioByte-like assembly'''<br />
<br />
*Bead preparation <br />
<br />
*Quickly vortex beads stock solution to obtain homogeneous suspension <br />
<br />
*Aliquot 40 µl of the beads into 1.5ml Eppendorf tubes - gently tap the tubes to collect all the beads at the bottom.<br />
<br />
*Place the tubes on the magnetic rack (or place a magnet on the side of each tube) and wait for the beads to be cleared out from the solution <br />
<br />
*Carefully discard the supernatant whilst beads are still attached to the side wall <br />
<br />
*Resuspend beads in 80ul of wash/binding buffer by gentle flicking (vortexing at high speed is not recommended) <br />
<br />
*Wash the beads once with 80 µl of 1X T4 Ligase buffer, before addition of ligation premix.<br />
<br />
*Add the DNA fragments using the ligation premix: 1) 25 µl of Quick Ligase (2X buffer); 2) Amount of DNA corresponding to 200 ng. The optimal DNA concentration for the ViroByte fragments assembly was experimentally established and was in range of 200 ng per fragment. Using higher and lower DNA concentrations did not give any positive assembly results; 3) Fill up with water to obtain the 50 µl total volume.<br />
<br />
*For the ligation procedure the Quick Ligase was used that showed to be more efficient during the experimental procedure in comparison to the ordinary T4 Ligase. Optimal ligation time for the Virobytes ligation was between 15-25 minutes.<br />
<br />
*After the last DNA fragment ligation wash the beads once with Wash/Binding buffer. Moreover the DNA should be cleaved from the beads by using HindIII restriction enzyme (or the other one depending on your designed cleavage site). For the restriction a standard protocol for the DNA digestion should be used.<br />
<br />
==Notebook==<br />
<br />
For further reference please find our lab notebook [https://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytes here].<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:33:52Z<p>Rudolf: /* 27/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
<br />
==15/10/2010==<br />
<br />
Fragments 1-4; 5-8 assembly.<br />
<br />
<br />
[[Image:Gel_546.jpg|thumb|600px|right|]]<br />
<br />
*1 - fragments 1-4 assembly.<br />
*2 - fragments control.<br />
*3 - assembly ligation mix<br />
M - DNA 1kb ladder<br />
*4 - fragments 1-4 assembly.<br />
*5 - fragments control.<br />
*6 - assembly ligation mix<br />
<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
[[Image:hot start 25102010 a.png|thumb|350px|center|fragments 1-8 of AAV1 and 1-4 of AAV2]]<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
<br />
[[Image:hot start 25102010 c.png|thumb|350px|center|fragments 1-8 of AAV8 and 1-4 of AAV5]]<br />
<br />
==26/10/2010==<br />
<br />
*Fragment digest, Bsa1, 3hrs, purified from gel <br />
**7ul fragment DNA<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**1ul Bsa1<br />
**16ul nuclease free water<br />
<br />
==27/10/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
<br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:32:35Z<p>Rudolf: /* October */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
[[Image:hot start 25102010 a.png|thumb|350px|center|fragments 1-8 of AAV1 and 1-4 of AAV2]]<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
<br />
[[Image:hot start 25102010 c.png|thumb|350px|center|fragments 1-8 of AAV8 and 1-4 of AAV5]]<br />
<br />
==26/10/2010==<br />
<br />
*Fragment digest, Bsa1, 3hrs, purified from gel <br />
**7ul fragment DNA<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**1ul Bsa1<br />
**16ul nuclease free water<br />
<br />
==27/09/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
<br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:26:41Z<p>Rudolf: /* 26/10/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
==26/10/2010==<br />
<br />
*Fragment digest, Bsa1, 3hrs, purified from gel <br />
**7ul fragment DNA<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**1ul Bsa1<br />
**16ul nuclease free water<br />
<br />
==27/09/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
<br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:23:57Z<p>Rudolf: /* 27/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
==26/10/2010==<br />
<br />
* Assembly of 1-4, 5-8 and 1-8 assemblies<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
................................................ <br />
98 °C/30s <br />
................................................ (1x <br />
98 °C/15 s <br />
72 °C/15 s (- 1.0 °C/cycle) <br />
72 °C/1 min <br />
................................................ (17x) <br />
98 °C/15 s <br />
55 °C/30 s <br />
72 °C/1 min <br />
................................................ (20x) <br />
72 °C/10 min <br />
................................................ (1x) <br />
4 °C/ hold<br />
................................................ <br />
<br />
[[Image:assembly 26102010.png|thumb|350px|center|assembly of 1-4 5-8 1-8 and controls]]<br />
==27/09/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
<br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:23:16Z<p>Rudolf: /* 27/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
==26/10/2010==<br />
<br />
* Assembly of 1-4, 5-8 and 1-8 assemblies<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
................................................ <br />
98 °C/30s <br />
................................................ (1x <br />
98 °C/15 s <br />
72 °C/15 s (- 1.0 °C/cycle) <br />
72 °C/1 min <br />
................................................ (17x) <br />
98 °C/15 s <br />
55 °C/30 s <br />
72 °C/1 min <br />
................................................ (20x) <br />
72 °C/10 min <br />
................................................ (1x) <br />
4 °C/ hold<br />
................................................ <br />
<br />
[[Image:assembly 26102010.png|thumb|350px|center|assembly of 1-4 5-8 1-8 and controls]]<br />
==27/09/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
<br />
72 °C/15 s (- 1.0 °C/cycle) <br />
<br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s<br />
<br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:22:48Z<p>Rudolf: /* 27/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
==26/10/2010==<br />
<br />
* Assembly of 1-4, 5-8 and 1-8 assemblies<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
................................................ <br />
98 °C/30s <br />
................................................ (1x <br />
98 °C/15 s <br />
72 °C/15 s (- 1.0 °C/cycle) <br />
72 °C/1 min <br />
................................................ (17x) <br />
98 °C/15 s <br />
55 °C/30 s <br />
72 °C/1 min <br />
................................................ (20x) <br />
72 °C/10 min <br />
................................................ (1x) <br />
4 °C/ hold<br />
................................................ <br />
<br />
[[Image:assembly 26102010.png|thumb|350px|center|assembly of 1-4 5-8 1-8 and controls]]<br />
==27/09/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
<br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/15 s (- 1.0 °C/cycle) <br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s <br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:22:07Z<p>Rudolf: /* 27/09/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
==26/10/2010==<br />
<br />
* Assembly of 1-4, 5-8 and 1-8 assemblies<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
................................................ <br />
98 °C/30s <br />
................................................ (1x <br />
98 °C/15 s <br />
72 °C/15 s (- 1.0 °C/cycle) <br />
72 °C/1 min <br />
................................................ (17x) <br />
98 °C/15 s <br />
55 °C/30 s <br />
72 °C/1 min <br />
................................................ (20x) <br />
72 °C/10 min <br />
................................................ (1x) <br />
4 °C/ hold<br />
................................................ <br />
<br />
[[Image:assembly 26102010.png|thumb|350px|center|assembly of 1-4 5-8 1-8 and controls]]<br />
==27/09/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
................................................ <br />
<br />
98 °C/30s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/15 s (- 1.0 °C/cycle) <br />
72 °C/1 min <br />
<br />
................................................ (17x) <br />
<br />
98 °C/15 s <br />
55 °C/30 s <br />
<br />
72 °C/1 min <br />
................................................ (20x) <br />
<br />
72 °C/10 min <br />
<br />
................................................ (1x) <br />
<br />
4 °C/ hold<br />
<br />
................................................ <br />
<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Notebook/Capsid Shuffling/ViroBytes2010-10-28T03:20:12Z<p>Rudolf: /* ViroBytes */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
__NOTOC__<br />
=ViroBytes=<br />
<br />
Virobytes is a rational approach to fragment-based DNA shuffling of Adeno-associated viral Cap genes. The method is complementary to our conventional [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based homology based DNA shuffling]. ViroByte strategy is based on [https://2009.igem.org/Team:Alberta BioByte] protocol which have been modified in order to enable for randomized fragment assembly.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_shuff.jpg|thumb|350px|left|ViroBytes Assembly Scheme]]<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Notebook/Capsid Shuffling/ViroBytes2010-10-28T03:19:21Z<p>Rudolf: /* ViroBytes */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
__NOTOC__<br />
=ViroBytes=<br />
<br />
Virobytes is a rational approach to fragment-based DNA shuffling of Adeno-associated viral Cap genes. The method is complementary to our conventional [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based homology based DNA shuffling]. ViroByte strategy is based on [https://2009.igem.org/Team:Alberta BioByte] protocol which have been modified in order to enable for randomized fragment assembly.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_shuff.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/File:Hot_start_25102010_b.pngFile:Hot start 25102010 b.png2010-10-28T03:18:25Z<p>Rudolf: </p>
<hr />
<div></div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:17:49Z<p>Rudolf: /* 25/10/2010 */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
<br />
98 °C/45 s <br />
<br />
................................................ (1x <br />
<br />
98 °C/15 s <br />
72 °C/30 s <br />
<br />
................................................ (35x) <br />
<br />
72 °C/10 min <br />
<br />
................................................<br />
<br />
4 °C/ hold<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
==26/10/2010==<br />
<br />
* Assembly of 1-4, 5-8 and 1-8 assemblies<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
................................................ <br />
98 °C/30s <br />
................................................ (1x <br />
98 °C/15 s <br />
72 °C/15 s (- 1.0 °C/cycle) <br />
72 °C/1 min <br />
................................................ (17x) <br />
98 °C/15 s <br />
55 °C/30 s <br />
72 °C/1 min <br />
................................................ (20x) <br />
72 °C/10 min <br />
................................................ (1x) <br />
4 °C/ hold<br />
................................................ <br />
<br />
[[Image:assembly 26102010.png|thumb|350px|center|assembly of 1-4 5-8 1-8 and controls]]<br />
==27/09/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/OctoberTeam:Heidelberg/Notebook/ViroBytes/October2010-10-28T03:17:08Z<p>Rudolf: /* October */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
__NOTOC__<br />
=October=<br />
<br />
==4/10/2010==<br />
<br />
*digest of 8 fragments with BsaI-HF @ 37°C for 1hr<br />
**6x2ul of F1-8<br />
**3ul NEB4 10x<br />
**3ul BSA 10x<br />
**11ul H<sub>2</sub>O<br />
**1ul BsaI-HF<br />
*purification with Nucleotide Removal Kit<br />
*NanoDrop concentration check:<br />
<br /><br />
{| class="wikitable" border="1" style="text-align: center; width: 620px; height: 80px;"<br />
|-<br />
! Fragment 1<br />
! Fragment 2<br />
! Fragment 3<br />
! Fragment 4<br />
! Fragment 5<br />
! Fragment 6<br />
! Fragment 7<br />
! Fragment 8<br />
|-<br />
| 35.5 ng/ul<br />
| 43.5 ng/ul<br />
| 43.0 ng/ul<br />
| 43.0 ng/ul<br />
| 79.0 ng/ul<br />
| 51.0 ng/ul<br />
| 63.0 ng/ul<br />
| 44.0 ng/ul<br />
|}<br />
<br /><br />
<br />
==5/10/2010==<br />
<br />
*assembly started with Quick ligase kit<br />
*~200ng of fragment DNA per reaction<br />
*ligation time ~10min<br />
==25/10/2010==<br />
<br />
*ViroByte PCR with Phusion High-Fidelity Hot Start<br />
<br />
PCR was set up as follows:<br />
<br />
10 ul Phusion HF Buffer 5x<br />
1ul of dNTP<br />
0.5 ul of 100 um primers<br />
2 ul of AAV template<br />
36 ul of water<br />
<br />
................................................ <br />
98 °C/45 s <br />
................................................ (1x <br />
98 °C/15 s <br />
72 °C/30 s <br />
................................................ (35x) <br />
72 °C/10 min <br />
................................................<br />
4 °C/ hold<br />
<br />
<br />
[[Image:hot start 25102010 b.png|thumb|350px|center|fragments 5-8 of AAV2 and 1-8 of AAV6]]<br />
<br />
==26/10/2010==<br />
<br />
* Assembly of 1-4, 5-8 and 1-8 assemblies<br />
<br />
Touchdown Phusion HiFi PCR was performed according to the following protocol: <br />
................................................ <br />
98 °C/30s <br />
................................................ (1x <br />
98 °C/15 s <br />
72 °C/15 s (- 1.0 °C/cycle) <br />
72 °C/1 min <br />
................................................ (17x) <br />
98 °C/15 s <br />
55 °C/30 s <br />
72 °C/1 min <br />
................................................ (20x) <br />
72 °C/10 min <br />
................................................ (1x) <br />
4 °C/ hold<br />
................................................ <br />
<br />
[[Image:assembly 26102010.png|thumb|350px|center|assembly of 1-4 5-8 1-8 and controls]]<br />
==27/09/2010==<br />
<br />
AAV 1 fragments 1-4; 5-8 and 1-8 (full capsid) assembly<br />
<br />
[[Image:Full_assembly_27.10.10.jpg|thumb|600px|right|]]<br />
<br />
<br />
**Gel loading scheme:<br />
**M - GeneRuler 1kb DNA ladder<br />
**F 1-4 - fragments 1-4 assembly<br />
**F 5-8 - fragments 5-8 assembly<br />
**F 1-8 - fragments 1-8 assembly<br />
**C 1-4 - fragments 1-4 control<br />
**C 5-8 - fragments 5-8 control<br />
**C 1-8 - fragments 1-8 control<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Notebook/Capsid Shuffling/ViroBytes2010-10-28T02:46:31Z<p>Rudolf: /* ViroBytes */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
__NOTOC__<br />
=ViroBytes=<br />
<br />
Virobytes is a rational approach to fragment-based DNA shuffling of Adeno-associated viral Cap genes. The method is complementary to our conventional [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based homology based DNA shuffling]. ViroByte strategy is based on [https://2009.igem.org/Team:Alberta BioByte] protocol which have been modified in order to enable for randomized fragment assembly.<br />
<br />
paste picture here<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Notebook/Capsid Shuffling/ViroBytes2010-10-28T02:44:52Z<p>Rudolf: /* ViroBytes */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
__NOTOC__<br />
=ViroBytes=<br />
<br />
Virobytes is a rational approach to fragment-based DNA shuffling of Adeno-associated viral Cap genes. The method is complementary to our conventional [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/Homology_Based homology based DNA shuffling]. ViroByte strategy is based on [https://2009.igem.org/Team:Alberta BioByte] protocol which we have been modified in order to enable for randomized fragment assembly.<br />
<br />
paste picture here<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Notebook/Capsid Shuffling/ViroBytes2010-10-28T02:34:48Z<p>Rudolf: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
__NOTOC__<br />
=ViroBytes=<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Notebook/Capsid Shuffling/ViroBytes2010-10-28T02:33:36Z<p>Rudolf: </p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|note_virobytes}}<br />
{{:Team:Heidelberg/Side_Top}}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#78b41e; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#009be1;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September<font color="#ffecba">September</font>]<br />
|- style="background:#009be1; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="2"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#01.2F09.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#02.2F09.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#03.2F09.2F2010 3]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#04.2F09.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#05.2F09.2F2010 5]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#06.2F09.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#07.2F09.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#08.2F09.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#09.2F09.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#10.2F09.2F2010 10]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#11.2F09.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#12.2F09.2F2010 12]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#13.2F09.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#14.2F09.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#15.2F09.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#16.2F09.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#17.2F09.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#18.2F09.2F2010 18]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#19.2F09.2F2010 19]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#20.2F09.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#21.2F09.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F09.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#23.2F09.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#24.2F09.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#25.2F09.2F2010 25]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#26.2F09.2F2010 26]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#27.2F09.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#28.2F09.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#29.2F09.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/September#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
| colspan="7"| <span style="color:#ffffff">-</span><br />
|}<br />
<br />
<br />
{| cellpadding="5" cellspacing="0" align="center" style="text-align: center; color:#f09600; border: 1.5px solid #333333;"<br />
|- border="0"<br />
! colspan="7" style="background:#78b41e;" | [https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October<font color="white">October</font>]<br />
|- style="background:#78b41e; color:white"<br />
|width="20pt"|'''M'''||width="20pt"|'''T'''||width="20pt"|'''W'''||width="20pt"|'''T'''||width="20pt"|'''F'''||width="20pt"|'''S'''||width="20pt"|'''S'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="4"| ||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#01.2F10.2F2010 1]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#02.2F10.2F2010 2]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#03.2F10.2F2010 3]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#04.2F10.2F2010 4]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#05.2F10.2F2010 5]'''<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#06.2F10.2F2010 6]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#07.2F10.2F2010 7]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#08.2F10.2F2010 8]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#09.2F10.2F2010 9]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#10.2F10.2F2010 10]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#11.2F10.2F2010 11]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#12.2F10.2F2010 12]'''|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#13.2F10.2F2010 13]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#14.2F10.2F2010 14]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#15.2F10.2F2010 15]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#16.2F10.2F2010 16]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#17.2F10.2F2010 17]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#18.2F10.2F2010 18]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#19.2F10.2F2010 19]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#20.2F10.2F2010 20]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#21.2F10.2F2010 21]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F10.2F2010 22]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#23.2F10.2F2010 23]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#24.2F10.2F2010 24]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#25.2F10.2F2010 25]'''<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#26.2F10.2F2010 26]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#27.2F10.2F2010 27]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#28.2F10.2F2010 28]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#29.2F10.2F2010 29]'''||'''[https://2010.igem.org/Team:Heidelberg/Notebook/ViroBytes/October#22.2F30.2F2010 30]'''||colspan="3"|<br />
|- style="background:#f2f2f2; color:#78b41e"<br />
|colspan="7"|<br />
<span style="color:#ffffff">-</span><br />
|}<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
<br />
__NOTOC__<br />
===ViroBytes===<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T02:13:31Z<p>Rudolf: /* ViroBytes */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br /><br />
<br />
===Anchor===<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes#Protocols Protocols]). The final Anchor construct contains important restriction sites as well as the VirByte_for sequence used for final PCR amplification. First recognition site is HindIII which we used for separating the beads from the assembled DNA before PCR. Second restriction sequence corresponds to PacI which is a common non-cutter within all AAV serotypes used and can be emplyed for further ligation into an appropriate vector. Most importantly the 3'-end forms a sticky end compatible with the so-called "start overhang" of all fragments'''1'''.<br />
<br />
Annotated sequence of anchor oligos:<br />
<br />
<br /><br />
<br />
Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+4nt(cap specific)<br />
<br />
*first 15nt form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
* ''italicized'' is HindIII recognition site<br />
<br />
* '''bold''' is amplification (VirByte_for) sequence<br />
<br />
* '''''bold italicized''''' is PacI recognition site<br />
<br />
Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
* reverse complimentary strand to Anchors<br />
<br />
<br />
Final Anchor construct used:<br />
<br />
5'-Biotin-tctctctctctctctaagcttgtctgagtgactagcattcgttaattaac+4nt-3'<br />
3'-ttcgaacagactcactgatcgtaagcaattaattg-5' <br />
<br />
===Primers===<br />
<br />
Fragment X forward [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers]:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
* NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI) forming the 5'-overhang<br />
<br />
<br />
Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
<br />
==Notebook==<br />
<br />
For further reference please find our lab notebook [https://2010.igem.org/Team:Heidelberg/Notebook/Capsid_Shuffling/ViroBytes here].<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T02:08:00Z<p>Rudolf: /* Primers */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br /><br />
<br />
===Anchor===<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes#Protocols Protocols]). The final Anchor construct contains important restriction sites as well as the VirByte_for sequence used for final PCR amplification. First recognition site is HindIII which we used for separating the beads from the assembled DNA before PCR. Second restriction sequence corresponds to PacI which is a common non-cutter within all AAV serotypes used and can be emplyed for further ligation into an appropriate vector. Most importantly the 3'-end forms a sticky end compatible with the so-called "start overhang" of all fragments'''1'''.<br />
<br />
Annotated sequence of anchor oligos:<br />
<br />
<br /><br />
<br />
Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+4nt(cap specific)<br />
<br />
*first 15nt form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
* ''italicized'' is HindIII recognition site<br />
<br />
* '''bold''' is amplification (VirByte_for) sequence<br />
<br />
* '''''bold italicized''''' is PacI recognition site<br />
<br />
Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
* reverse complimentary strand to Anchors<br />
<br />
<br />
Final Anchor construct used:<br />
<br />
5'-Biotin-tctctctctctctctaagcttgtctgagtgactagcattcgttaattaac+4nt-3'<br />
3'-ttcgaacagactcactgatcgtaagcaattaattg-5' <br />
<br />
===Primers===<br />
<br />
Fragment X forward [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers]:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
* NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI) forming the 5'-overhang<br />
<br />
<br />
Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T01:59:04Z<p>Rudolf: /* ViroByte design */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br /><br />
<br />
===Anchor===<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes#Protocols Protocols]). The final Anchor construct contains important restriction sites as well as the VirByte_for sequence used for final PCR amplification. First recognition site is HindIII which we used for separating the beads from the assembled DNA before PCR. Second restriction sequence corresponds to PacI which is a common non-cutter within all AAV serotypes used and can be emplyed for further ligation into an appropriate vector. Most importantly the 3'-end forms a sticky end compatible with the so-called "start overhang" of all fragments'''1'''.<br />
<br />
Annotated sequence of anchor oligos:<br />
<br />
<br /><br />
<br />
Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+4nt(cap specific)<br />
<br />
*first 15nt form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
* ''italicized'' is HindIII recognition site<br />
<br />
* '''bold''' is amplification (VirByte_for) sequence<br />
<br />
* '''''bold italicized''''' is PacI recognition site<br />
<br />
Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
* reverse complimentary strand to Anchors<br />
<br />
<br />
Final Anchor construct used:<br />
<br />
5'-Biotin-tctctctctctctctaagcttgtctgagtgactagcattcgttaattaac+4nt-3'<br />
3'-ttcgaacagactcactgatcgtaagcaattaattg-5' <br />
<br />
===Primers===<br />
<br />
*Fragment X forward [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers]:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
* '''bold''' is BsaI recognition sequence<br />
<br />
* NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI) forming the 5'-overhang<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T01:46:20Z<p>Rudolf: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes#Protocols Protocols]). The final Anchor construct contains important restriction sites as well as the VirByte_for sequence used for final PCR amplification. First recognition site is HindIII which we used for separating the beads from the assembled DNA before PCR. Second restriction sequence corresponds to PacI which is a common non-cutter within all AAV serotypes used and can be emplyed for further ligation into an appropriate vector. Most importantly the 3'-end forms a sticky end compatible with the so-called "start overhang" of all fragments'''1'''.<br />
<br />
Annotated sequence of anchor oligos:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+4nt(cap specific)<br />
<br />
- first 15nt form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition site<br />
<br />
- '''bold''' is amplification (VirByte_for) sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition site<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers]:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T01:28:44Z<p>Rudolf: /* ViroByte design */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes#Protocols Protocols]). The final Anchor construct contains important restriction sites as well as the VirByte_for sequence used for final PCR amplification. First recognition site is HindIII which we used for separating the beads from the assembled DNA before PCR. Second restriction sequence corresponds to PacI which is a common non-cutter within all AAV serotypes used and can be emplyed for further ligation into an appropriate vector. Most importantly the 3'-end forms a sticky end compatible with the so-called "start overhang" of all fragments'''1'''.<br />
<br />
Annotated sequence of anchor oligos:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+4nt(cap specific)<br />
<br />
- first 15nt form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition site<br />
<br />
- '''bold''' is amplification (VirByte_for) sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition site<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T01:12:08Z<p>Rudolf: /* ViroByte design */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
Anchor for ViroByte assembly was designed according to [https://2009.igem.org/Team:Alberta/DNAanchor BioByte Anchor System]. We used 5'-biotinylated oligos which were annealed with Anchor_complementary sequences (see Protocols)<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+5nt(cap specific)<br />
<br />
- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition sequence<br />
<br />
- '''bold''' is amplification sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition sequence<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T01:06:25Z<p>Rudolf: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final.jpg|thumb|350px|center|ViroBytes Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+5nt(cap specific)<br />
<br />
- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition sequence<br />
<br />
- '''bold''' is amplification sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition sequence<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T01:05:51Z<p>Rudolf: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final.jpg|thumb|350px|center|ViroByte Assembly Scheme]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+5nt(cap specific)<br />
<br />
- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition sequence<br />
<br />
- '''bold''' is amplification sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition sequence<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T01:02:25Z<p>Rudolf: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br /><br />
<br />
[[Image:Virobytes_final.jpg|thumb|350px|center|]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+5nt(cap specific)<br />
<br />
- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition sequence<br />
<br />
- '''bold''' is amplification sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition sequence<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T00:52:16Z<p>Rudolf: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
[[Image:Virobytes_final.jpg|thumb|350px|center|]]<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+5nt(cap specific)<br />
<br />
- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition sequence<br />
<br />
- '''bold''' is amplification sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition sequence<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T00:47:52Z<p>Rudolf: </p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
<br />
==Important facts==<br />
<br />
Shuffling of several (six in our case) wild-type AAV serotypes unfortunately does not allow for standardization of the Virobyte fragments. We use type II restriction enzyme Bsa1 for creating the sticky ends instead. Incorporation of the recognition sequence of Bsa1 at both ends of the ViroBytes allows for higher specificity and thus prevents non-neighbouring fragments from ligating. The homology regions within which the Bsa1 enzyme cuts provide possibility for fragment shuffling without creating sequence frameshifts or deletions leading to nonviable chimeric isolates.<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence the overhang created at each fragment ending: 5'-NNNN<br />
<br />
Homology regions employed in our Virobyte approach were selected as follows:<br />
<br />
between Anchor and Fragment1 ("Start overhang"): <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716 ,AAV1):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016 ,AAV1):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285 ,AAV1):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447 ,AAV1):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743 ,AAV1):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043 ,AAV1):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+5nt(cap specific)<br />
<br />
- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition sequence<br />
<br />
- '''bold''' is amplification sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition sequence<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T00:04:32Z<p>Rudolf: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) using conventional shuffling strategies ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). Application of magnetic beads for controlled assembly and the principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
AAV serotypes 1,2,5,6,8 and 9 were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
==Important facts==<br />
<br />
Biobrick standards...<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence overhang: 5'-NNNN<br />
<br />
Homology region used:<br />
<br />
between Anchor and Fragment1: <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+5nt(cap specific)<br />
<br />
- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition sequence<br />
<br />
- '''bold''' is amplification sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition sequence<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-28T00:03:26Z<p>Rudolf: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure used for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus (AAV). Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) observed in standard shuffling techniques ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). The principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
Five AAV serotypes (1,2,5,6,8 and 9) were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These [https://2010.igem.org/Team:Heidelberg/Notebook/Material/Primer#ViroBytes_primers primers] contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
==Important facts==<br />
<br />
Biobrick standards...<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence overhang: 5'-NNNN<br />
<br />
Homology region used:<br />
<br />
between Anchor and Fragment1: <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+5nt(cap specific)<br />
<br />
- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition sequence<br />
<br />
- '''bold''' is amplification sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition sequence<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Notebook/Material/PrimerTeam:Heidelberg/Notebook/Material/Primer2010-10-28T00:00:24Z<p>Rudolf: /* ViroBytes primers */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
<br />
{{:Team:Heidelberg/tables|normal=FFF|highlight=ddd}}<br />
<br />
{{:Team:Heidelberg/Single_Pagetop|note_primer}}<br />
<br />
__NOTOC__<br />
<br />
==Primer Table==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified !! origin !! for backbone<br />
|-<br />
|align="right"| 001 || Casp8FWEcoR1 || ttttgaattcatggacttcagcagaaatc || Caspase8 death gene || Caspase8 ||<br />
|-<br />
|align="right"| 002 || CMV_AgeI_fw || ttttaccggtagaatctgcttagggttagg || CMV, shRNA || pcDNA5/FRT-shRNA || pTR-UF3 <br />
|-<br />
|align="right"| 003 || CMVshRNApA_BglII_rv || taatagatctcagaagccatagagcccacc || CMV, shRNA || pcDNA5/FRT-shRNA || pTR-UF3<br />
|-<br />
|align="right"| 004 || EGFPRVFse1 || ttttggccggcccttgtacagctcgtccatg || EGFP || GFP ||<br />
|-<br />
|align="right"| 005 || ElenasFirstSyntheticRNA_F || aatatgtctaaactattatttatgccaaccagccaatctagctactgctaggc || part 2 Elenas first synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 006 || ElenasFirstSyntheticRNA_R || aataatagtttagacatatttatgccagccagccagaccagctctgctaagg || part 3 Elenas first synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 007 || ElenasSecondSyntheticRNA_F || gacatgtctaaactattgtcttcggtagcgtcgtagactagctactgctaggc || part 2 Elenas second synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 008 || ElenasSecondSyntheticRNA_R || gacaatagtttagacatgtcttcggtatcgtcgtatcccagctctgctaagg || part 3 Elenas second synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 009 || ElenasThirdSyntheticRNA_F || tatttgtctaaactataataattcgcggctggcctgactagctactgctaggc || part 2 Elenas third synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 010 || ElenasThirdSyntheticRNA_R || tattatagtttagacaaataattcgcgtctggccttcccagctctgctaagg || part 3 Elenas third synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 011 || ElenasFifthSyntheticRNA_F || tatttgtctaaactataataattcgcggctggcctgactagctactgctaggc || part 2 Elenas fifth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 012 || ElenasFifthSyntheticRNA_R || atctatagtttagacaagatgaaacgccgagttaacgccagctctgctaagg || part 3 Elenas fifth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 013 || ElenasSixthSyntheticRNA_F || ttattgtctaaactatataactgccgtaactccaaatctagctactgctaggc || part 2 Elenas sixth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 014 || ElenasSixthSyntheticRNA_R || ttatatagtttagacaataactgccgtcactccaacgccagctctgctaagg || part 3 Elenas sixth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 015 || ElenasSeventhSyntheticRNA_F || atcttgtctaaactatagataactgccatcactccccctagctactgctaggc || part 2 Elenas seventh synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 016 || ElenasSeventhSyntheticRNA_R || atctatagtttagacaagataactgccgtcactccaaccagctctgctaagg || part 3 Elenas seventh synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 017 || ElenasEighthSyntheticRNA_F || tacatgtctaaactattgtagtcggttcatgcagcccctagctactgctaggc || part 2 Elenas eighth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 018 || ElenasEighthSyntheticRNA_R || tacaatagtttagacatgtagtcggtttatgcagcaaccagctctgctaagg || part 3 Elenas eighth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 019 || ElenasNinethSyntheticRNA_F || aaattgtctaaactatatttgatccagagatacagaactagctactgctaggc || part 2 Elenas nineth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 020 || ElenasNinethSyntheticRNA_R || aaatatagtttagacaatttgatccagcgatacagcgccagctctgctaagg || part 3 Elenas nineth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 021 || ElenasTenthSyntheticRNA_F || attatgtctaaactattaatatcggtgaccgtggtacctagctactgctaggc || part 2 Elenas tenth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 022 || ElenasTenthSyntheticRNA_R || attaatagtttagacataatatcggtggccgtggtgtccagctctgctaagg || part 3 Elenas tenth synthetic shRNA || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 023 || FADDFWEcoR1 || ttttgaattcatgggcggtaggcgtgtacg || FADD || || <br />
|-<br />
|align="right"| 024 || gE1A-Fse1_rev || tttttccggccggttatggcctggggcctttaca || E1A rescue gene || || <br />
|-<br />
|align="right"| 025 || Hcrfor_HindIII_AgeI_TL || gagtcaagcttaccggttggaggtgaagttaacaccttcgtg || part 1 shRNA against everything; cutting site: HindIII, AgeI || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 026 || Hcrrev_ApaI_SalI_TL || ctcgagggcccgtcgacaagcaaacgatgccaagacatttatcg || part 4 shRNA against everything; cutting site: ApaI, SalI || miRsAg || pC-DNA5 <br />
|-<br />
|align="right"| 027 || HSVluc_norm_BglII_fw || tttttagatcttgcaggagcttcagggagtg || HSV-TK, ''Firefly'' Luciferase || psiCHECK2 || pTR-UF3<br />
|-<br />
|align="right"| 028 || HSVluc_norm_BglII_rv || ttttagatctggttccgcgcacatttccc || HSV-TK, ''Firefly'' Luciferase || psiCHECK2 || pTR-UF3<br />
|-<br />
|align="right"| 029 || Kif11_PLK1_shRNA-hcrfor:ecoRI || gagtcgaattctggaggtgaagttaacaccttcgtg || part 1 shRNA against everything; cutting site: ecoRI || miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 030 || Kif11&PLK1_shRNA_hcrrev:XbaI || ctcgaagatctaagcaaacgatgccaagacatttatcg || part 4 shRNA against everything; cutting site: XbaI || miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 031 || Kif11_shRNA_forward || actctgtctaaactatgagtacattaaacaattcctattagctactgctaggc || part 2 shRNA against Kif11 || miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 032 || Kif11_shRNA_reverse || actcatagtttagacagagtacattaatcaattccattcagctctgctaagg || part3 shRNA against Kif11 || miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 033 || PLK1_shRNA_forward || atgatgtctaaactattcattaagcagatcgttaaccgtagctactgctaggc || part2 shRNA against PLK1|| miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 034 || PLK1_shRNA_reverse || atgaatagtttagacatcattaagcagctcgttaatggcagctctgctaagg || part3 shRNA against PLK1|| miRsAg || pTR-UF3 <br />
|-<br />
|align="right"| 035 || pTR-UF3_Nsp1_for || ctattacgccagctggatgcatcccagctgc || for pTR-UF3 backbone Pst1->Nsi1 mutation || || <br />
|-<br />
|align="right"| 036 || pTR-UF3_Nsp1_rev || gcagctgggatgcatccagctggcgtaatag || for pTR-UF3 backbone Pst1->Nsi1 mutation || || <br />
|-<br />
|align="right"| 037 || pTR-UF3_PstI-NsiI_for || gctattacgccagctggatgcatcccagctgcattaatgaatcgg || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3 <br />
|-<br />
|align="right"| 038 || pTR-UF3_PstI-NsiI_rev || ccgattcattaatgcagctgggatgcatccagctggcgtaatagc || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3 <br />
|-<br />
|align="right"| 039 || pTR-UF3_PstI-NsiI_shifted_rev || cattaatgcagctgggatgcatccagctggcgtaatagcgaagag || mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3<br />
|-<br />
|align="right"| 040 || pTRUF3_seq_fwrv || caactccatcactaggggttcct || sequencing purpose || pTR-UF3 || pTR-UF3<br />
|-<br />
|align="right"| 041 || SCLpsv40_FW || ctcaattagtcagcaaccatagtccc || FWprimer for testing stable integration of shRNA into T-Rex || || T-REx cells <br />
|-<br />
|align="right"| 042 || SCLpsv40_FW || gcaaagtgccgataaacataacgatct || RVprimer for testing stable integration of shRNA into T-Rex || || T-REx cells <br />
|-<br />
|align="right"| 043 || Sequencing primer_pTR-UF3 mutated || ctaaatcggaaccctaaagggagcccccg || sequencing of mutagenesis of PstI to NsiI || pTR-UF3 || pTR-UF3<br />
|-<br />
|align="right"| 044 || Sv40lucmcs_AgeI_fw || ttttaccggtgtggaatgtgtgtcagttag || SV40, ''Renilla'' Luciferase, MCS || pTR-UF3 ||<br />
|-<br />
|align="right"| 045 || Sv40lucmcs_BglII_rv || tattagatctccgcgtcagacaaaccctaac || SV40, ''Renilla'' Luciferase, MCS || psiCHECK2 || pTR-UF3<br />
|-<br />
|align="right"| 046 || tBidGFPRVFse1 || tttttggccggccttacatgtacagctcg || tBid death gene || pcherryBidGFP ||<br />
|-<br />
|align="right"| 047 || tBidFWEcoR1 || tttttgaattcaaccgcagcagccactc || tBid death gene || pcherryBidGFP ||<br />
|-<br />
|align="right"| 048 || tBidRVFse1 || tttttccggccgggtccatcccatttctg || tBid death gene || pcherryBidGFP ||<br />
|-<br />
|align="right"| 049 || TetO2FW || ggggacaacttttctatacaaagttgtccctatcagtgatagagatctc || TetO8 || synthesized tetO8 || Gateway entry vector <br />
|}<br />
<br />
==Standart Kit Cloning Primers==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3') <br />
|-<br />
|align="right"| D001 || backbone_AvrII_fw || ttttcctaggtagcggcgcattaagcgcgg <br />
|-<br />
|align="right"| D002 || backbone_AvrII_rev || ttttcctaggcttgttgtagcttaaattttg <br />
|-<br />
|align="right"| D003 || backbone_ClaI_fw || ttttatcgattagcggcgcattaagcgcgg <br />
|-<br />
|align="right"| D004 || backbone_XhoI_rev || ttttctcgagcttgttgtagcttaaattttg <br />
|-<br />
|align="right"| D005 || BBB_Oligo_XhoI || ccggActgcagcggccgcgcgctagcacactagtgcggccgcgaattCa <br />
|-<br />
|align="right"| D006 || BBB_Oligo_XmaI || tcgatgaattcgcggccgcactagtgtgctagcgcgcggccgctgcagt <br />
|-<br />
|align="right"| D007 || BBB_Oligo_XmaI || tcgatgaattcgcggccgcactagtgtgctagcgcgcggccgctgcagt <br />
|-<br />
|align="right"| D008 || BBB_suffix_reverse || aaaactgcagcggccgcgc <br />
|-<br />
|align="right"| D009 || BGH_pA_BamHI_rc_fw || ttttgaattcgcggccgcactagtggatccccatagagcccaccgcatccc <br />
|-<br />
|align="right"| D010 || BGH_pA_fw || ttttgaattcgcggccgcactagttttaaacccgctgatcagcc <br />
|-<br />
|align="right"| D011 || BGH_pA_rev || ttttctgcagcggccgcgctagcccatagagcccaccgcatccc <br />
|-<br />
|align="right"| D012 || BGH_pA_rc_rev || ttttctgcagcggccgcgctagctttaaacccgctgatcagcc <br />
|-<br />
|align="right"| D013 || biCMV_BBB_fw || ttttgaattcgcggccgcactagtgcgatctgacggttcactaaacg <br />
|-<br />
|align="right"| D014 || biCMV_BBB_fw || ttttgaattcgcggccgcactagtgcgatctgacggttcactaaacg <br />
|-<br />
|align="right"| D015 || biCMV_BBB_rev || ttttctgcagcggccgcgcgctagcacagcggatctgacggttcac <br />
|-<br />
|align="right"| D016 || biCMV_rc_BBB_fw || ttttgaattcgcggccgcactagtagcggatctgacggttcac <br />
|-<br />
|align="right"| D017 || biCMV_rc_BBB_rev || ttttctgcagcggccgcgctagcgcgatctgacggttcac <br />
|-<br />
|align="right"| D018 || CMV_BBB_BamHI_fw || gaattcgcggccgcactagtggatcccgatgtacgggccagatatacg <br />
|-<br />
|align="right"| D019 || CMV_BBB_fw || ttttgaattcgcggccgcactagtcgatgtacgggccagatatacg <br />
|-<br />
|align="right"| D020 || CMV_BBB_rev || ttttctgcagcggccgcgcgctagcacatttcgataagccagtaagc <br />
|-<br />
|align="right"| D021 || CMV_Teto2_BBB_fw || tttt gaattcgcggccgcactagtgttgacattgattattgtctag <br />
|-<br />
|align="right"| D022 || CMV_TetO2_BBB_rev || tttt ctgcagcggccgcgcgctagcaccggaggctggatcggtc <br />
|-<br />
|align="right"| D023 || CMV_rc_BBB_fw || ttttgaattcgcggccgcactagtatttcgataagccagtaagc <br />
|-<br />
|align="right"| D024 || CMV_rc_BBB_rev || ttttctgcagcggccgcgctagccgatgtacgggccagatatacg <br />
|-<br />
|align="right"| D025 || FRT_rev || ctgcagcggccgcgctagcccaaggaagttcctatactttc <br />
|-<br />
|align="right"| D026 || FRT_rev || gaattcgcggccgcactagtttctcgccacgttcgccggc <br />
|-<br />
|align="right"| D027 || hRluc_ter_BBB_fw || ttttgaattcgcggccgcactagtatggcttccaaggtgtacgac <br />
|-<br />
|align="right"| D028 || hRluc_ter_BBB_rev || ttttctgcagcggccgcgctagcttactgctcgttcttcagcacgc <br />
|-<br />
|align="right"| D029 || hsa-mir-122_BBB(perf) || ttttgaattcgcggccgcactagtcaaacaccattgtcacactccagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D030 || hsa-mir-122_BBB(rand9-12) || ttttgaattcgcggccgcactagtcaaacaccatnnnnacactccagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D031 || hsa-mir-122_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnnacactccagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D032 || hsa-mir-122_Sgf_Not(perf) || ttttgcgatcgccaaacaccattgtcacactccagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D033 || hsa-mir-122_Sgf_Not(rand9-12) || ttttgcgatcgccaaacaccatnnnnacactccagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D034 || hsa-mir-122_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnnnacactccagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D035 || hsa-mir-375_BBB(perf) || ttttgaattcgcggccgcactagttcacgcgagccgaacgaacaaagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D036 || hsa-mir-375_BBB(rand9-12) || ttttgaattcgcggccgcactagttcacgcgagcnnnncgaacaaagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D037 || hsa-mir-375_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnncgaacaaagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D038 || hsa-mir-375_Sgf_Not(perf) || ttttgcgatcgctcacgcgagccgaacgaacaaagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D039 || hsa-mir-375_Sgf_Not(rand9-12) || ttttgcgatcgctcacgcgagcnnnncgaacaaagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D040 || hsa-mir-375_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnnncgaacaaagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D041 || hsa-mir-376a_BBB(perf) || ttttgaattcgcggccgcactagtacgtggattttcctctatgatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D042 || hsa-mir-376a_BBB(rand9-12) || ttttgaattcgcggccgcactagtacgtggattnnnntctatgatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D043 || hsa-mir-376a_BBB(rand9-22) || ttttgaattcgcggccgcactagtnnnnnnnnnnnnntctatgatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D044 || hsa-mir-376a_Sgf_Not(perf) || ttttgcgatcgcacgtggattttcctctatgatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D045 || hsa-mir-376a_Sgf_Not(rand9-12) || ttttgcgatcgcacgtggattnnnntctatgatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D046 || hsa-mir-376a_Sgf_Not(rand9-22) || ttttgcgatcgcnnnnnnnnnnnnntctatgatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D047 || igem20100723_01 || tgccacctgacgtctaagaa <br />
|-<br />
|align="right"| D048 || igem20100723_02 || attaccgcctttgagtgagc <br />
|-<br />
|align="right"| D049 || Luc2_ter_BamHI_BBB_rev || ttttctgcagcggccgcgctagcggatcctaccacatttgtagaggttttac <br />
|-<br />
|align="right"| D050 || Luc2_ter_BamHI_BBB_rev || ttttctgcagcggccgcgctagcggatcctaccacatttgtagaggttttac <br />
|-<br />
|align="right"| D051 || Luc2_ter_BBB_fw || ttttgaattcgcggccgcactagtgccaccatggaagatgcc <br />
|-<br />
|align="right"| D052 || mir122_miMeasure_screen_fev || ccgcgctagctggagtgt <br />
|-<br />
|align="right"| D053 || Oligo_Xba_mut_fw || ctagcctcgagttctgaccgccccgggg <br />
|-<br />
|align="right"| D054 || Oligo_Xba_mut_rev || ctagccccggggcggtcagaactcgagg <br />
|-<br />
|align="right"| D055 || pSMB_miMeasure_Screen_fw || gcacaagctggagtacaactac <br />
|-<br />
|align="right"| D056 || pSMB_miMeasure_Screen_rev || ggtttcccgactggaaagcg <br />
|-<br />
|align="right"| D057 || RSV_fw || ttttgaattcgcggccgcactagtcaattctcatgtttgacagc <br />
|-<br />
|align="right"| D058 || RSV_rev || ttttctgcagcggccgcgctagccagcttggaggtgcacacc <br />
|-<br />
|align="right"| D059 || RSV_rc_fw || ttttgaattcgcggccgcactagtcagcttggaggtgcacacc <br />
|-<br />
|align="right"| D060 || RSV_rc_rev || ttttctgcagcggccgcgctagccaattctcatgtttgacagc <br />
|-<br />
|align="right"| D061 || RSV_fw_midcomp || cgaaccactgaataccgcattgcag <br />
|-<br />
|align="right"| D062 || RSV_rev_midcomp || ctgcaatgcggtattcagtggttcg <br />
|-<br />
|align="right"| D063 || SB-prep-3P || gccgctgcagtccggcaaaaaaacg <br />
|-<br />
|align="right"| D064 || SB-prep-2Ea || atgaattccagaaatcatccttagcg <br />
|-<br />
|align="right"| D065 || second_strand_notI || agttgtgacatagcggccgc <br />
|-<br />
|align="right"| D066 || shRNA-6th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnncgtcaatagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D067 || shRNA-7th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnntcaatagagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D068 || shRNA-8th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnngctgatgtgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D069 || shRNA-9th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnnctagtttagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D070 || shRNA-10th-bs(custom)_BBB || ttttgaattcgcggccgcactagtnnnnnnnnnnnnnngctataatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D071 || shRNA-6th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcgcaacctcactgccgtcaatagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D072 || shRNA-7th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcaacctcactgccgtcaatagagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D073 || shRNA-8th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcaacgacgtatttggctgatgtgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D074 || shRNA-9th-bs(perf)_BBB || ttttgaattcgcggccgcactagtcgcgacatagcgacctagtttagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D075 || shRNA-10th-bs(perf)_BBB || ttttgaattcgcggccgcactagtctgtggtgccggtggctataatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D076 || shRNA-6th-bs(rand9-12)_BBB || gcgatcgccgcaacctcannnncgtcaatagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D077 || shRNA-7th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcaacctcactnnnntcaatagagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D078 || shRNA-8th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcaacgacgtannnngctgatgtgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D079 || shRNA-9th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtcgcgacatagnnnnctagtttagctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D080 || shRNA-10th-bs(rand9-12)_BBB || ttttgaattcgcggccgcactagtctgtggtgccnnnngctataatgctagcgcggccgctgcagtttt <br />
|-<br />
|align="right"| D081 || shRNA-6th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnncgtcaatagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D082 || shRNA-7th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnntcaatagagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D083 || shRNA-8th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnngctgatgtgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D084 || shRNA-9th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnnctagtttagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D085 || shRNA-10th-bs(custom)_SgfI_NotI || gcgatcgcnnnnnnnnnnnnnngctataatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D086 || shRNA-6th-bs(perf)_SgfI_NotI || gcgatcgccgcaacctcactgccgtcaatagcggccgctatgtcacaact<br />
|-<br />
|align="right"| D087 || shRNA-7th-bs(perf)_SgfI_NotI || gcgatcgccaacctcactgccgtcaatagagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D088 || shRNA-8th-bs(perf)_SgfI_NotI || gcgatcgccaacgacgtatttggctgatgtgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D089 || shRNA-9th-bs(perf)_SgfI_NotI || gcgatcgccgcgacatagcgacctagtttagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D090 || shRNA-10th-bs(perf)_SgfI_NotI || gcgatcgcctgtggtgccggtggctataatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D091 || shRNA-6th-bs(rand9-12)_SgfI_NotI || gcgatcgccgcaacctcannnncgtcaatagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D092 || shRNA-7th-bs(rand9-12)_SgfI_NotI || gcgatcgccaacctcactnnnntcaatagagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D093 || shRNA-8th-bs(rand9-12)_SgfI_NotI || gcgatcgccaacgacgtannnngctgatgtgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D094 || shRNA-9th-bs(rand9-12)_SgfI_NotI || gcgatcgccgcgacatagnnnnctagtttagcggccgctatgtcacaact <br />
|-<br />
|align="right"| D095 || shRNA-10th-bs(rand9-12)_SgfI_NotI || gcgatcgcctgtggtgccnnnngctataatgcggccgctatgtcacaact <br />
|-<br />
|align="right"| D096 || shRNA_AflII_BBB_fw || ttttctgcagcggccgcgcgctagccttaagtggaggtgaagttaacaccttcgtg <br />
|-<br />
|align="right"| D097 || shRNA_HindIII_BBB_rev || ttttgaattcgcggccgcactagtaagcttaagcaaacgatgccaagacatttatcg <br />
|-<br />
|align="right"| D098 || SV40_BamHI_BBB_fw || ctgcagcggccgcgctagcggatccaagctttttgcaaaagcctagg <br />
|-<br />
|align="right"| D099 || SV40_BBB_rev || ttttctgcagcggccgcgctagcaagctttttgcaaaagcctaggc <br />
|-<br />
|align="right"| D100 || SV40_rc_BBB_fw || ttttgaattcgcggccgcactagtaagctttttgcaaaagcc <br />
|-<br />
|align="right"| D101 || SV40_rc_BBB_rev || ttttctgcagcggccgcgctagcgcgcagcaccatggcctg <br />
|-<br />
|align="right"| D102 || SV40_term_fw || ttttgaattcgcggccgcactagtcagacatgataagatacattg <br />
|-<br />
|align="right"| D103 || SV40_Xho_Xma_BBB_fw || gaattcgcggccgcactagtctcgagtttctcccggggcgcagcaccatggcctg <br />
|-<br />
|align="right"| D104 || TetRepressor (from pcDNA6)fw || ttttgaattcgcggccgcactagtgccaccatgtctagattagataaaag <br />
|-<br />
|align="right"| D105 || TetRepressor (from pcDNA6)rew || ttttctgcagcggccgcgctagcttaataagatctaaattcccgcgatccgc <br />
|}<br />
<br />
==ViroBytes primers==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified fragment !! direction !! cap gene of AAV<br />
|-<br />
|align="right"| R001 || Anchor12689 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaacTACCG || anchor || - ||<br />
|-<br />
|align="right"| R002 || Anchor4 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaactactg || anchor || - ||<br />
|-<br />
|align="right"| R003 || Anchor5 || tctctctctctctctaagcttgtctgagtgactagcattcgttaattaactacag || anchor || - ||<br />
|-<br />
|align="right"| R004 || Anchor_comp_all || gttaattaacgaatgctagtcactcagacaagctt || anchor || - ||<br />
|-<br />
|align="right"| R005 || F1_for_cap12689 || gctacggtctcaatggctgccgatggttatcttccag || 1 || forward || 1,2,6,8,9<br />
|-<br />
|align="right"| R006 || F1_for_cap5 || gctacggtctcaatggctgccgatggttatcttccag || 1 || forward || 5<br />
|-<br />
|align="right"| R007 || F1_rev_cap2 || gctacggtctcgctcctgaaactcggcgtcggcgtgg || 1 || reverse || 2<br />
|-<br />
|align="right"| R008 || F1_rev_cap5 || gctacggtctctctcctgaaactcggcgtccgcgtgg || 1 || reverse || 5<br />
|-<br />
|align="right"| R009 || F1_rev_cap9 || gctacggtctcgctcctggaactcggcgtcggcgtgg || 1 || reverse || 9<br />
|-<br />
|align="right"| R010 || F1_rev_cap168 || gctacggtctcgctcctgaaactcggcgtcggcgtgg || 1 || reverse || 1,6,8<br />
|-<br />
|align="right"| R011 || F2_for_cap2 || gctacggtctctggagcgccttaaagaagatacgtcttttggggg || 2 || forward || 2<br />
|-<br />
|align="right"| R012 || F2_for_cap5 || gctacggtctctggagaagctcgccgacgacacatccttcggggg || 2 || forward || 5<br />
|-<br />
|align="right"| R013 || F2_for_cap9 || gctacggtctctggagcggctcaaagaagatacgtcttttggggg || 2 || forward || 9<br />
|-<br />
|align="right"| R014 || F2_for_cap168 || gctacggtctctggagcgtctgcaagaagatacgtcttttggggg || 2 || forward || 1,6,8<br />
|-<br />
|align="right"| R015 || F2_rev_cap2 || gctacggtctcgtgtcgcccatccatgtggaatcgcaatgc || 2 || reverse || 2<br />
|-<br />
|align="right"| R016 || F2_rev_cap5 || gctacggtctcgtgtcccccatccacgtggaatcgcaatgc || 2 || reverse || 5<br />
|-<br />
|align="right"| R017 || F2_rev_cap9 || gctacggtctcgtgtcccccagccattgggaatcgcaatgc || 2 || reverse || 9<br />
|-<br />
|align="right"| R018 || F2_rev_cap168 || gctacggtctcgtgtcgcccagccatgtggaatcgcaatgc || 2 || reverse || 1,6,8<br />
|-<br />
|align="right"| R019 || F3_for_cap5 || gctacggtctccgacagagtcatcaccaccagcacccg || 3 || forward || 5<br />
|-<br />
|align="right"| R020 || F3_for_cap9 || gctacggtctccgacagagtcatcaccaccagcacccg || 3 || forward || 9<br />
|-<br />
|align="right"| R021 || F3_for_cap1268 || gctacggtctccgacagagtcatcaccaccagcacccg || 3 || forward || 1,2,6,8<br />
|-<br />
|align="right"| R022 || F3_rev_cap1 || gctacggtctcaggttattagcgatggttgtgacgccatcattcgtc || 3 || reverse || 1<br />
|-<br />
|align="right"| R023 || F3_rev_cap2 || gctacggtctcaggttattggcaatcgtcgtcgtaccgtcattctgc || 3 || reverse || 2<br />
|-<br />
|align="right"| R024 || F3_rev_cap5 || gctacggtctcaggttgttggcgatggtggtggtggagtcctgcac || 3 || reverse || 5<br />
|-<br />
|align="right"| R025 || F3_rev_cap6 || gctacggtctcaggttattagcgatggtcgtgacgccatcattcgtc || 3 || reverse || 6<br />
|-<br />
|align="right"| R026 || F3_rev_cap8 || gctacggtctcaggttattggcgatggtcttggtgccttcattctgc || 3 || reverse || 8<br />
|-<br />
|align="right"| R027 || F3_rev_cap9 || gctacggtctcaggttattggcgatggtcttgactccattgttgtcc || 3 || reverse || 9<br />
|-<br />
|align="right"| R028 || F4_for_cap2 || gctacggtctctaaccttaccagcacggttcaggtgtttactgactc || 4 || forward || 2<br />
|-<br />
|align="right"| R029 || F4_for_cap5 || gctacggtctccaacctcacctccaccgtccaagtgtttacggacga || 4 || forward || 5<br />
|-<br />
|align="right"| R030 || F4_for_cap8 || gctacggtctctaacctcaccagcaccatccaggtgtttacggactc || 4 || forward || 8<br />
|-<br />
|align="right"| R031 || F4_for_cap9 || gctacggtctctaaccttaccagcacggtccaggtcttcacggactc || 4 || forward || 9<br />
|-<br />
|align="right"| R032 || F4_for_cap16 || gctacggtctctaaccttaccagcacggttcaagtcttctcggactc || 4 || forward || 1,6<br />
|-<br />
|align="right"| R033 || F4_reverse_cap1 || gctacggtctcagctgctgtggaaaggcacttcctcaaaggtg || 4 || reverse || 1<br />
|-<br />
|align="right"| R034 || F4_reverse_cap2 || gctacggtctcagctgctgtggaaaggaacgtcctcaaaagtg || 4 || reverse || 2<br />
|-<br />
|align="right"| R035 || F4_reverse_cap5 || gctacggtctcagctggagtggaagggcacctcctcaaagttg || 4 || reverse || 5<br />
|-<br />
|align="right"| R036 || F4_reverse_cap9 || gctacggtctcagctgctatggaaaggtacgttctcaaactcg || 4 || reverse || 9<br />
|-<br />
|align="right"| R037 || F4_reverse_cap68 || gctacggtctcagctgctgtggaaaggcacgtcctcgaaggtg || 4 || reverse || 6,8<br />
|-<br />
|align="right"| R038 || F5_for_cap2 || gctacggtctcgcagctacgctcacagccagagtctggaccgtc || 5 || forward || 2<br />
|-<br />
|align="right"| R039 || F5_for_cap5 || gctacggtctcccagcttcgctcccagtcagaacctgttcaagc || 5 || forward || 5<br />
|-<br />
|align="right"| R040 || F5_for_cap8 || gctacggtctcgcagctacgcccacagccagagcttggaccggc || 5 || forward || 8<br />
|-<br />
|align="right"| R041 || F5_for_cap9 || gctacggtctcgcagctacgctcacagccaaagcctggaccgac || 5 || forward || 9<br />
|-<br />
|align="right"| R042 || F5_for_cap16 || gctacggtctcgcagctacgcgcacagccagagcctggaccggc || 5 || forward || 1,6<br />
|-<br />
|align="right"| R043 || F5_rev_cap2 || gctacggtctccagttcctagactggtcccgaatgtcactcg || 5 || reverse || 2<br />
|-<br />
|align="right"| R044 || F5_rev_cap5 || gctacggtctccagtttttgtaggtgttggcgtatctcccgg || 5 || reverse || 5<br />
|-<br />
|align="right"| R045 || F5_rev_cap8 || gctacggtctccagttctttgcctgattggccattgtattag || 5 || reverse || 8<br />
|-<br />
|align="right"| R046 || F5_rev_cap9 || gctacggtctctagtttcttccctggacagccatgttgctgg || 5 || reverse || 9<br />
|-<br />
|align="right"| R047 || F5_rev_cap16 || gctacggtctccagtttttgggctgaacagacatgccagctg || 5 || reverse || 1,6<br />
|-<br />
|align="right"| R048 || F6_for_cap2 || gctacggtctcgaactggcttcctggaccctgttaccgccagc || 6 || forward || 2<br />
|-<br />
|align="right"| R049 || F6_for_cap5|| gctacggtctcaaactggttcccggggcccatgggccgaaccc || 6 || forward || 5<br />
|-<br />
|align="right"| R050 || F6_for_cap8 || gctacggtctcgaactggctgccaggaccctgttaccgccaac || 6 || forward || 8<br />
|-<br />
|align="right"| R051 || F6_for_cap9 || gctacggtctcaaactacatacctggacccagctaccgacaac || 6 || forward || 9<br />
|-<br />
|align="right"| R052 || F6_for_cap16 || gctacggtctcaaactggctacctggaccctgttatcggcagc || 6 || forward || 1,6<br />
|-<br />
|align="right"| R053 || F6_rev_cap1 || gctacggtctcgccacagggttagtggctttaatttcctcttcgtctg || 6 || reverse || 1<br />
|-<br />
|align="right"| R054 || F6_rev_cap2 || gctacggtctcgccacgggattggttgtcctgatttcctcttcgtctg || 6 || reverse || 2<br />
|-<br />
|align="right"| R055 || F6_rev_cap5 || gctacggtctcgccacgcggttcaccggctgcgtctcgctctcgctgg || 6 || reverse || 5<br />
|-<br />
|align="right"| R056 || F6_rev_cap6 || gctacggtctcgccacggggttagtggctttgatttcctcttcgtctg || 6 || reverse || 6<br />
|-<br />
|align="right"| R057 || F6_rev_cap8 || gctacggtctcgccacagggttagtggttttgatttcttctcgctgg || 6 || reverse || 8<br />
|-<br />
|align="right"| R058 || F6_rev_cap9 || gctacggtctcgccaccgggttagtagttttaatttcttcttcgttggttatc || 6 || reverse || 9<br />
|-<br />
|align="right"| R059 || F7_for_cap1 || gctacggtctctgtggccaccgaaagatttgggaccgtggcagtcaatttc || 7 || forward || 1<br />
|-<br />
|align="right"| R060 || F7_for_cap2 || gctacggtctccgtggctacggagcagtatggttctgtatctaccaacctc || 7 || forward || 2<br />
|-<br />
|align="right"| R061 || F7_for_cap5 || gctacggtctccgtggcgtacaacgtcggcgggcagatg || 7 || forward || 5<br />
|-<br />
|align="right"| R062 || F7_for_cap6 || gctacggtctccgtggccaccgaaagatttgggactgtggcagtcaatctc || 7 || forward || 6<br />
|-<br />
|align="right"| R063 || F7_for_cap8 || gctacggtctctgtggctacagaggaatacggtatcgtggcagataacttg || 7 || forward || 8<br />
|-<br />
|align="right"| R064 || F7_for_cap9 || gctacggtctcggtagcaacggagtcctatggacaagtggccacaaaccac || 7 || forward || 9<br />
|-<br />
|align="right"| R065 || F7_rev_cap1 || gctacggtctcggtgatgaatgaagcaaactttgtagctgaaaac || 7 || reverse || 1<br />
|-<br />
|align="right"| R066 || F7_rev_cap2 || gctacggtctctgtgatgaaggaagcaaactttgccgcactgaag || 7 || reverse || 2<br />
|-<br />
|align="right"| R067 || F7_rev_cap5 || gctacggtctcggtgatgaagctgctgacgggcacgtccgagaag || 7 || reverse || 5<br />
|-<br />
|align="right"| R068 || F7_rev_cap6 || gctacggtctcggtgatgaatgaagcaaactttgtagccgaaaac || 7 || reverse || 6<br />
|-<br />
|align="right"| R069 || F7_rev_cap8 || gctacggtctccgtgatgaaagagttcagctttgactggttgaag || 7 || reverse || 8<br />
|-<br />
|align="right"| R070 || F7_rev_cap9 || gctacggtctcggtgatgaaagagttcagcttgtccttgttgaag || 7 || reverse || 9<br />
|-<br />
|align="right"| R071 || F8_for_cap1 || gctacggtctcatcacccaatactccacaggacaagtgagtgtgg || 8 || forward || 1<br />
|-<br />
|align="right"| R072 || F8_for_cap2 || gctacggtctcatcacacagtactccacgggacaggtcagcgtgg || 8 || forward || 2<br />
|-<br />
|align="right"| R073 || F8_for_cap5 || gctacggtctcatcacccagtacagcaccgggcaggtcaccgtgg || 8 || forward || 5<br />
|-<br />
|align="right"| R074 || F8_for_cap6 || gctacggtctcatcacccagtattccacaggacaagtgagcgtgg || 8 || forward || 6<br />
|-<br />
|align="right"| R075 || F8_for_cap8 || gctacggtctcatcacgcaatacagcaccggacaggtcagcgtgg || 8 || forward || 8<br />
|-<br />
|align="right"| R076 || F8_for_cap9 || gctacggtctcatcacccagtattctactggccaagtcagcgtgg || 8 || forward || 9<br />
|-<br />
|align="right"| R077 || F8_rev_cap1 || gctacggcgcgccttacaggggacgggtaaggtaacgggtgcc || 8 || reverse || 1<br />
|-<br />
|align="right"| R078 || F8_rev_cap2 || gctacggcgcgccttacagattacgagtcaggtatctggtgccaatggg || 8 || reverse || 2<br />
|-<br />
|align="right"| R079 || F8_rev_cap5 || gctacggcgcgccttaaaggggtcgggtaaggtatcgggttccgatagg || 8 || reverse || 5<br />
|-<br />
|align="right"| R080 || F8_rev_cap6 || gctacggcgcgccttacaggggacgggtgaggtaacgggtgcc || 8 || reverse || 6<br />
|-<br />
|align="right"| R081 || F8_rev_cap8 || gctacggcgcgccttacagattacgggtgaggtaacgggtgccaatggg || 8 || reverse || 8<br />
|-<br />
|align="right"| R082 || F8_rev_cap9 || gctacggcgcgccttacagattacgagtcaggtatctggtgccaatggg || 8 || reverse || 9<br />
|-<br />
|align="right"| R083 || Virbyte_for || gtctgagtgactagcattcg || - || forward ||<br />
|-<br />
|align="right"| R084 || Virobyte_rev || gctacggcgcgcctta || - || reverse ||<br />
|}<br />
<br />
==Primer Table Quick 'n' Dirty==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3') !! amplified !! origin !! for backbone<br />
|-<br />
|align="right"| L001 || CMV_AgeI_fw || ttttaccggtagaatctgcttagggttagg || for use with L11 || from pcDNA5+miRNA || to tuning construct-pTR-UF3 KpnI/SalI<br />
|-<br />
|align="right"| L002 || CMVshRNApA_KpnI_rv || taatggtacccagaagccatagagcccacc || - || from pcDNA5+miRNA || to tuning construct-pTR-UF3 KpnI/SalI <br />
|-<br />
|align="right"| L003 || HSVluc_norm_BglII_fw || tttttagatcttgcaggagcttcagggagtg || for use with L8 || from PsiCheck2 || to pTR-UF3 BglII <br />
|-<br />
|align="right"| L004 || HSVluc_norm_BglII_rv || ttttagatctggttccgcgcacatttccc || for use with L7 || from PsiCheck2 || to pTR-UF3 BglII <br />
|-<br />
|align="right"| L005 || HSVluc_norm_KpnI_fw || tttttggtagcaggagcttcagggagtg || for use with L16 || from PsiCheck2 || to pTR-UF3 KpnI/SalI <br />
|-<br />
|align="right"| L006 || HSVluc_norm_SalI_rv || ttttgtcgacggttccgcgcacatttccc || for use with L15 || from PsiCheck2 || to pTR-UF3 KpnI/SalI <br />
|-<br />
|align="right"| L007 || Sv40lucmcs_AgeI_fw || ttttaccggtgtggaatgtgtgtcagttag || for use with L13 || from PsiCheck2 || to tuning construct-pTR-UF3 KpnI/SalI <br />
|-<br />
|align="right"| L008 || SV40luc_SalI_rv || tattgtcgacccgcgtcagacaaaccctaac || for use with L1 || from PsiCheck2 || to tuning construct-pTR-UF3 KpnI/SalI <br />
|-<br />
|align="right"| L009 || TetO2_StuI_NheI || ttttaggccttccctatcagtgatagagatctccctatcagtgatagagagctagctaac || Tet Repressor|| Oligo || to final tuning construct <br />
|-<br />
|align="right"| L010 || TetR_BspEI_fw || tttttccggaggcgaattgatatgtctagattag || for use with L14 || from pcDNA6/TR || pTR-UF3 BspEI/NotI <br />
|-<br />
|align="right"| L011 || TetR_SgfI_NotI_rv || ttttgcggccgctggcgatcgctaataagatctgaattcccgggatc || for use with L12 || from pcDNA6/TR || to pTR-UF3 BspEI/NotI <br />
|}<br />
<br />
<br />
==Primer Table raPCR ==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3') !! target !! Assembly Site !! <br />
|-<br />
|align="right"| ra001 || psicheck2_MCS_min_200_fw || cagcgacgatctgcctaa || sequencing fw || || sequencing Primer for binding-sites in pSiCheck vector<br />
|-<br />
|align="right"| ra002 || psicheck2_MCS_plu_200_rv || gtggccaccaagaccaaa || sequencing rv || || sequencing Primer for binding-sites in pSiCheck vector<br />
|-<br />
|align="right"| ra003 || raPCR_AS13-hsa-mir-122 || cactgaatccaactgcaaacaccattgtcacactccagcatacatggactgc || hsa-mir-122 || 13 bp || <br />
|-<br />
|align="right"| ra004 || raPCR_AS13-has-mir122(ran9-12) || cactgaatccaactgcaaacaccatnnnnacactccagcatacatggactgc || has-mir122 (ran9-12) || 13 bp || randomised nucleotides 9-12<br />
|-<br />
|align="right"| ra005 || raPCR_AS13-hsa-mir-320b || cactgaatccaactgttgccctctcaacccagcttttgcatacatggactgc || hsa-mir-320b || 13 bp || <br />
|-<br />
|align="right"| ra006 || raPCR_AS13-has-mir-221 || cactgaatccaactggaaacccagcagacaatgtagctgcatacatggactgc || has-mir-221 || 13 bp || <br />
|-<br />
|align="right"| ra007 || raPCR_AS13-has-mir-221(ran9-12 || cactgaatccaactggaaacccagcannnnatgtagctgcatacatggactgc || has-mir-221 (ran9-12) || 13 bp || randomised nucleotides 9-12<br />
|-<br />
|align="right"| ra008 || raPCR_AS13-has-mir-1179 || cactgaatccaactgccaaccaatgaaagaatgcttgcatacatggactgc || has-mir-1179 || 13 bp || <br />
|-<br />
|align="right"| ra009 || raPCR_AS13-has-mir-1179ran9-12 || cactgaatccaactgccaaccaatnnnngaatgcttgcatacatggactgc || has-mir-1179 (ran9-12) || 13 bp || randomised nucleotides 9-12<br />
|-<br />
|align="right"| ra010 || raPCR_AS13-has-mir4286 || cactgaatccaactgggtaccaggagtggggtgcatacatggactgc || has-mir4286 || 13 bp || <br />
|-<br />
|align="right"| ra011 || raPCR_AS13-mm-mir-375 || cactgaatccaactgtcacgcgagccgaacgaacaaagcatacatggactgc || mm-mir-375 || 13 bp || <br />
|-<br />
|align="right"| ra012 || raPCR_AS13-mm-mir-375(ran9-12) || cactgaatccaactgtcacgcgagcnnnncgaacaaagcatacatggactgc || mm-mir-375 (ran9-12) || 13 bp || randomised nucleotides 9-12<br />
|-<br />
|align="right"| ra013 || raPCR_AS13-mm-mir-376a || cactgaatccaactgacgtggattttcctctacgatgcatacatggactgc || mm-mir-376a || 13 bp || <br />
|-<br />
|align="right"| ra014 || raPCR_AS13-spacer(0) || cagttggattcagtggcagtccatgtatgc || spacer || 13 bp || <br />
|-<br />
|align="right"| ra015 || raPCR_AS13-spacer(10) || cagttggattcagtggctatttctcgcagtccatgtatgc || spacer || 13 bp || <br />
|-<br />
|align="right"| ra016 || raPCR_AS13-spacer(20) || cagttggattcagtgatgacaggtagctatttctcgcagtccatgtatgc || spacer || 13 bp || <br />
|-<br />
|align="right"| ra017 || raPCR_AS13-stop_fw_BBB || ttttgaattcgcggccgcactagtcactgaatccaactg || stop fw || 13 bp || <br />
|-<br />
|align="right"| ra018 || raPCR_AS13-stop_rev_BBB || ttttctgcagcggccgcgctagcgcagtccatgtatgc || stop rev || 13 bp || <br />
|-<br />
|align="right"| ra019 || raPCR_AS13-stop_rev_NotI || ttttgcggccgctggagtgtgacaatggtgtttg || stop rev || 13 bp || <br />
|-<br />
|align="right"| ra020 || raPCR_AS13-stop_fw_XhoI || ttttctcgagcactgaatccaactg || stop fw || 13 bp || <br />
|}<br />
<br />
<br />
==mouse oligos==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3')<br />
|-<br />
|align="right"| mouse1 || CMV_TetR_122bs_SalI_fw ||ttttgtcgaccgttgacattgattattgac <br />
|- <br />
|align="right"| mouae2 || CMV_TetR_both_MluI_rev || ttttacgcgttaacacacaaaaaaccaacac <br />
|-<br />
|align="right"| mouse3 || CMV_TetR_control_SalI_fw || ttttgtcgaccgttgacattgattattgac <br />
|-<br />
|align="right"| mouse4 || CMV_TetO2_EcoRI_fw || ttttgaattcgttgacattgattattgtctag <br />
|-<br />
|align="right"| mouse5 || Luc2_Ter_PstI_rev || ttttctgcagtaccacatttgtagaggttttac <br />
|-<br />
|align="right"| mouse6XXX || haat_bs_p_fw || tcgaggaagcgtttaggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse7 || haat_bs_p_rev || ggccgctctagagatgttaaacatgcctaaacgcttcc <br />
|-<br />
|align="right"| mouse8 || haat_bs_r10_12_aat_fw || tcgaggaagcgtaatggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse9 || haat_bs_r10_12_aat_rev || ggccgctctagagatgttaaacatgccattacgcttcc <br />
|-<br />
|align="right"| mouse10 || haat_bs_r10_12_agc_fw || tcgaggaagcgtagcggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse11 || haat_bs_r10_12_agc_rev || ggccgctctagagatgttaaacatgccgctacgcttcc <br />
|-<br />
|align="right"| mouse12 || haat_bs_m10at_fw || tcgaggaagcgttttggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse13 || haat_bs_m10at_rev || ggccgctctagagatgttaaacatgccaaaacgcttcc <br />
|-<br />
|align="right"| mouse14 || haat_bs_m10ac_fw || tcgaggaagcgtttcggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse15 || haat_bs_m10ac_rev || ggccgctctagagatgttaaacatgccgaaacgcttcc <br />
|-<br />
|align="right"| mouse16 || haat_bs_m11ta_fw || tcgaggaagcgttaaggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse17 || haat_bs_m11ta_rev || ggccgctctagagatgttaaacatgccttaacgcttcc <br />
|-<br />
|align="right"| mouse18 || haat_bs_m11tg_fw || tcgaggaagcgttgaggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse19 || haat_bs_m11tg_rev || ggccgctctagagatgttaaacatgcctcaacgcttcc <br />
|-<br />
|align="right"| mouse20 || haat_bs_r9_12_aatc_fw || tcgaggaagcgtaatcgcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse21 || haat_bs_r9_12_aatc_rev || ggccgctctagagatgttaaacatgcgattacgcttcc <br />
|-<br />
|align="right"| mouse22 || haat_bs_r9_12_agcc_fw || tcgaggaagcgtagccgcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse23 || haat_bs_r9_12_agcc_rev || ggccgctctagagatgttaaacatgcggctacgcttcc <br />
|-<br />
|align="right"| mouse24 || haat_bs_onlyseed_fw || tcgagcttcgcaaatcgcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse25 || haat_bs_onlyseed_rev || ggccgctctagagatgttaaacatgcgatttgcgaagc <br />
|-<br />
|align="right"| mouse26 || haat_bs_r16-18_fw || tcgaggttccgtttaggcatgtttaacatctctagagc <br />
|-<br />
|align="right"| mouse27 || haat_bs_r16-18_rev || ggccgctctagagatgttaaacatgcctaaacggaacc <br />
|-<br />
|align="right"| mouse28XXX || sAg_bs_p_fw || tcgagctcagtttactagtgccatttgttctctagagc <br />
|-<br />
|align="right"| mouse29 || sAg_bs_p_rev || ggccgctctagagaacaaatggcactagtaaactgagc <br />
|-<br />
|align="right"| mouse30 || sAg_bs_r10_12_acg_fw || tcgagctcagtttactagacgcatttgttctctagagc <br />
|-<br />
|align="right"| mouse31 || sAg_bs_r10_12_acg_rev || ggccgctctagagaacaaatgcgtctagtaaactgagc <br />
|-<br />
|align="right"| mouse32 || sAg_bs_r10_12_taa_fw || tcgagctcagtttactagtaacatttgttctctagagc <br />
|-<br />
|align="right"| mouse33 || sAg_bs_r10_12_taa_rev || ggccgctctagagaacaaatgttactagtaaactgagc <br />
|-<br />
|align="right"| mouse34 || sAg_bs_r9_12_acgg_fw || tcgagctcagtttactagacggatttgttctctagagc <br />
|-<br />
|align="right"| mouse35 || sAg_bs_r9_12_acgg_rev || ggccgctctagagaacaaatccgtctagtaaactgagc <br />
|-<br />
|align="right"| mouse36 || sAg_bs_r9_12_atgt_fw || tcgagctcagtttactagatgtatttgttctctagagc <br />
|-<br />
|align="right"| mouse37 || sAg_bs_r9_12_atgt_rev || ggccgctctagagaacaaatacatctagtaaactgagc <br />
|-<br />
|align="right"| mouse38 || sAg_bs_m10cg_fw || tcgagctcagtttactagtggcatttgttctctagagc <br />
|-<br />
|align="right"| mouse39 || sAg_bs_m10cg_rev || ggccgctctagagaacaaatgccactagtaaactgagc <br />
|-<br />
|align="right"| mouse40 || sAg_bs_m10ca_fw || tcgagctcagtttactagtgacatttgttctctagagc <br />
|-<br />
|align="right"| mouse41 || sAg_bs_m10ca_rev || ggccgctctagagaacaaatgtcactagtaaactgagc <br />
|-<br />
|align="right"| mouse42 || sAg_bs_m11gc_fw || tcgagctcagtttactagtcccatttgttctctagagc <br />
|-<br />
|align="right"| mouse43 || sAg_bs_m11gc_rev || ggccgctctagagaacaaatgggactagtaaactgagc <br />
|-<br />
|align="right"| mouse44 || sAg_bs_m11ga_fw || tcgagctcagtttactagtaccatttgttctctagagc <br />
|-<br />
|align="right"| mouse45 || sAg_bs_m11ga_rev || ggccgctctagagaacaaatggtactagtaaactgagc <br />
|-<br />
|align="right"| mouse46 || sAg_bs_onlyseed_fw || tcgagctcagtaatgatcacggatttgttctctagagc <br />
|-<br />
|align="right"| mouse47 || sAg_bs_onlyseed_rev || ggccgctctagagaacaaatccgtgatcattactgagc <br />
|-<br />
|align="right"| mouse48 || sAg_bs_r16-18_fw || tcgagctcagttatgtagtgccatttgttctctagagc <br />
|-<br />
|align="right"| mouse49 || sAg_bs_r16-18_rev || ggccgctctagagaacaaatggcactacataactgagc <br />
|-<br />
|align="right"| mouse50XXX || hAAT_cDNA_SalI_Bluescript_fw || ttttgtcgacgaccatgattacgccaagcg <br />
|-<br />
|align="right"| mouse51 || hAAT_cDNA_SalI_fw || ttttgtcgacgggtaccgggccccccgtcgaggatg <br />
|-<br />
|align="right"| mouse52 || hAAT_cDNA_XhoI_NotI_NheI_rev || ttttgctagcgcggccgcgtatctcgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse53 || hAAT_cDNA_sAg_bs_p_NheI_rev || ttttgctagcgaacaaatggcactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse54 || hAAT_cDNA_sAg_bs_r10_12_acg_NheI_rev || ttttgctagcgaacaaatgcgtctagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse55 || hAAT_cDNA_sAg_bs_r10_12_taa_NheI_rev || ttttgctagcgaacaaatgttactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse56 || hAAT_cDNA_bs_r9_12_acgg_NheI_rev || ttttgctagcgaacaaatccgtctagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse57 || hAAT_cDNA_sAg_bs_r9_12_atgt_NheI_rev || ttttgctagcgaacaaatacatctagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse58 || hAAT_cDNA_sAg_bs_m10cg_NheI_rev || ttttgctagcgaacaaatgccactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse59 || hAAT_cDNA_sAg_bs_m10ca_NheI_rev || ttttgctagcgaacaaatgtcactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse60 || hAAT_cDNA_sAg_bs_m11gc_NheI_rev || ttttgctagcgaacaaatgggactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse61 || hAAT_cDNA_sAg_bs_m11ga_NheI_rev || ttttgctagcgaacaaatggtactagtaaactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse62 || hAAT_cDNA_sAg_bs_onlyseed_NheI_rev || ttttgctagcgaacaaatccgtgatcattactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse63 || hAAT_cDNA_sAg_bs_r16-18_NheI_rev || ttttgctagcgaacaaatggcactacataactgaggctcaacccttctttaatg <br />
|-<br />
|align="right"| mouse64XXX || sAg_bs_p_fw_E || aattcctcagtttactagtgccatttgttcctgca <br />
|-<br />
|align="right"| mouse65 || sAg_bs_p_rev_P || ggaacaaatggcactagtaaactgagg <br />
|-<br />
|align="right"| mouse66 || sAg_bs_r10_12_acg_fw_E || aattcctcagtttactagacgcatttgttcctgca <br />
|-<br />
|align="right"| mouse67 || sAg_bs_r10_12_acg_rev_P || ggaacaaatgcgtctagtaaactgagg <br />
|-<br />
|align="right"| mouse68 || sAg_bs_r10_12_taa_fw_E || aattcctcagtttactagtaacatttgttcctgca <br />
|-<br />
|align="right"| mouse69 || sAg_bs_r10_12_taa_rev_P || ggaacaaatgttactagtaaactgagg <br />
|-<br />
|align="right"| mouse70 || sAg_bs_r9_12_acgg_fw_E || aattcctcagtttactagacggatttgttcctgca <br />
|-<br />
|align="right"| mouse71 || sAg_bs_r9_12_acgg_rev_P || ggaacaaatccgtctagtaaactgagg <br />
|-<br />
|align="right"| mouse72 || sAg_bs_r9_12_atgt_fw_E || aattcctcagtttactagatgtatttgttcctgca <br />
|-<br />
|align="right"| mouse73 || sAg_bs_r9_12_atgt_rev_P || ggaacaaatacatctagtaaactgagg <br />
|-<br />
|align="right"| mouse74 || sAg_bs_m10cg_fw_E || aattcctcagtttactagtggcatttgttcctgca <br />
|-<br />
|align="right"| mouse75 || sAg_bs_m10cg_rev_P || ggaacaaatgccactagtaaactgagg <br />
|-<br />
|align="right"| mouse76 || sAg_bs_m10ca_fw_E || aattcctcagtttactagtgacatttgttcctgca <br />
|-<br />
|align="right"| mouse77 || sAg_bs_m10ca_rev_P || ggaacaaatgtcactagtaaactgagg <br />
|-<br />
|align="right"| mouse78 || sAg_bs_m11gc_fw_E || aattcctcagtttactagtcccatttgttcctgca <br />
|-<br />
|align="right"| mouse79 || sAg_bs_m11gc_rev_P || ggaacaaatgggactagtaaactgagg <br />
|-<br />
|align="right"| mouse80 || sAg_bs_m11ga_fw_E || aattcctcagtttactagtaccatttgttcctgca <br />
|-<br />
|align="right"| mouse81 || sAg_bs_m11ga_rev_P || ggaacaaatggtactagtaaactgagg <br />
|-<br />
|align="right"| mouse82 || sAg_bs_onlyseed_fw_E || aattcctcagtaatgatcacggatttgttcctgca <br />
|-<br />
|align="right"| mouse83 || sAg_bs_onlyseed_rev_P || ggaacaaatccgtgatcattactgagg <br />
|-<br />
|align="right"| mouse84 || sAg_bs_r16-18_fw_E || aattcctcagttatgtagtgccatttgttcctgca <br />
|-<br />
|align="right"| mouse85 || sAg_bs_r16-18_rev_P || ggaacaaatggcactacataactgagg <br />
|}<br />
<br />
==Modeling Training and Validation Binding Site Set-miRsAg==<br />
<br />
{| border="1" class="wikitable zebra sortable" cellpadding="6" style="border:solid 1px #AAAAAA; border-collapse:collapse; background-color:#F9F9F9; font-size:95%; empty-cells:show;"<br />
!align="right"| ID !! Name !! Sequence (5' to 3')<br />
|-<br />
|align="right"| miRsAg001 || fw_model_sAg_Bs_1 || ccgggataatttgttcatttgttctctagagc<br />
|-<br />
|align="right"| miRsAg002 || fw_model_sAg_Bs_2 || ccgggataatttgttcatttgttcatttgttctctagagc<br />
|-<br />
|align="right"| miRsAg003 || fw_model_sAg_Bs_3 || ccgggagtttactagtgccatttgttcaaatatagcctctagagc<br />
|-<br />
|align="right"| miRsAg004 || fw_model_sAg_Bs_4 || ccgggagtttactagtgcaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg005 || fw_model_sAg_Bs_5 || ccgggagtttactagtgaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg006 || fw_model_sAg_Bs_6 || ccgggagtttactagtaaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg007 || fw_model_sAg_Bs_7 || ccgggagtttactagaaaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg008 || fw_model_sAg_Bs_8 || ccgggctgggcaattataaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg009 || fw_model_sAg_Bs_9 || ccgggctgggcagccgcaaatttgttaaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg010 || fw_model_sAg_Bs_10 || ccgggctgggcagctataattttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg011 || fw_model_sAg_Bs_11 || ccgggagtttacgccgtaaatttgttgaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg012 || fw_model_sAg_Bs_12 || ccgggctgggcaattataaatttgttgaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg013 || fw_model_sAg_Bs_13 || ccgggtccttactagtgcaatttgttaaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg014 || fw_model_sAg_Bs_14 || ccgggctgaatatagtgaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg015 || fw_model_sAg_Bs_15 || ccgggagtttactacctaattttgttaaaatccggcctctagagc<br />
|-<br />
|align="right"| miRsAg016 || fw_model_sAg_Bs_16 || ccgggctgggcctagtggattttgttaaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg017 || fw_model_sAg_Bs_17 || ccgggagtttacattgcaaatttgttgaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg018 || fw_model_sAg_Bs_18 || ccgggctgggactagtgcaatttgttgaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg019 || fw_model_sAg_Bs_20 || ccgggagtttactagaaaattttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg020 || fw_model_sAg_Bs_21 || ccgggagtttactagaaaaatttgttgaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg021 || fw_model_sAg_Bs_22 || ccgggagtttactccgcaaccgctaggaaagcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg022 || fw_model_sAg_Bs_23 || ccgggctgggcatagataattttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg023 || fw_model_sAg_Bs_24 || ccgggctggtactagctaattttgttaaaatccggcctctagagc<br />
|-<br />
|align="right"| miRsAg024 || fw_model_sAg_Bs_25 || ccgggagtttactagccgattttgttaaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg025 || fw_model_sAg_Bs_26 || ccgggctgggcctagaaaaatttgttgaaatccggcctctagagc<br />
|-<br />
|align="right"| miRsAg026 || fw_model_sAg_Bs_27 || ccgggcttttactagaaaaatttgttgaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg027 || fw_model_sAg_Bs_28 || ccgggctggtactaggcaaatttgttgaaggcccgcctctagagc<br />
|-<br />
|align="right"| miRsAg028 || fw_model_sAg_Bs_29 || ccggggctttactagaaaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg029 || fw_model_sAg_Bs_30 || ccgggagtttactttaaaaatttgttaaaatttagcctctagagc<br />
|-<br />
|align="right"| miRsAg030 || rev_model_sAg_Bs_1 || tcgagctctagagaacaaatgaacaaattatc<br />
|-<br />
|align="right"| miRsAg031 || rev_model_sAg_Bs_2 || tcgagctctagagaacaaatgaacaaatgaacaaattatc<br />
|-<br />
|align="right"| miRsAg032 || rev_model_sAg_Bs_3 || tcgagctctagaggctatatttgaacaaatggcactagtaaactc<br />
|-<br />
|align="right"| miRsAg033 || rev_model_sAg_Bs_4 || tcgagctctagaggctaaattttaacaaattgcactagtaaactc<br />
|-<br />
|align="right"| miRsAg034 || rev_model_sAg_Bs_5 || tcgagctctagaggctaaattttaacaaatttcactagtaaactc<br />
|-<br />
|align="right"| miRsAg035 || rev_model_sAg_Bs_6 || tcgagctctagaggctaaattttaacaaattttactagtaaactc<br />
|-<br />
|align="right"| miRsAg036 || rev_model_sAg_Bs_7 || tcgagctctagaggctaaattttaacaaatttttctagtaaactc<br />
|-<br />
|align="right"| miRsAg037 || rev_model_sAg_Bs_8 || tcgagctctagaggctaaattttaacaaatttataattgcccagc<br />
|-<br />
|align="right"| miRsAg038 || rev_model_sAg_Bs_9 || tcgagctctagaggcgggcctttaacaaatttgcggctgcccagc<br />
|-<br />
|align="right"| miRsAg039 || rev_model_sAg_Bs_10 || tcgagctctagaggctaaattttaacaaaattatagctgcccagc<br />
|-<br />
|align="right"| miRsAg040 || rev_model_sAg_Bs_11 || tcgagctctagaggcgggccttcaacaaatttacggcgtaaactc<br />
|-<br />
|align="right"| miRsAg041 || rev_model_sAg_Bs_12 || tcgagctctagaggctaaatttcaacaaatttataattgcccagc<br />
|-<br />
|align="right"| miRsAg042 || rev_model_sAg_Bs_13 || tcgagctctagaggcgggcctttaacaaattgcactagtaaggac<br />
|-<br />
|align="right"| miRsAg043 || rev_model_sAg_Bs_14 || tcgagctctagaggctaaattttaacaaatttcactatattcagc<br />
|-<br />
|align="right"| miRsAg044 || rev_model_sAg_Bs_15 || tcgagctctagaggccggattttaacaaaattaggtagtaaactc<br />
|-<br />
|align="right"| miRsAg045 || rev_model_sAg_Bs_16 || tcgagctctagaggcgggcctttaacaaaatccactaggcccagc<br />
|-<br />
|align="right"| miRsAg046 || rev_model_sAg_Bs_17 || tcgagctctagaggcgggccttcaacaaatttgcaatgtaaactc<br />
|-<br />
|align="right"| miRsAg047 || rev_model_sAg_Bs_18 || tcgagctctagaggcgggccttcaacaaattgcactagtcccagc<br />
|-<br />
|align="right"| miRsAg048 || rev_model_sAg_Bs_20 || tcgagctctagaggctaaattttaacaaaattttctagtaaactc<br />
|-<br />
|align="right"| miRsAg049 || rev_model_sAg_Bs_21 || tcgagctctagaggctaaatttcaacaaatttttctagtaaactc<br />
|-<br />
|align="right"| miRsAg050 || rev_model_sAg_Bs_22 || tcgagctctagaggcgggctttcctagcggttgcggagtaaactc<br />
|-<br />
|align="right"| miRsAg051 || rev_model_sAg_Bs_23 || tcgagctctagaggctaaattttaacaaaattatctatgcccagc<br />
|-<br />
|align="right"| miRsAg052 || rev_model_sAg_Bs_24 || tcgagctctagaggccggattttaacaaaattagctagtaccagc<br />
|-<br />
|align="right"| miRsAg053 || rev_model_sAg_Bs_25 || tcgagctctagaggcgggcctttaacaaaatcggctagtaaactc<br />
|-<br />
|align="right"| miRsAg054 || rev_model_sAg_Bs_26 || tcgagctctagaggccggatttcaacaaatttttctaggcccagc<br />
|-<br />
|align="right"| miRsAg055 || rev_model_sAg_Bs_27 || tcgagctctagaggctaaattcaacaaatttttctagtaaaagc<br />
|-<br />
|align="right"| miRsAg056 || rev_model_sAg_Bs_28 || tcgagctctagaggcgggccttcaacaaatttgcctagtaccagc<br />
|-<br />
|align="right"| miRsAg057 || rev_model_sAg_Bs_29 || tcgagctctagaggctaaattttaacaaatttttctagtaaagcc<br />
|-<br />
|align="right"| miRsAg058 || rev_model_sAg_Bs_30 || tcgagctctagaggctaaattttaacaaatttttaaagtaaactc<br />
|-<br />
|align="right"| miRsAg059 || Luc2_BS_seq_screen || acgacgatgccggcgagctg<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-27T23:20:41Z<p>Rudolf: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure used for "rational shuffling" of capsid genes from natural isolates of Adeno-Associated Virus (AAV). Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) observed in standard shuffling techniques ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). The principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
Five AAV serotypes (1,2,5,6,8 and 9) were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These primers contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
==Important facts==<br />
<br />
Biobrick standards...<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence overhang: 5'-NNNN<br />
<br />
Homology region used:<br />
<br />
between Anchor and Fragment1: <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+5nt(cap specific)<br />
<br />
- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition sequence<br />
<br />
- '''bold''' is amplification sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition sequence<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytesTeam:Heidelberg/Project/Capsid Shuffling/ViroBytes2010-10-27T23:18:18Z<p>Rudolf: /* Introduction */</p>
<hr />
<div>{{:Team:Heidelberg/Double}}<br />
{{:Team:Heidelberg/Pagetop|pro_virobytes}}<br />
<br />
=ViroBytes=<br />
<br />
<br />
==Introduction==<br />
<br />
ViroBytes is a modified [https://2009.igem.org/Team:Alberta BioBytes] procedure used for "rational shuffling" of capsid genes from several Adeno-Associated Virus serotypes. Main motivation for the new protocol is unsatisfactory incorporation of certain serotypes (and especially certain parts of AAV capsid regions eg. from AAV5) observed in standard shuffling techniques ([https://2010.igem.org/Team:Heidelberg/Project/References#Capsid_Shuffling Grimm et al., 2008]). The principle of BioByte formation and annealing persists. Sticky overhangs are used for selective combination of the bytes but different method is used for the production of individual ViroBytes.<br />
<br />
Five AAV serotypes (1,2,5,6,8 and 9) were selected as suitable candidates for fragmentation due to their exceptional individual properties. The analysis of Cap gene sequences revealed multiple homology regions which were then used for rational fragment formation. Total number of fragments per Cap gene is eight in our case and all fragments have similar length around ~250bp to assure similar behaviour in the ligation reaction. The Bytes are created and amplified by High-Fidelity PCR using Cap- and FragmentX-specific primers. These primers contain flanking regions with recognition sequence for type II restriction enzyme Bsa1. Precise positioning in front of and behind the homology regions at the ends of each fragmetn ensures that the enzyme forms unique sticky ends with 4nt overhangs. This procedure allows the user to avoid arduous design of overhangs with incorporated uracils further used for USER<sup>TM</sup> digestion. Also for the purposes of shuffling, the homology regions need to be exploited in order to avoid frame shifts which cannot be easily accomplished using standard BioByte protocol.<br />
<br />
==Important facts==<br />
<br />
Biobrick standards...<br />
<br />
BsaI recognition and cutting sequence:<br />
<br />
5'...GGTCTCN/NNNN...3'<br />
3'...CCAGAGNNNNN/...5'<br />
<br />
hence overhang: 5'-NNNN<br />
<br />
Homology region used:<br />
<br />
between Anchor and Fragment1: <br />
<br />
5'...ATGG...3'<br />
3'...TACC...5'<br />
<br />
between Fragment1 and Fragment2 (bp 279-303 relative to AAV1 Cap):<br />
<br />
5'...GGAG...3'<br />
3'...CCTC...5'<br />
<br />
between Fragment2 and Fragment3 (bp 688-716):<br />
<br />
5'...GACA...3'<br />
3'...CTGT...5'<br />
<br />
between Fragment3 and Fragment4 (bp 1013-1016):<br />
<br />
5'...AACC...3'<br />
3'...TTGG...5'<br />
<br />
between Fragment4 and Fragment5 (bp 1282-1285):<br />
<br />
5'...CAGC...3'<br />
3'...GTCG...5'<br />
<br />
between Fragment5 and Fragment6 (bp 1444-1447):<br />
<br />
5'...AACT...3'<br />
3'...TTGA...5'<br />
<br />
between Fragment6 and Fragment7 (bp 1740-1743):<br />
<br />
5'...GTGG...3'<br />
3'...CACC...5'<br />
<br />
between Fragment7 and Fragment8 (bp 2040-2043):<br />
<br />
5'...TCAC...3'<br />
3'...AGTG...5'<br />
<br />
==ViroByte design==<br />
<br />
*Anchor:<br />
<br />
5'-Biotin-tctctctctctctct''aagctt'' '''gtctgagtgactagcattcg''' '''''ttaattaa'''''c+5nt(cap specific)<br />
<br />
- first 15nt are to form ssDNA linker (improves efficiency of Anchor binding onto Steptavidin-coated magnetic beads)<br />
<br />
- ''italicized'' is HindIII recognition sequence<br />
<br />
- '''bold''' is amplification sequence<br />
<br />
- '''''bold italicized''''' is PacI recognition sequence<br />
<br />
*Anchor complement:<br />
<br />
5'-g'''''ttaattaa''''' '''cgaatgctagtcactcagac''' ''aagctt''<br />
<br />
- reverse complimentary strand to Anchors<br />
<br />
<br />
*Fragment X forward primers:<br />
<br />
5'-gctac'''ggtctc'''aNNNN+~20-25nt Cap specific<br />
<br />
- '''bold''' is BsaI recognition sequence<br />
<br />
- NNNN = cap specific homology sequence from all cap genes (also cutting sequence of BsaI)<br />
<br />
<br />
*Fragment X reverse primers:<br />
<br />
5'-gctac'''ggtctc'''gNNNN<br />
<br />
<br />
<br />
==Protocols==<br />
<br />
<br />
Anchor preparation<br />
<br />
==References==<br />
<br />
Grimm D, Lee JS, Wang L, Desai T, Akache B, Storm TA, Kay MA. In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses. J Virol 2008;82:5887–5911.<br />
<br />
{{:Team:Heidelberg/Pagemiddle}}<br />
__TOC__<br />
{{:Team:Heidelberg/Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2010-10-27T22:42:45Z<p>Rudolf: /* ViroBytes */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts}}<br />
<br />
<html><br />
<script type="text/javascript"><br />
function start() {<br />
<br />
var d = document.getElementById("groupparts")<br />
<br />
d.style.width = "620px"<br />
<br />
switch (d.getElementsByTagName("thead")[0]) {<br />
<br />
case undefined:<br />
setTimeout("start()",200);<br />
break;<br />
<br />
default:<br />
formatparts();<br />
break;<br />
}<br />
}<br />
<br />
function formatparts() {<br />
<br />
var d = document.getElementById("groupparts");<br />
var dbodytr = d.getElementsByTagName("tbody")[0].getElementsByTagName("tr");<br />
var lasttd = dbodytr[0].getElementsByTagName("td").length;<br />
var designertd = lasttd - 2;<br />
var rowscount = dbodytr.length<br />
<br />
d.getElementsByTagName("thead")[0].getElementsByTagName("th")[6].style.display = "none"<br />
<br />
for (var i=0;i<rowscount;i++) {<br />
dbodytr[i].getElementsByTagName("td")[designertd].style.display ="none"<br />
}<br />
<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Heidelberg/tables|normal=FFF|highlight=ddd}}<br />
<html><br />
<body onload="start()"><br />
</html><br />
__NOTOC__<br />
=miBricks - Parts submitted to the registry=<br />
<br><br />
<br />
The parts we submit belong to the two core aims our project: Reaching regulatory control (1) and specificity (2) of gene expression of any gene of interest in any target cell or tissue of choice. Therefore we engineered parts, that address these two aims on two different regulatory levels. <br />
<br />
First, we engineered gene therapy vectors based on synthetic adeno associated viruses (AAVs). On parts level, we provide about 50 plasmids that can be used for creating shuffled AAV libraries or even rationally designed, recombinant AAV vectors. Those parts we refer to as virobytes, are designed in a format directly applicable for the [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes Virobytes Assembly] protocol we develop.<br />
<br />
On RNA level we provide the [https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit miTuner toolkit] consisting of roughly 60 parts enabling gene expression control based on synthetic or cell-specific endogenous microRNAs. This toolkit consists of three main constructs: The '''pSMB_miMeasure''' binding site characterization standard and '''two pSMB_miTuner''' expression controlling plasmids. Furthermore, it contains 12 basic and 28 intermediate construction parts, synthetic, single microRNA binding sites as well as binding site patterns in BB-2 (RFC 12, Tom Knight) standard. This enables maximum flexibility for applications in many different contexts.<br />
<br />
<br />
==Main Measurement Constructs - Engineered==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K3||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337036 BBa_K337036]|| pSMB_miTuner Plasmid HD3 <br />
|-<br />
|K4||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337038 BBa_K337038]|| pSMB_miTuner Plasmid HD4<br />
|-<br />
|miM||sv40ter(rc)/eBFP(rc)/biCMV/eGFP(fw)/sv40ter(fw)||[http://partsregistry.org/Part:BBa_K337049 BBa_K337049]|| pSMB_miMeasure<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==Synthetic Single Binding Sites==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|(Physical DNA not submitted)<br />
|width=60px| Design||width=300px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|KD:97%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052]||shRNA miRhaat<br />
|-<br />
|KD:69%||imperfect binding site: point mut 11||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053]||shRNA miRhaat <br />
|-<br />
|KD:28%||imperfect binding site: bulge 16-18||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]||shRNA miRhaat <br />
|-<br />
|KD:96%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]||miR122 <br />
|-<br />
|KD:64%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056]||miR122 <br />
|-<br />
|KD:24%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057]||miR122 <br />
|-<br />
|}<br />
</center><br />
<br />
==synthetic microRNA binding Site patterns against endogenous miRNA==<br />
<center><br />
<br />
<br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=350px|Content||width=100px|Registry link<br />
|-<br />
|1.3||hsa-miR-122 Binding site pattern (3BS)||[http://partsregistry.org/Part:BBa_K337000 BBa_K337000]<br />
|-<br />
|1A||hsa-miR-122 Binding site pattern (4BS)||[http://partsregistry.org/Part:BBa_K337003 BBa_K337003]<br />
|-<br />
|1-5||hsa-miR-122 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337004 BBa_K337004]<br />
|-<br />
|3.7||hsa-miR-122 Binding site pattern (2BS - additional 10bp Spacer)||[http://partsregistry.org/Part:BBa_K337005 BBa_K337005]<br />
|-<br />
|1.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337006 BBa_K337006]<br />
|-<br />
|1.8||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337007 BBa_K337007]<br />
|-<br />
|3.1||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337008 BBa_K337008]<br />
|-<br />
|4.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337009 BBa_K337009]<br />
|-<br />
|4.6||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337010 BBa_K337010]<br />
|-<br />
|mir221-10L2||hsa-miR-221 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337011 BBa_K337011]<br />
|-<br />
|}<br />
</center><br />
<br />
==miTunig Kit - Basic Parts==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=100px|Content||width=100px|Registry link|| width=300px|Comment<br />
|-<br />
|F1||RSV fw||[http://partsregistry.org/Part:BBa_K337012 BBa_K337012]||-<br />
|-<br />
|F2||SV40 rc||[http://partsregistry.org/Part:BBa_K337013 BBa_K337013]||-<br />
|-<br />
|F3||RSV rc||[http://partsregistry.org/Part:BBa_K337014 BBa_K337014]||-<br />
|-<br />
|F4||BGH fw||[http://partsregistry.org/Part:BBa_K337001 BBa_K337001]||-<br />
|-<br />
|F5||BGH rc||[http://partsregistry.org/Part:BBa_K337002 BBa_K337002]|| leads to insertion of BamHI site<br />
|-<br />
|F7||microRNA 10HD||[http://partsregistry.org/Part:BBa_K337016 BBa_K337016]|| template for creation of shRNA-like miRNA<br />
|-<br />
|F8||CMV fw||[http://partsregistry.org/Part:BBa_K337018 BBa_K337018]||-<br />
|-<br />
|F9||FRT site||[http://partsregistry.org/Part:BBa_K337019 BBa_K337019]||-<br />
|-<br />
|F10||hRluc||[http://partsregistry.org/Part:BBa_K337025 BBa_K337025]||-<br />
|-<br />
|F16||TetR||[http://partsregistry.org/Part:BBa_K337028 BBa_K337028]||-<br />
|-<br />
|F17||Luc2||[http://partsregistry.org/Part:BBa_K337030 BBa_K337030]|| compatible for insertion of microRNA binding sites<br />
|-<br />
|biCMV||biCMV||[http://partsregistry.org/Part:BBa_K337017 BBa_K337017]||-<br />
|-<br />
|}<br />
</center><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==miTuning Kit - Intermediate Parts 1==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=300px|Content||width=100px|Registry link||width=450px|Purpose of the cassette <br />
|-<br />
|F6||luc2_sv40ter||[http://partsregistry.org/Part:BBa_K337015 BBa_K337015]|| Luc2 reporter gene with terminator referring to SV40 promoter <br />
|-<br />
|F15||CMV_TetO2||[http://partsregistry.org/Part:BBa_K337027 BBa_K337027]|| CMV promoter under control of Tet Operator for regulation of gene expression<br />
|-<br />
|R1||Sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337045 BBa_K337045]||rowspan="4"| bidirectional hybrid promoter<br />
|-<br />
|R2||Sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337047 BBa_K337047]<br />
|-<br />
|R3||RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337048 BBa_K337048]<br />
|-<br />
|R4||RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337050 BBa_K337050]<br />
|-<br />
|R5||BGH(rc)/shRNA10(rc)||[http://partsregistry.org/Part:BBa_K337051 BBa_K337051]||rowspan="1"| synthetic microRNA template part<br />
|-<br />
|R13||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337020 BBa_K337020]||rowspan="7"|tuning construct cloning into reporter plasmid backbone containing a binding site against synthetic shRNA-like miRNA<br />
|-<br />
|R14||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337021 BBa_K337021] <br />
|-<br />
|R15||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337022 BBa_K337022]<br />
|-<br />
|R16||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337023 BBa_K337023]<br />
|-<br />
|R17||BGH(rc)/shRNA6(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337024 BBa_K337024]<br />
|-<br />
|R18||BGH(rc)/shRNA6(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337026 BBa_K337026]<br />
|-<br />
|R19||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337029 BBa_K337029]<br />
|-<br />
|R20||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337031 BBa_K337031]||tuning construct core containing Tet Operator for On-Targeting together with repressor construct<br />
|-<br />
|R21||Luc2(rc)_sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337033 BBa_K337033]||rowspan="2"| bidirectional hybrid promoter with Luc2 reference gene under control of SV40 promoter<br />
|-<br />
|R22||Luc2(rc)_sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337034 BBa_K337034]<br />
|-<br />
|R32||Kozag_hRluc/BGH(fw)||[http://partsregistry.org/Part:BBa_K337037 BBa_K337037]||reference reporter<br />
|-<br />
|R33||TetR_mut(XhoI/XbaI)||[http://partsregistry.org/Part:BBa_K337039 BBa_K337039]||mutagenized TetR including cutting sites to paste miRNA binding sites<br />
|-<br />
|T1||BGH(rc)_CMV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337041 BBa_K337041]||rowspan="2"|repressor construct for On-Targeting together with tuning construct<br />
|-<br />
|T2||BGH(rc)_RSV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337043 BBa_K337043]<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==miTuning Kit - Intermediate Parts 2==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K1||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337032 BBa_K337032]|| pSMB_miTuner Plasmid HD1 <br />
|-<br />
|K2||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337035 BBa_K337035]|| pSMB_miTuner Plasmid HD2 <br />
<br />
|-<br />
|K5||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337040 BBa_K337040]|| pSMB_miTuner Plasmid HD5 <br />
|-<br />
|K6||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337042 BBa_K337042]|| pSMB_miTuner Plasmid HD6 <br />
|-<br />
|K7||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337044 BBa_K337044]|| pSMB_miTuner Plasmid HD7 <br />
|-<br />
|K8||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337046 BBa_K337046]|| pSMB_miTuner Plasmid HD8 <br />
|-<br />
|}<br />
</center><br />
<br />
==ViroBytes==<br />
<br />
These parts are not submitted in the standardized form. <br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=150px|Part name||width=100px|Registry link||width=300px|Description<br />
|-<br />
|1||Fragment 1 of wt AAV1||[http://partsregistry.org/Part:BBa_K337058 BBa_K337058]||flanked with Bsa1 sites at both ends<br />
|-<br />
|2 ||Fragment 2 of wt AAV1||[http://partsregistry.org/Part:BBa_K337059 BBa_K337059]||flanked with Bsa1 sites at both ends<br />
|-<br />
|3 ||Fragment 3 of wt AAV1||[http://partsregistry.org/Part:BBa_K337060 BBa_K337060]||flanked with Bsa1 sites at both ends<br />
|-<br />
|4 ||Fragment 4 of wt AAV1||[http://partsregistry.org/Part:BBa_K337061 BBa_K337061]||flanked with Bsa1 sites at both ends<br />
|-<br />
|5 ||Fragment 5 of wt AAV1||[http://partsregistry.org/Part:BBa_K337062 BBa_K337062]||flanked with Bsa1 sites at both ends<br />
|-<br />
|6 ||Fragment 6 of wt AAV1||[http://partsregistry.org/Part:BBa_K337063 BBa_K337063]||flanked with Bsa1 sites at both ends<br />
|-<br />
|7 ||Fragment 7 of wt AAV1||[http://partsregistry.org/Part:BBa_K337064 BBa_K337064]||flanked with Bsa1 sites at both ends<br />
|-<br />
|8 ||Fragment 8 of wt AAV1||[http://partsregistry.org/Part:BBa_K337065 BBa_K337065]||flanked with Bsa1 sites at both ends<br />
|-<br />
|9 ||Fragment 1 of wt AAV2||[http://partsregistry.org/Part:BBa_K337066 BBa_K337066]||flanked with Bsa1 sites at both ends<br />
|-<br />
|10 ||Fragment 2 of wt AAV2||[http://partsregistry.org/Part:BBa_K337067 BBa_K337067]||flanked with Bsa1 sites at both ends<br />
|-<br />
|11 ||Fragment 3 of wt AAV2||[http://partsregistry.org/Part:BBa_K337068 BBa_K337068]||flanked with Bsa1 sites at both ends<br />
|-<br />
|12 ||Fragment 4 of wt AAV2||[http://partsregistry.org/Part:BBa_K337069 BBa_K337069]||flanked with Bsa1 sites at both ends<br />
|-<br />
|13 ||Fragment 5 of wt AAV2||[http://partsregistry.org/Part:BBa_K337070 BBa_K337070]||flanked with Bsa1 sites at both ends<br />
|-<br />
|14 ||Fragment 6 of wt AAV2||[http://partsregistry.org/Part:BBa_K337071 BBa_K337071]||flanked with Bsa1 sites at both ends<br />
|-<br />
|15 ||Fragment 7 of wt AAV2||[http://partsregistry.org/Part:BBa_K337072 BBa_K337072]||flanked with Bsa1 sites at both ends<br />
|-<br />
|16 ||Fragment 8 of wt AAV2||[http://partsregistry.org/Part:BBa_K337073 BBa_K337073]||flanked with Bsa1 sites at both ends<br />
|-<br />
|17 ||Fragment 1 of wt AAV5||[http://partsregistry.org/Part:BBa_K337074 BBa_K337074]||flanked with Bsa1 sites at both ends<br />
|-<br />
|18 ||Fragment 2 of wt AAV5||[http://partsregistry.org/Part:BBa_K337075 BBa_K337075]||flanked with Bsa1 sites at both ends<br />
|-<br />
|19 ||Fragment 3 of wt AAV5||[http://partsregistry.org/Part:BBa_K337076 BBa_K337076]||flanked with Bsa1 sites at both ends<br />
|-<br />
|20 ||Fragment 4 of wt AAV5||[http://partsregistry.org/Part:BBa_K337077 BBa_K337077]||flanked with Bsa1 sites at both ends<br />
|-<br />
|21 ||Fragment 5 of wt AAV5||[http://partsregistry.org/Part:BBa_K337078 BBa_K337078]||flanked with Bsa1 sites at both ends<br />
|-<br />
|22 ||Fragment 6 of wt AAV5||[http://partsregistry.org/Part:BBa_K337079 BBa_K337079]||flanked with Bsa1 sites at both ends<br />
|-<br />
|23 ||Fragment 7 of wt AAV5||[http://partsregistry.org/Part:BBa_K337080 BBa_K337080]||flanked with Bsa1 sites at both ends<br />
|-<br />
|24 ||Fragment 8 of wt AAV5||[http://partsregistry.org/Part:BBa_K337081 BBa_K337081]||flanked with Bsa1 sites at both ends<br />
|-<br />
|25 ||Fragment 1 of wt AAV6||[http://partsregistry.org/Part:BBa_K337082 BBa_K337082]||flanked with Bsa1 sites at both ends<br />
|-<br />
|26 ||Fragment 2 of wt AAV6||[http://partsregistry.org/Part:BBa_K337083 BBa_K337083]||flanked with Bsa1 sites at both ends<br />
|-<br />
|27 ||Fragment 3 of wt AAV6||[http://partsregistry.org/Part:BBa_K337084 BBa_K337084]||flanked with Bsa1 sites at both ends<br />
|-<br />
|28 ||Fragment 4 of wt AAV6||[http://partsregistry.org/Part:BBa_K337085 BBa_K337085]||flanked with Bsa1 sites at both ends<br />
|-<br />
|29 ||Fragment 5 of wt AAV6||[http://partsregistry.org/Part:BBa_K337086 BBa_K337086]||flanked with Bsa1 sites at both ends<br />
|-<br />
|30 ||Fragment 6 of wt AAV6||[http://partsregistry.org/Part:BBa_K337087 BBa_K337087]||flanked with Bsa1 sites at both ends<br />
|-<br />
|31 ||Fragment 7 of wt AAV6||[http://partsregistry.org/Part:BBa_K337088 BBa_K337088]||flanked with Bsa1 sites at both ends<br />
|-<br />
|32 ||Fragment 8 of wt AAV6||[http://partsregistry.org/Part:BBa_K337089 BBa_K337089]||flanked with Bsa1 sites at both ends<br />
|-<br />
|33 ||Fragment 1 of wt AAV8||[http://partsregistry.org/Part:BBa_K337090 BBa_K337090]||flanked with Bsa1 sites at both ends<br />
|-<br />
|34 ||Fragment 2 of wt AAV8||[http://partsregistry.org/Part:BBa_K337091 BBa_K337091]||flanked with Bsa1 sites at both ends<br />
|-<br />
|35 ||Fragment 3 of wt AAV8||[http://partsregistry.org/Part:BBa_K337092 BBa_K337092]||flanked with Bsa1 sites at both ends<br />
|-<br />
|36 ||Fragment 4 of wt AAV8||[http://partsregistry.org/Part:BBa_K337093 BBa_K337093]||flanked with Bsa1 sites at both ends<br />
|-<br />
|37 ||Fragment 5 of wt AAV8||[http://partsregistry.org/Part:BBa_K337094 BBa_K337094]||flanked with Bsa1 sites at both ends<br />
|-<br />
|38 ||Fragment 6 of wt AAV8||[http://partsregistry.org/Part:BBa_K337095 BBa_K337095]||flanked with Bsa1 sites at both ends<br />
|-<br />
|39 ||Fragment 7 of wt AAV8||[http://partsregistry.org/Part:BBa_K337096 BBa_K337096]||flanked with Bsa1 sites at both ends<br />
|-<br />
|40 ||Fragment 8 of wt AAV8||[http://partsregistry.org/Part:BBa_K337097 BBa_K337097]||flanked with Bsa1 sites at both ends<br />
|-<br />
|41 ||Fragment 1 of wt AAV9||[http://partsregistry.org/Part:BBa_K337098 BBa_K337098]||flanked with Bsa1 sites at both ends<br />
|-<br />
|42 ||Fragment 2 of wt AAV9||[http://partsregistry.org/Part:BBa_K337099 BBa_K337099]||flanked with Bsa1 sites at both ends<br />
|-<br />
|43 ||Fragment 3 of wt AAV9||[http://partsregistry.org/Part:BBa_K337100 BBa_K337100]||flanked with Bsa1 sites at both ends<br />
|-<br />
|44 ||Fragment 4 of wt AAV9||[http://partsregistry.org/Part:BBa_K337101 BBa_K337101]||flanked with Bsa1 sites at both ends<br />
|-<br />
|45 ||Fragment 5 of wt AAV9||[http://partsregistry.org/Part:BBa_K337102 BBa_K337102]||flanked with Bsa1 sites at both ends<br />
|-<br />
|46 ||Fragment 6 of wt AAV9||[http://partsregistry.org/Part:BBa_K337103 BBa_K337103]||flanked with Bsa1 sites at both ends<br />
|-<br />
|47 ||Fragment 7 of wt AAV9||[http://partsregistry.org/Part:BBa_K337104 BBa_K337104]||flanked with Bsa1 sites at both ends<br />
|-<br />
|48 ||Fragment 8 of wt AAV9||[http://partsregistry.org/Part:BBa_K337105 BBa_K337105]||flanked with Bsa1 sites at both ends<br />
|-<br />
<br />
|}<br />
</center><br />
<br />
<!-- <groupparts>iGEM010 Heidelberg</groupparts> --><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2010-10-27T22:19:16Z<p>Rudolf: /* ViroBytes */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts}}<br />
<br />
<html><br />
<script type="text/javascript"><br />
function start() {<br />
<br />
var d = document.getElementById("groupparts")<br />
<br />
d.style.width = "620px"<br />
<br />
switch (d.getElementsByTagName("thead")[0]) {<br />
<br />
case undefined:<br />
setTimeout("start()",200);<br />
break;<br />
<br />
default:<br />
formatparts();<br />
break;<br />
}<br />
}<br />
<br />
function formatparts() {<br />
<br />
var d = document.getElementById("groupparts");<br />
var dbodytr = d.getElementsByTagName("tbody")[0].getElementsByTagName("tr");<br />
var lasttd = dbodytr[0].getElementsByTagName("td").length;<br />
var designertd = lasttd - 2;<br />
var rowscount = dbodytr.length<br />
<br />
d.getElementsByTagName("thead")[0].getElementsByTagName("th")[6].style.display = "none"<br />
<br />
for (var i=0;i<rowscount;i++) {<br />
dbodytr[i].getElementsByTagName("td")[designertd].style.display ="none"<br />
}<br />
<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Heidelberg/tables|normal=FFF|highlight=ddd}}<br />
<html><br />
<body onload="start()"><br />
</html><br />
__NOTOC__<br />
=miBricks - Parts submitted to the registry=<br />
<br><br />
<br />
The parts we submit belong to the two core aims our project: Reaching regulatory control (1) and specificity (2) of gene expression of any gene of interest in any target cell or tissue of choice. Therefore we engineered parts, that address these two aims on two different regulatory levels. <br />
<br />
First, we engineered gene therapy vectors based on synthetic adeno associated viruses (AAVs). On parts level, we provide about 50 plasmids that can be used for creating shuffled AAV libraries or even rationally designed, recombinant AAV vectors. Those parts we refer to as virobytes, are designed in a format directly applicable for the [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes Virobytes Assembly] protocol we develop.<br />
<br />
On RNA level we provide the [https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit miTuner toolkit] consisting of roughly 60 parts enabling gene expression control based on synthetic or cell-specific endogenous microRNAs. This toolkit consists of three main constructs: The '''pSMB_miMeasure''' binding site characterization standard and '''two pSMB_miTuner''' expression controlling plasmids. Furthermore, it contains 12 basic and 28 intermediate construction parts, synthetic, single microRNA binding sites as well as binding site patterns in BB-2 (RFC 12, Tom Knight) standard. This enables maximum flexibility for applications in many different contexts.<br />
<br />
<br />
==Main Measurement Constructs - Engineered==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K3||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337036 BBa_K337036]|| pSMB_miTuner Plasmid HD3 <br />
|-<br />
|K4||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337038 BBa_K337038]|| pSMB_miTuner Plasmid HD4<br />
|-<br />
|miM||sv40ter(rc)/eBFP(rc)/biCMV/eGFP(fw)/sv40ter(fw)||[http://partsregistry.org/Part:BBa_K337049 BBa_K337049]|| pSMB_miMeasure<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==Synthetic Single Binding Sites==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|(Physical DNA not submitted)<br />
|width=60px| Design||width=300px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|KD:97%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052]||shRNA miRhaat<br />
|-<br />
|KD:69%||imperfect binding site: point mut 11||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053]||shRNA miRhaat <br />
|-<br />
|KD:28%||imperfect binding site: bulge 16-18||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]||shRNA miRhaat <br />
|-<br />
|KD:96%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]||miR122 <br />
|-<br />
|KD:64%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056]||miR122 <br />
|-<br />
|KD:24%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057]||miR122 <br />
|-<br />
|}<br />
</center><br />
<br />
==synthetic microRNA binding Site patterns against endogenous miR122==<br />
<center><br />
<br />
<br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=350px|Content||width=100px|Registry link<br />
|-<br />
|1.3||hsa-miR-122 Binding site pattern (3BS)||[http://partsregistry.org/Part:BBa_K337000 BBa_K337000]<br />
|-<br />
|1A||hsa-miR-122 Binding site pattern (4BS)||[http://partsregistry.org/Part:BBa_K337003 BBa_K337003]<br />
|-<br />
|1-5||hsa-miR-122 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337004 BBa_K337004]<br />
|-<br />
|3.7||hsa-miR-122 Binding site pattern (2BS - additional 10bp Spacer)||[http://partsregistry.org/Part:BBa_K337005 BBa_K337005]<br />
|-<br />
|1.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337006 BBa_K337006]<br />
|-<br />
|1.8||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337007 BBa_K337007]<br />
|-<br />
|3.1||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337008 BBa_K337008]<br />
|-<br />
|4.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337009 BBa_K337009]<br />
|-<br />
|4.6||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337010 BBa_K337010]<br />
|-<br />
|mir221-10L2||hsa-miR-221 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337011 BBa_K337011]<br />
|-<br />
|}<br />
</center><br />
<br />
==miTunig Kit - Basic Parts==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=100px|Content||width=100px|Registry link|| width=300px|Comment<br />
|-<br />
|F1||RSV fw||[http://partsregistry.org/Part:BBa_K337012 BBa_K337012]||-<br />
|-<br />
|F2||SV40 rc||[http://partsregistry.org/Part:BBa_K337013 BBa_K337013]||-<br />
|-<br />
|F3||RSV rc||[http://partsregistry.org/Part:BBa_K337014 BBa_K337014]||-<br />
|-<br />
|F4||BGH fw||[http://partsregistry.org/Part:BBa_K337001 BBa_K337001]||-<br />
|-<br />
|F5||BGH rc||[http://partsregistry.org/Part:BBa_K337002 BBa_K337002]|| leads to insertion of BamHI site<br />
|-<br />
|F7||microRNA 10HD||[http://partsregistry.org/Part:BBa_K337016 BBa_K337016]|| template for creation of shRNA-like miRNA<br />
|-<br />
|F8||CMV fw||[http://partsregistry.org/Part:BBa_K337018 BBa_K337018]||-<br />
|-<br />
|F9||FRT site||[http://partsregistry.org/Part:BBa_K337019 BBa_K337019]||-<br />
|-<br />
|F10||hRluc||[http://partsregistry.org/Part:BBa_K337025 BBa_K337025]||-<br />
|-<br />
|F16||TetR||[http://partsregistry.org/Part:BBa_K337028 BBa_K337028]||-<br />
|-<br />
|F17||Luc2||[http://partsregistry.org/Part:BBa_K337030 BBa_K337030]|| compatible for insertion of microRNA binding sites<br />
|-<br />
|biCMV||biCMV||[http://partsregistry.org/Part:BBa_K337017 BBa_K337017]||-<br />
|-<br />
|}<br />
</center><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==miTuning Kit - Intermediate Parts 1==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=300px|Content||width=100px|Registry link||width=450px|Purpose of the cassette <br />
|-<br />
|F6||luc2_sv40ter||[http://partsregistry.org/Part:BBa_K337015 BBa_K337015]|| Luc2 reporter gene with terminator referring to SV40 promoter <br />
|-<br />
|F15||CMV_TetO2||[http://partsregistry.org/Part:BBa_K337027 BBa_K337027]|| CMV promoter under control of Tet Operator for regulation of gene expression<br />
|-<br />
|R1||Sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337045 BBa_K337045]||rowspan="4"| bidirectional hybrid promoter<br />
|-<br />
|R2||Sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337047 BBa_K337047]<br />
|-<br />
|R3||RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337048 BBa_K337048]<br />
|-<br />
|R4||RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337050 BBa_K337050]<br />
|-<br />
|R5||BGH(rc)/shRNA10(rc)||[http://partsregistry.org/Part:BBa_K337051 BBa_K337051]||rowspan="1"| synthetic microRNA template part<br />
|-<br />
|R13||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337020 BBa_K337020]||rowspan="7"|tuning construct cloning into reporter plasmid backbone containing a binding site against synthetic shRNA-like miRNA<br />
|-<br />
|R14||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337021 BBa_K337021] <br />
|-<br />
|R15||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337022 BBa_K337022]<br />
|-<br />
|R16||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337023 BBa_K337023]<br />
|-<br />
|R17||BGH(rc)/shRNA6(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337024 BBa_K337024]<br />
|-<br />
|R18||BGH(rc)/shRNA6(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337026 BBa_K337026]<br />
|-<br />
|R19||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337029 BBa_K337029]<br />
|-<br />
|R20||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337031 BBa_K337031]||tuning construct core containing Tet Operator for On-Targeting together with repressor construct<br />
|-<br />
|R21||Luc2(rc)_sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337033 BBa_K337033]||rowspan="2"| bidirectional hybrid promoter with Luc2 reference gene under control of SV40 promoter<br />
|-<br />
|R22||Luc2(rc)_sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337034 BBa_K337034]<br />
|-<br />
|R32||Kozag_hRluc/BGH(fw)||[http://partsregistry.org/Part:BBa_K337037 BBa_K337037]||reference reporter<br />
|-<br />
|R33||TetR_mut(XhoI/XbaI)||[http://partsregistry.org/Part:BBa_K337039 BBa_K337039]||mutagenized TetR including cutting sites to paste miRNA binding sites<br />
|-<br />
|T1||BGH(rc)_CMV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337041 BBa_K337041]||rowspan="2"|repressor construct for On-Targeting together with tuning construct<br />
|-<br />
|T2||BGH(rc)_RSV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337043 BBa_K337043]<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==miTuning Kit - Intermediate Parts 2==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K1||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337032 BBa_K337032]|| pSMB_miTuner Plasmid HD1 <br />
|-<br />
|K2||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337035 BBa_K337035]|| pSMB_miTuner Plasmid HD2 <br />
<br />
|-<br />
|K5||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337040 BBa_K337040]|| pSMB_miTuner Plasmid HD5 <br />
|-<br />
|K6||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337042 BBa_K337042]|| pSMB_miTuner Plasmid HD6 <br />
|-<br />
|K7||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337044 BBa_K337044]|| pSMB_miTuner Plasmid HD7 <br />
|-<br />
|K8||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337046 BBa_K337046]|| pSMB_miTuner Plasmid HD8 <br />
|-<br />
|}<br />
</center><br />
<br />
==ViroBytes==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=150px|Part name||width=100px|Registry link||width=300px|Description<br />
|-<br />
|1||Fragment 1 of wt AAV1||[http://partsregistry.org/Part:BBa_K337058 BBa_K337058]||flanked with Bsa1 sites at both ends<br />
|-<br />
|2 ||Fragment 2 of wt AAV1||[http://partsregistry.org/Part:BBa_K337059 BBa_K337059]||flanked with Bsa1 sites at both ends<br />
|-<br />
|3 ||Fragment 3 of wt AAV1||[http://partsregistry.org/Part:BBa_K337060 BBa_K337060]||flanked with Bsa1 sites at both ends<br />
|-<br />
|4 ||Fragment 4 of wt AAV1||[http://partsregistry.org/Part:BBa_K337061 BBa_K337061]||flanked with Bsa1 sites at both ends<br />
|-<br />
|5 ||Fragment 5 of wt AAV1||[http://partsregistry.org/Part:BBa_K337062 BBa_K337062]||flanked with Bsa1 sites at both ends<br />
|-<br />
|6 ||Fragment 6 of wt AAV1||[http://partsregistry.org/Part:BBa_K337063 BBa_K337063]||flanked with Bsa1 sites at both ends<br />
|-<br />
|7 ||Fragment 7 of wt AAV1||[http://partsregistry.org/Part:BBa_K337064 BBa_K337064]||flanked with Bsa1 sites at both ends<br />
|-<br />
|8 ||Fragment 8 of wt AAV1||[http://partsregistry.org/Part:BBa_K337065 BBa_K337065]||flanked with Bsa1 sites at both ends<br />
|-<br />
|9 ||Fragment 1 of wt AAV2||[http://partsregistry.org/Part:BBa_K337066 BBa_K337066]||flanked with Bsa1 sites at both ends<br />
|-<br />
|10 ||Fragment 2 of wt AAV2||[http://partsregistry.org/Part:BBa_K337067 BBa_K337067]||flanked with Bsa1 sites at both ends<br />
|-<br />
|11 ||Fragment 3 of wt AAV2||[http://partsregistry.org/Part:BBa_K337068 BBa_K337068]||flanked with Bsa1 sites at both ends<br />
|-<br />
|12 ||Fragment 4 of wt AAV2||[http://partsregistry.org/Part:BBa_K337069 BBa_K337069]||flanked with Bsa1 sites at both ends<br />
|-<br />
|13 ||Fragment 5 of wt AAV2||[http://partsregistry.org/Part:BBa_K337070 BBa_K337070]||flanked with Bsa1 sites at both ends<br />
|-<br />
|14 ||Fragment 6 of wt AAV2||[http://partsregistry.org/Part:BBa_K337071 BBa_K337071]||flanked with Bsa1 sites at both ends<br />
|-<br />
|15 ||Fragment 7 of wt AAV2||[http://partsregistry.org/Part:BBa_K337072 BBa_K337072]||flanked with Bsa1 sites at both ends<br />
|-<br />
|16 ||Fragment 8 of wt AAV2||[http://partsregistry.org/Part:BBa_K337073 BBa_K337073]||flanked with Bsa1 sites at both ends<br />
|-<br />
|17 ||Fragment 1 of wt AAV5||[http://partsregistry.org/Part:BBa_K337074 BBa_K337074]||flanked with Bsa1 sites at both ends<br />
|-<br />
|18 ||Fragment 2 of wt AAV5||[http://partsregistry.org/Part:BBa_K337075 BBa_K337075]||flanked with Bsa1 sites at both ends<br />
|-<br />
|19 ||Fragment 3 of wt AAV5||[http://partsregistry.org/Part:BBa_K337076 BBa_K337076]||flanked with Bsa1 sites at both ends<br />
|-<br />
|20 ||Fragment 4 of wt AAV5||[http://partsregistry.org/Part:BBa_K337077 BBa_K337077]||flanked with Bsa1 sites at both ends<br />
|-<br />
|21 ||Fragment 5 of wt AAV5||[http://partsregistry.org/Part:BBa_K337078 BBa_K337078]||flanked with Bsa1 sites at both ends<br />
|-<br />
|22 ||Fragment 6 of wt AAV5||[http://partsregistry.org/Part:BBa_K337079 BBa_K337079]||flanked with Bsa1 sites at both ends<br />
|-<br />
|23 ||Fragment 7 of wt AAV5||[http://partsregistry.org/Part:BBa_K337080 BBa_K337080]||flanked with Bsa1 sites at both ends<br />
|-<br />
|24 ||Fragment 8 of wt AAV5||[http://partsregistry.org/Part:BBa_K337081 BBa_K337081]||flanked with Bsa1 sites at both ends<br />
|-<br />
|25 ||Fragment 1 of wt AAV6||[http://partsregistry.org/Part:BBa_K337082 BBa_K337082]||flanked with Bsa1 sites at both ends<br />
|-<br />
|26 ||Fragment 2 of wt AAV6||[http://partsregistry.org/Part:BBa_K337083 BBa_K337083]||flanked with Bsa1 sites at both ends<br />
|-<br />
|27 ||Fragment 3 of wt AAV6||[http://partsregistry.org/Part:BBa_K337084 BBa_K337084]||flanked with Bsa1 sites at both ends<br />
|-<br />
|28 ||Fragment 4 of wt AAV6||[http://partsregistry.org/Part:BBa_K337085 BBa_K337085]||flanked with Bsa1 sites at both ends<br />
|-<br />
|29 ||Fragment 5 of wt AAV6||[http://partsregistry.org/Part:BBa_K337086 BBa_K337086]||flanked with Bsa1 sites at both ends<br />
|-<br />
|30 ||Fragment 6 of wt AAV6||[http://partsregistry.org/Part:BBa_K337087 BBa_K337087]||flanked with Bsa1 sites at both ends<br />
|-<br />
|31 ||Fragment 7 of wt AAV6||[http://partsregistry.org/Part:BBa_K337088 BBa_K337088]||flanked with Bsa1 sites at both ends<br />
|-<br />
|32 ||Fragment 8 of wt AAV6||[http://partsregistry.org/Part:BBa_K337089 BBa_K337089]||flanked with Bsa1 sites at both ends<br />
|-<br />
|33 ||Fragment 1 of wt AAV8||[http://partsregistry.org/Part:BBa_K337090 BBa_K337090]||flanked with Bsa1 sites at both ends<br />
|-<br />
|34 ||Fragment 2 of wt AAV8||[http://partsregistry.org/Part:BBa_K337091 BBa_K337091]||flanked with Bsa1 sites at both ends<br />
|-<br />
|35 ||Fragment 3 of wt AAV8||[http://partsregistry.org/Part:BBa_K337092 BBa_K337092]||flanked with Bsa1 sites at both ends<br />
|-<br />
|36 ||Fragment 4 of wt AAV8||[http://partsregistry.org/Part:BBa_K337093 BBa_K337093]||flanked with Bsa1 sites at both ends<br />
|-<br />
|37 ||Fragment 5 of wt AAV8||[http://partsregistry.org/Part:BBa_K337094 BBa_K337094]||flanked with Bsa1 sites at both ends<br />
|-<br />
|38 ||Fragment 6 of wt AAV8||[http://partsregistry.org/Part:BBa_K337095 BBa_K337095]||flanked with Bsa1 sites at both ends<br />
|-<br />
|39 ||Fragment 7 of wt AAV8||[http://partsregistry.org/Part:BBa_K337096 BBa_K337096]||flanked with Bsa1 sites at both ends<br />
|-<br />
|40 ||Fragment 8 of wt AAV8||[http://partsregistry.org/Part:BBa_K337097 BBa_K337097]||flanked with Bsa1 sites at both ends<br />
|-<br />
|41 ||Fragment 1 of wt AAV9||[http://partsregistry.org/Part:BBa_K337098 BBa_K337098]||flanked with Bsa1 sites at both ends<br />
|-<br />
|42 ||Fragment 2 of wt AAV9||[http://partsregistry.org/Part:BBa_K337099 BBa_K337099]||flanked with Bsa1 sites at both ends<br />
|-<br />
|43 ||Fragment 3 of wt AAV9||[http://partsregistry.org/Part:BBa_K337100 BBa_K337100]||flanked with Bsa1 sites at both ends<br />
|-<br />
|44 ||Fragment 4 of wt AAV9||[http://partsregistry.org/Part:BBa_K337101 BBa_K337101]||flanked with Bsa1 sites at both ends<br />
|-<br />
|45 ||Fragment 5 of wt AAV9||[http://partsregistry.org/Part:BBa_K337102 BBa_K337102]||flanked with Bsa1 sites at both ends<br />
|-<br />
|46 ||Fragment 6 of wt AAV9||[http://partsregistry.org/Part:BBa_K337103 BBa_K337103]||flanked with Bsa1 sites at both ends<br />
|-<br />
|47 ||Fragment 7 of wt AAV9||[http://partsregistry.org/Part:BBa_K337104 BBa_K337104]||flanked with Bsa1 sites at both ends<br />
|-<br />
|48 ||Fragment 8 of wt AAV9||[http://partsregistry.org/Part:BBa_K337105 BBa_K337105]||flanked with Bsa1 sites at both ends<br />
|-<br />
<br />
|}<br />
</center><br />
<br />
<!-- <groupparts>iGEM010 Heidelberg</groupparts> --><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2010-10-27T22:15:58Z<p>Rudolf: /* ViroBytes */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts}}<br />
<br />
<html><br />
<script type="text/javascript"><br />
function start() {<br />
<br />
var d = document.getElementById("groupparts")<br />
<br />
d.style.width = "620px"<br />
<br />
switch (d.getElementsByTagName("thead")[0]) {<br />
<br />
case undefined:<br />
setTimeout("start()",200);<br />
break;<br />
<br />
default:<br />
formatparts();<br />
break;<br />
}<br />
}<br />
<br />
function formatparts() {<br />
<br />
var d = document.getElementById("groupparts");<br />
var dbodytr = d.getElementsByTagName("tbody")[0].getElementsByTagName("tr");<br />
var lasttd = dbodytr[0].getElementsByTagName("td").length;<br />
var designertd = lasttd - 2;<br />
var rowscount = dbodytr.length<br />
<br />
d.getElementsByTagName("thead")[0].getElementsByTagName("th")[6].style.display = "none"<br />
<br />
for (var i=0;i<rowscount;i++) {<br />
dbodytr[i].getElementsByTagName("td")[designertd].style.display ="none"<br />
}<br />
<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Heidelberg/tables|normal=FFF|highlight=ddd}}<br />
<html><br />
<body onload="start()"><br />
</html><br />
__NOTOC__<br />
=miBricks - Parts submitted to the registry=<br />
<br><br />
<br />
The parts we submit belong to the two core aims our project: Reaching regulatory control (1) and specificity (2) of gene expression of any gene of interest in any target cell or tissue of choice. Therefore we engineered parts, that address these two aims on two different regulatory levels. <br />
<br />
First, we engineered gene therapy vectors based on synthetic adeno associated viruses (AAVs). On parts level, we provide about 50 plasmids that can be used for creating shuffled AAV libraries or even rationally designed, recombinant AAV vectors. Those parts we refer to as virobytes, are designed in a format directly applicable for the [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes Virobytes Assembly] protocol we develop.<br />
<br />
On RNA level we provide the [https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit miTuner toolkit] consisting of roughly 60 parts enabling gene expression control based on synthetic or cell-specific endogenous microRNAs. This toolkit consists of three main constructs: The '''pSMB_miMeasure''' binding site characterization standard and '''two pSMB_miTuner''' expression controlling plasmids. Furthermore, it contains 12 basic and 28 intermediate construction parts, synthetic, single microRNA binding sites as well as binding site patterns in BB-2 (RFC 12, Tom Knight) standard. This enables maximum flexibility for applications in many different contexts.<br />
<br />
<br />
==Main Measurement Constructs - Engineered==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K3||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337036 BBa_K337036]|| pSMB_miTuner Plasmid HD3 <br />
|-<br />
|K4||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337038 BBa_K337038]|| pSMB_miTuner Plasmid HD4<br />
|-<br />
|miM||sv40ter(rc)/eBFP(rc)/biCMV/eGFP(fw)/sv40ter(fw)||[http://partsregistry.org/Part:BBa_K337049 BBa_K337049]|| pSMB_miMeasure<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==Synthetic Single Binding Sites==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|(Physical DNA not submitted)<br />
|width=60px| Design||width=300px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|KD:97%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052]||shRNA miRhaat<br />
|-<br />
|KD:69%||imperfect binding site: point mut 11||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053]||shRNA miRhaat <br />
|-<br />
|KD:28%||imperfect binding site: bulge 16-18||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]||shRNA miRhaat <br />
|-<br />
|KD:96%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]||miR122 <br />
|-<br />
|KD:64%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056]||miR122 <br />
|-<br />
|KD:24%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057]||miR122 <br />
|-<br />
|}<br />
</center><br />
<br />
==synthetic microRNA binding Site patterns against endogenous miR122==<br />
<center><br />
<br />
<br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=350px|Content||width=100px|Registry link<br />
|-<br />
|1.3||hsa-miR-122 Binding site pattern (3BS)||[http://partsregistry.org/Part:BBa_K337000 BBa_K337000]<br />
|-<br />
|1A||hsa-miR-122 Binding site pattern (4BS)||[http://partsregistry.org/Part:BBa_K337003 BBa_K337003]<br />
|-<br />
|1-5||hsa-miR-122 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337004 BBa_K337004]<br />
|-<br />
|3.7||hsa-miR-122 Binding site pattern (2BS - additional 10bp Spacer)||[http://partsregistry.org/Part:BBa_K337005 BBa_K337005]<br />
|-<br />
|1.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337006 BBa_K337006]<br />
|-<br />
|1.8||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337007 BBa_K337007]<br />
|-<br />
|3.1||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337008 BBa_K337008]<br />
|-<br />
|4.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337009 BBa_K337009]<br />
|-<br />
|4.6||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337010 BBa_K337010]<br />
|-<br />
|mir221-10L2||hsa-miR-221 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337011 BBa_K337011]<br />
|-<br />
|}<br />
</center><br />
<br />
==miTunig Kit - Basic Parts==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=100px|Content||width=100px|Registry link|| width=300px|Comment<br />
|-<br />
|F1||RSV fw||[http://partsregistry.org/Part:BBa_K337012 BBa_K337012]||-<br />
|-<br />
|F2||SV40 rc||[http://partsregistry.org/Part:BBa_K337013 BBa_K337013]||-<br />
|-<br />
|F3||RSV rc||[http://partsregistry.org/Part:BBa_K337014 BBa_K337014]||-<br />
|-<br />
|F4||BGH fw||[http://partsregistry.org/Part:BBa_K337001 BBa_K337001]||-<br />
|-<br />
|F5||BGH rc||[http://partsregistry.org/Part:BBa_K337002 BBa_K337002]|| leads to insertion of BamHI site<br />
|-<br />
|F7||microRNA 10HD||[http://partsregistry.org/Part:BBa_K337016 BBa_K337016]|| template for creation of shRNA-like miRNA<br />
|-<br />
|F8||CMV fw||[http://partsregistry.org/Part:BBa_K337018 BBa_K337018]||-<br />
|-<br />
|F9||FRT site||[http://partsregistry.org/Part:BBa_K337019 BBa_K337019]||-<br />
|-<br />
|F10||hRluc||[http://partsregistry.org/Part:BBa_K337025 BBa_K337025]||-<br />
|-<br />
|F16||TetR||[http://partsregistry.org/Part:BBa_K337028 BBa_K337028]||-<br />
|-<br />
|F17||Luc2||[http://partsregistry.org/Part:BBa_K337030 BBa_K337030]|| compatible for insertion of microRNA binding sites<br />
|-<br />
|biCMV||biCMV||[http://partsregistry.org/Part:BBa_K337017 BBa_K337017]||-<br />
|-<br />
|}<br />
</center><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==miTuning Kit - Intermediate Parts 1==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=300px|Content||width=100px|Registry link||width=450px|Purpose of the cassette <br />
|-<br />
|F6||luc2_sv40ter||[http://partsregistry.org/Part:BBa_K337015 BBa_K337015]|| Luc2 reporter gene with terminator referring to SV40 promoter <br />
|-<br />
|F15||CMV_TetO2||[http://partsregistry.org/Part:BBa_K337027 BBa_K337027]|| CMV promoter under control of Tet Operator for regulation of gene expression<br />
|-<br />
|R1||Sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337045 BBa_K337045]||rowspan="4"| bidirectional hybrid promoter<br />
|-<br />
|R2||Sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337047 BBa_K337047]<br />
|-<br />
|R3||RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337048 BBa_K337048]<br />
|-<br />
|R4||RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337050 BBa_K337050]<br />
|-<br />
|R5||BGH(rc)/shRNA10(rc)||[http://partsregistry.org/Part:BBa_K337051 BBa_K337051]||rowspan="1"| synthetic microRNA template part<br />
|-<br />
|R13||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337020 BBa_K337020]||rowspan="7"|tuning construct cloning into reporter plasmid backbone containing a binding site against synthetic shRNA-like miRNA<br />
|-<br />
|R14||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337021 BBa_K337021] <br />
|-<br />
|R15||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337022 BBa_K337022]<br />
|-<br />
|R16||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337023 BBa_K337023]<br />
|-<br />
|R17||BGH(rc)/shRNA6(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337024 BBa_K337024]<br />
|-<br />
|R18||BGH(rc)/shRNA6(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337026 BBa_K337026]<br />
|-<br />
|R19||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337029 BBa_K337029]<br />
|-<br />
|R20||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337031 BBa_K337031]||tuning construct core containing Tet Operator for On-Targeting together with repressor construct<br />
|-<br />
|R21||Luc2(rc)_sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337033 BBa_K337033]||rowspan="2"| bidirectional hybrid promoter with Luc2 reference gene under control of SV40 promoter<br />
|-<br />
|R22||Luc2(rc)_sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337034 BBa_K337034]<br />
|-<br />
|R32||Kozag_hRluc/BGH(fw)||[http://partsregistry.org/Part:BBa_K337037 BBa_K337037]||reference reporter<br />
|-<br />
|R33||TetR_mut(XhoI/XbaI)||[http://partsregistry.org/Part:BBa_K337039 BBa_K337039]||mutagenized TetR including cutting sites to paste miRNA binding sites<br />
|-<br />
|T1||BGH(rc)_CMV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337041 BBa_K337041]||rowspan="2"|repressor construct for On-Targeting together with tuning construct<br />
|-<br />
|T2||BGH(rc)_RSV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337043 BBa_K337043]<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==miTuning Kit - Intermediate Parts 2==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K1||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337032 BBa_K337032]|| pSMB_miTuner Plasmid HD1 <br />
|-<br />
|K2||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337035 BBa_K337035]|| pSMB_miTuner Plasmid HD2 <br />
<br />
|-<br />
|K5||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337040 BBa_K337040]|| pSMB_miTuner Plasmid HD5 <br />
|-<br />
|K6||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337042 BBa_K337042]|| pSMB_miTuner Plasmid HD6 <br />
|-<br />
|K7||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337044 BBa_K337044]|| pSMB_miTuner Plasmid HD7 <br />
|-<br />
|K8||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337046 BBa_K337046]|| pSMB_miTuner Plasmid HD8 <br />
|-<br />
|}<br />
</center><br />
<br />
==ViroBytes==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=150px|Part name||width=100px|Registry link||width=300px|Description<br />
|-<br />
|1||Fragment 1 of wt AAV1||[http://partsregistry.org/Part:BBa_K337058 BBa_K337058]||flanked with Bsa1 sites on both ends<br />
|-<br />
|2 ||Fragment 2 of wt AAV1||[http://partsregistry.org/Part:BBa_K337059 BBa_K337059]||flanked with Bsa1 sites on both ends<br />
|-<br />
|3 ||Fragment 3 of wt AAV1||[http://partsregistry.org/Part:BBa_K337060 BBa_K337060]||flanked with Bsa1 sites on both ends<br />
|-<br />
|4 ||Fragment 4 of wt AAV1||[http://partsregistry.org/Part:BBa_K337061 BBa_K337061]||flanked with Bsa1 sites on both ends<br />
|-<br />
|5 ||Fragment 5 of wt AAV1||[http://partsregistry.org/Part:BBa_K337062 BBa_K337062]||flanked with Bsa1 sites on both ends<br />
|-<br />
|6 ||Fragment 6 of wt AAV1||[http://partsregistry.org/Part:BBa_K337063 BBa_K337063]||flanked with Bsa1 sites on both ends<br />
|-<br />
|7 ||Fragment 7 of wt AAV1||[http://partsregistry.org/Part:BBa_K337064 BBa_K337064]||flanked with Bsa1 sites on both ends<br />
|-<br />
|8 ||Fragment 8 of wt AAV1||[http://partsregistry.org/Part:BBa_K337065 BBa_K337065]||flanked with Bsa1 sites on both ends<br />
|-<br />
|9 ||Fragment 1 of wt AAV2||[http://partsregistry.org/Part:BBa_K337066 BBa_K337066]||flanked with Bsa1 sites on both ends<br />
|-<br />
|10 ||Fragment 2 of wt AAV2||[http://partsregistry.org/Part:BBa_K337067 BBa_K337067]||flanked with Bsa1 sites on both ends<br />
|-<br />
|11 ||Fragment 3 of wt AAV2||[http://partsregistry.org/Part:BBa_K337068 BBa_K337068]||flanked with Bsa1 sites on both ends<br />
|-<br />
|12 ||Fragment 4 of wt AAV2||[http://partsregistry.org/Part:BBa_K337069 BBa_K337069]||flanked with Bsa1 sites on both ends<br />
|-<br />
|13 ||Fragment 5 of wt AAV2||[http://partsregistry.org/Part:BBa_K337070 BBa_K337070]||flanked with Bsa1 sites on both ends<br />
|-<br />
|14 ||Fragment 6 of wt AAV2||[http://partsregistry.org/Part:BBa_K337071 BBa_K337071]||flanked with Bsa1 sites on both ends<br />
|-<br />
|15 ||Fragment 7 of wt AAV2||[http://partsregistry.org/Part:BBa_K337072 BBa_K337072]||flanked with Bsa1 sites on both ends<br />
|-<br />
|16 ||Fragment 8 of wt AAV2||[http://partsregistry.org/Part:BBa_K337073 BBa_K337073]||flanked with Bsa1 sites on both ends<br />
|-<br />
|17 ||Fragment 1 of wt AAV5||[http://partsregistry.org/Part:BBa_K337074 BBa_K337074]||flanked with Bsa1 sites on both ends<br />
|-<br />
|18 ||Fragment 2 of wt AAV5||[http://partsregistry.org/Part:BBa_K337075 BBa_K337075]||flanked with Bsa1 sites on both ends<br />
|-<br />
|19 ||Fragment 3 of wt AAV5||[http://partsregistry.org/Part:BBa_K337076 BBa_K337076]||flanked with Bsa1 sites on both ends<br />
|-<br />
|20 ||Fragment 4 of wt AAV5||[http://partsregistry.org/Part:BBa_K337077 BBa_K337077]||flanked with Bsa1 sites on both ends<br />
|-<br />
|21 ||Fragment 5 of wt AAV5||[http://partsregistry.org/Part:BBa_K337078 BBa_K337078]||flanked with Bsa1 sites on both ends<br />
|-<br />
|22 ||Fragment 6 of wt AAV5||[http://partsregistry.org/Part:BBa_K337079 BBa_K337079]||flanked with Bsa1 sites on both ends<br />
|-<br />
|23 ||Fragment 7 of wt AAV5||[http://partsregistry.org/Part:BBa_K337080 BBa_K337080]||flanked with Bsa1 sites on both ends<br />
|-<br />
|24 ||Fragment 8 of wt AAV5||[http://partsregistry.org/Part:BBa_K337081 BBa_K337081]||flanked with Bsa1 sites on both ends<br />
|-<br />
|25 ||Fragment 1 of wt AAV6||[http://partsregistry.org/Part:BBa_K337082 BBa_K337082]||flanked with Bsa1 sites on both ends<br />
|-<br />
|26 ||Fragment 2 of wt AAV6||[http://partsregistry.org/Part:BBa_K337083 BBa_K337083]||flanked with Bsa1 sites on both ends<br />
|-<br />
|27 ||Fragment 3 of wt AAV6||[http://partsregistry.org/Part:BBa_K337084 BBa_K337084]||flanked with Bsa1 sites on both ends<br />
|-<br />
|28 ||Fragment 4 of wt AAV6||[http://partsregistry.org/Part:BBa_K337085 BBa_K337085]||flanked with Bsa1 sites on both ends<br />
|-<br />
|29 ||Fragment 5 of wt AAV6||[http://partsregistry.org/Part:BBa_K337086 BBa_K337086]||flanked with Bsa1 sites on both ends<br />
|-<br />
|30 ||Fragment 6 of wt AAV6||[http://partsregistry.org/Part:BBa_K337087 BBa_K337087]||flanked with Bsa1 sites on both ends<br />
|-<br />
|31 ||Fragment 7 of wt AAV6||[http://partsregistry.org/Part:BBa_K337088 BBa_K337088]||flanked with Bsa1 sites on both ends<br />
|-<br />
|32 ||Fragment 8 of wt AAV6||[http://partsregistry.org/Part:BBa_K337089 BBa_K337089]||flanked with Bsa1 sites on both ends<br />
|-<br />
|33 ||Fragment 1 of wt AAV8||[http://partsregistry.org/Part:BBa_K337090 BBa_K337090]||flanked with Bsa1 sites on both ends<br />
|-<br />
|34 ||Fragment 2 of wt AAV8||[http://partsregistry.org/Part:BBa_K337091 BBa_K337091]||flanked with Bsa1 sites on both ends<br />
|-<br />
|35 ||Fragment 3 of wt AAV8||[http://partsregistry.org/Part:BBa_K337092 BBa_K337092]||flanked with Bsa1 sites on both ends<br />
|-<br />
|36 ||Fragment 4 of wt AAV8||[http://partsregistry.org/Part:BBa_K337093 BBa_K337093]||flanked with Bsa1 sites on both ends<br />
|-<br />
|37 ||Fragment 5 of wt AAV8||[http://partsregistry.org/Part:BBa_K337094 BBa_K337094]||flanked with Bsa1 sites on both ends<br />
|-<br />
|38 ||Fragment 6 of wt AAV8||[http://partsregistry.org/Part:BBa_K337095 BBa_K337095]||flanked with Bsa1 sites on both ends<br />
|-<br />
|39 ||Fragment 7 of wt AAV8||[http://partsregistry.org/Part:BBa_K337096 BBa_K337096]||flanked with Bsa1 sites on both ends<br />
|-<br />
|40 ||Fragment 8 of wt AAV8||[http://partsregistry.org/Part:BBa_K337097 BBa_K337097]||flanked with Bsa1 sites on both ends<br />
|-<br />
|41 ||Fragment 1 of wt AAV9||[http://partsregistry.org/Part:BBa_K337098 BBa_K337098]||flanked with Bsa1 sites on both ends<br />
|-<br />
|42 ||Fragment 2 of wt AAV9||[http://partsregistry.org/Part:BBa_K337099 BBa_K337099]||flanked with Bsa1 sites on both ends<br />
|-<br />
|43 ||Fragment 3 of wt AAV9||[http://partsregistry.org/Part:BBa_K337100 BBa_K337100]||flanked with Bsa1 sites on both ends<br />
|-<br />
|44 ||Fragment 4 of wt AAV9||[http://partsregistry.org/Part:BBa_K33101 BBa_K33101]||flanked with Bsa1 sites on both ends<br />
|-<br />
|45 ||Fragment 5 of wt AAV9||[http://partsregistry.org/Part:BBa_K33102 BBa_K33102]||flanked with Bsa1 sites on both ends<br />
|-<br />
|46 ||Fragment 6 of wt AAV9||[http://partsregistry.org/Part:BBa_K33103 BBa_K33103]||flanked with Bsa1 sites on both ends<br />
|-<br />
|47 ||Fragment 7 of wt AAV9||[http://partsregistry.org/Part:BBa_K33104 BBa_K33104]||flanked with Bsa1 sites on both ends<br />
|-<br />
|48 ||Fragment 8 of wt AAV9||[http://partsregistry.org/Part:BBa_K33105 BBa_K33105]||flanked with Bsa1 sites on both ends<br />
|-<br />
<br />
|}<br />
</center><br />
<br />
<!-- <groupparts>iGEM010 Heidelberg</groupparts> --><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/PartsTeam:Heidelberg/Parts2010-10-27T21:57:31Z<p>Rudolf: /* ViroBytes */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|parts}}<br />
<br />
<html><br />
<script type="text/javascript"><br />
function start() {<br />
<br />
var d = document.getElementById("groupparts")<br />
<br />
d.style.width = "620px"<br />
<br />
switch (d.getElementsByTagName("thead")[0]) {<br />
<br />
case undefined:<br />
setTimeout("start()",200);<br />
break;<br />
<br />
default:<br />
formatparts();<br />
break;<br />
}<br />
}<br />
<br />
function formatparts() {<br />
<br />
var d = document.getElementById("groupparts");<br />
var dbodytr = d.getElementsByTagName("tbody")[0].getElementsByTagName("tr");<br />
var lasttd = dbodytr[0].getElementsByTagName("td").length;<br />
var designertd = lasttd - 2;<br />
var rowscount = dbodytr.length<br />
<br />
d.getElementsByTagName("thead")[0].getElementsByTagName("th")[6].style.display = "none"<br />
<br />
for (var i=0;i<rowscount;i++) {<br />
dbodytr[i].getElementsByTagName("td")[designertd].style.display ="none"<br />
}<br />
<br />
}<br />
</script><br />
</html><br />
<br />
{{:Team:Heidelberg/tables|normal=FFF|highlight=ddd}}<br />
<html><br />
<body onload="start()"><br />
</html><br />
__NOTOC__<br />
=miBricks - Parts submitted to the registry=<br />
<br><br />
<br />
The parts we submit belong to the two core aims our project: Reaching regulatory control (1) and specificity (2) of gene expression of any gene of interest in any target cell or tissue of choice. Therefore we engineered parts, that address these two aims on two different regulatory levels. <br />
<br />
First, we engineered gene therapy vectors based on synthetic adeno associated viruses (AAVs). On parts level, we provide about 50 plasmids that can be used for creating shuffled AAV libraries or even rationally designed, recombinant AAV vectors. Those parts we refer to as virobytes, are designed in a format directly applicable for the [https://2010.igem.org/Team:Heidelberg/Project/Capsid_Shuffling/ViroBytes Virobytes Assembly] protocol we develop.<br />
<br />
On RNA level we provide the [https://2010.igem.org/Team:Heidelberg/Project/miRNA_Kit miTuner toolkit] consisting of roughly 60 parts enabling gene expression control based on synthetic or cell-specific endogenous microRNAs. This toolkit consists of three main constructs: The '''pSMB_miMeasure''' binding site characterization standard and '''two pSMB_miTuner''' expression controlling plasmids. Furthermore, it contains 12 basic and 28 intermediate construction parts, synthetic, single microRNA binding sites as well as binding site patterns in BB-2 (RFC 12, Tom Knight) standard. This enables maximum flexibility for applications in many different contexts.<br />
<br />
<br />
==Main Measurement Constructs - Engineered==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K3||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337036 BBa_K337036]|| pSMB_miTuner Plasmid HD3 <br />
|-<br />
|K4||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337038 BBa_K337038]|| pSMB_miTuner Plasmid HD4<br />
|-<br />
|miM||sv40ter(rc)/eBFP(rc)/biCMV/eGFP(fw)/sv40ter(fw)||[http://partsregistry.org/Part:BBa_K337049 BBa_K337049]|| pSMB_miMeasure<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==Synthetic Single Binding Sites==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|(Physical DNA not submitted)<br />
|width=60px| Design||width=300px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|KD:97%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337052 BBa_K337052]||shRNA miRhaat<br />
|-<br />
|KD:69%||imperfect binding site: point mut 11||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337053 BBa_K337053]||shRNA miRhaat <br />
|-<br />
|KD:28%||imperfect binding site: bulge 16-18||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337054 BBa_K337054]||shRNA miRhaat <br />
|-<br />
|KD:96%||perfect binding site||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337055 BBa_K337055]||miR122 <br />
|-<br />
|KD:64%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337056 BBa_K337056]||miR122 <br />
|-<br />
|KD:24%||imperfect binding site:||[http://partsregistry.org/wiki/index.php?title=Part:BBa_K337057 BBa_K337057]||miR122 <br />
|-<br />
|}<br />
</center><br />
<br />
==synthetic microRNA binding Site patterns against endogenous miR122==<br />
<center><br />
<br />
<br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=350px|Content||width=100px|Registry link<br />
|-<br />
|1.3||hsa-miR-122 Binding site pattern (3BS)||[http://partsregistry.org/Part:BBa_K337000 BBa_K337000]<br />
|-<br />
|1A||hsa-miR-122 Binding site pattern (4BS)||[http://partsregistry.org/Part:BBa_K337003 BBa_K337003]<br />
|-<br />
|1-5||hsa-miR-122 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337004 BBa_K337004]<br />
|-<br />
|3.7||hsa-miR-122 Binding site pattern (2BS - additional 10bp Spacer)||[http://partsregistry.org/Part:BBa_K337005 BBa_K337005]<br />
|-<br />
|1.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337006 BBa_K337006]<br />
|-<br />
|1.8||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337007 BBa_K337007]<br />
|-<br />
|3.1||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337008 BBa_K337008]<br />
|-<br />
|4.5||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337009 BBa_K337009]<br />
|-<br />
|4.6||hsa-miR-122 Binding site pattern (2BS) with randomized nt9-12||[http://partsregistry.org/Part:BBa_K337010 BBa_K337010]<br />
|-<br />
|mir221-10L2||hsa-miR-221 Binding site pattern (2BS)||[http://partsregistry.org/Part:BBa_K337011 BBa_K337011]<br />
|-<br />
|}<br />
</center><br />
<br />
==miTunig Kit - Basic Parts==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=100px|Content||width=100px|Registry link|| width=300px|Comment<br />
|-<br />
|F1||RSV fw||[http://partsregistry.org/Part:BBa_K337012 BBa_K337012]||-<br />
|-<br />
|F2||SV40 rc||[http://partsregistry.org/Part:BBa_K337013 BBa_K337013]||-<br />
|-<br />
|F3||RSV rc||[http://partsregistry.org/Part:BBa_K337014 BBa_K337014]||-<br />
|-<br />
|F4||BGH fw||[http://partsregistry.org/Part:BBa_K337001 BBa_K337001]||-<br />
|-<br />
|F5||BGH rc||[http://partsregistry.org/Part:BBa_K337002 BBa_K337002]|| leads to insertion of BamHI site<br />
|-<br />
|F7||microRNA 10HD||[http://partsregistry.org/Part:BBa_K337016 BBa_K337016]|| template for creation of shRNA-like miRNA<br />
|-<br />
|F8||CMV fw||[http://partsregistry.org/Part:BBa_K337018 BBa_K337018]||-<br />
|-<br />
|F9||FRT site||[http://partsregistry.org/Part:BBa_K337019 BBa_K337019]||-<br />
|-<br />
|F10||hRluc||[http://partsregistry.org/Part:BBa_K337025 BBa_K337025]||-<br />
|-<br />
|F16||TetR||[http://partsregistry.org/Part:BBa_K337028 BBa_K337028]||-<br />
|-<br />
|F17||Luc2||[http://partsregistry.org/Part:BBa_K337030 BBa_K337030]|| compatible for insertion of microRNA binding sites<br />
|-<br />
|biCMV||biCMV||[http://partsregistry.org/Part:BBa_K337017 BBa_K337017]||-<br />
|-<br />
|}<br />
</center><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==miTuning Kit - Intermediate Parts 1==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=300px|Content||width=100px|Registry link||width=450px|Purpose of the cassette <br />
|-<br />
|F6||luc2_sv40ter||[http://partsregistry.org/Part:BBa_K337015 BBa_K337015]|| Luc2 reporter gene with terminator referring to SV40 promoter <br />
|-<br />
|F15||CMV_TetO2||[http://partsregistry.org/Part:BBa_K337027 BBa_K337027]|| CMV promoter under control of Tet Operator for regulation of gene expression<br />
|-<br />
|R1||Sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337045 BBa_K337045]||rowspan="4"| bidirectional hybrid promoter<br />
|-<br />
|R2||Sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337047 BBa_K337047]<br />
|-<br />
|R3||RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337048 BBa_K337048]<br />
|-<br />
|R4||RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337050 BBa_K337050]<br />
|-<br />
|R5||BGH(rc)/shRNA10(rc)||[http://partsregistry.org/Part:BBa_K337051 BBa_K337051]||rowspan="1"| synthetic microRNA template part<br />
|-<br />
|R13||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337020 BBa_K337020]||rowspan="7"|tuning construct cloning into reporter plasmid backbone containing a binding site against synthetic shRNA-like miRNA<br />
|-<br />
|R14||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337021 BBa_K337021] <br />
|-<br />
|R15||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337022 BBa_K337022]<br />
|-<br />
|R16||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV(fw)_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337023 BBa_K337023]<br />
|-<br />
|R17||BGH(rc)/shRNA6(rc)/sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337024 BBa_K337024]<br />
|-<br />
|R18||BGH(rc)/shRNA6(rc)/sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337026 BBa_K337026]<br />
|-<br />
|R19||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337029 BBa_K337029]<br />
|-<br />
|R20||BGH(rc)/shRNA6(rc)/RSV(rc)/CMV_TetO2(fw)||[http://partsregistry.org/Part:BBa_K337031 BBa_K337031]||tuning construct core containing Tet Operator for On-Targeting together with repressor construct<br />
|-<br />
|R21||Luc2(rc)_sv40(rc)/CMV(fw)||[http://partsregistry.org/Part:BBa_K337033 BBa_K337033]||rowspan="2"| bidirectional hybrid promoter with Luc2 reference gene under control of SV40 promoter<br />
|-<br />
|R22||Luc2(rc)_sv40(rc)/RSV(fw)||[http://partsregistry.org/Part:BBa_K337034 BBa_K337034]<br />
|-<br />
|R32||Kozag_hRluc/BGH(fw)||[http://partsregistry.org/Part:BBa_K337037 BBa_K337037]||reference reporter<br />
|-<br />
|R33||TetR_mut(XhoI/XbaI)||[http://partsregistry.org/Part:BBa_K337039 BBa_K337039]||mutagenized TetR including cutting sites to paste miRNA binding sites<br />
|-<br />
|T1||BGH(rc)_CMV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337041 BBa_K337041]||rowspan="2"|repressor construct for On-Targeting together with tuning construct<br />
|-<br />
|T2||BGH(rc)_RSV/TetR/BGH(fw)/BGH(rc)||[http://partsregistry.org/Part:BBa_K337043 BBa_K337043]<br />
|-<br />
|}<br />
</center><br />
<br />
<br />
==Tuning Kit - Intermediate Parts 2==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=600px|Content||width=100px|Registry link||width=100px|Name <br />
|-<br />
|K1||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337032 BBa_K337032]|| pSMB_miTuner Plasmid HD1 <br />
|-<br />
|K2||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/Luc2_sv40/CMV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337035 BBa_K337035]|| pSMB_miTuner Plasmid HD2 <br />
<br />
|-<br />
|K5||BGH(rc)/shRNA10(rc)/sv40(rc)/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337040 BBa_K337040]|| pSMB_miTuner Plasmid HD5 <br />
|-<br />
|K6||BGH(rc)/shRNA10(rc)/sv40(rc)/CMV/RSV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337042 BBa_K337042]|| pSMB_miTuner Plasmid HD6 <br />
|-<br />
|K7||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337044 BBa_K337044]|| pSMB_miTuner Plasmid HD7 <br />
|-<br />
|K8||BGH(rc)/shRNA10(rc)/RSV(rc)/CMV_TetO2/Luc2_sv40/RSV/Kozag_hRluc_BGH||[http://partsregistry.org/Part:BBa_K337046 BBa_K337046]|| pSMB_miTuner Plasmid HD8 <br />
|-<br />
|}<br />
</center><br />
<br />
==ViroBytes==<br />
<center><br />
{| class="wikitable sortable" border="0" style="text-align: left"<br />
|-bgcolor=#cccccc<br />
|+ align="top, left"|<br />
|width=40px| ID||width=150px|Part name||width=100px|Registry link||width=300px|Description<br />
|-<br />
|1||Fragment 1 of wt AAV1||[http://partsregistry.org/Part:BBa_K337058 BBa_K337058]||flanked with Bsa1 sites on both ends<br />
|-<br />
|2 ||Fragment 2 of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
|3 ||Fragment 3 of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
|4 ||Fragment 4 of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
|5 ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
|6 ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
|7 ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
|8 ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
|9 ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
|10 ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
|11 ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
| ||Fragment of wt AAV||[http://partsregistry.org/Part:BBa_K3370 BBa_K3370]||flanked with Bsa1 sites on both ends<br />
|-<br />
<br />
|}<br />
</center><br />
<br />
<!-- <groupparts>iGEM010 Heidelberg</groupparts> --><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/miMeasureTeam:Heidelberg/Project/miMeasure2010-10-27T21:57:19Z<p>Rudolf: /* Abstract */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|pro_miMeasure}}<br />
__NOTOC__<br />
{{:Team:Heidelberg/Side_Top}}<br />
[[Image:MiMeasure.png|frameless|250px|miMeasure Plasmid]]<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
=miMeasure=<br />
==Abstract==<br />
<br />
Recent advances in gene therapy approaches have seen rising importance of small RNA molecules. The identification and characterization of miRNAs and their respective binding sites are therefore becoming crucial for innovative applications. In order to exploit the miRNA ability to target and regulate specific genes, we constructed a measurement standard not only able to characterize existing miRNAs but also to validate potential synthetic miRNAs for new therapeutic approaches. The synthetic miRNAs we have created are inert to endogenous targets and thus applicable for gene regulation without direct side effects. This opens new possibilities for precise gene expression tuning, especially in quantitative means. <br />
Our [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miMeasure] construct plasmid (see sidebar) normalizes knockdown of the green fluorescent protein (EGFP) to the blue fluorescent protein (EBFP2). This allows for an accurate study of binding site properties, since both fluorescent proteins are combined in the same construct and driven by the same [http://partsregistry.org/Part:BBa_K337017 bidirectional promoter]. Another advantage is that any desired binding site can be cloned easily into the miMeasure plasmid with the [http://dspace.mit.edu/handle/1721.1/45139 BB-2 standard]. As the binding site is inserted downstream of EGFP, the regulation of EGFP expression is to be expected. <br />
The knockdown percentage of each modified binding site can be calculated by the ratio of EGFP to EBFP2. The ratio is obtained from linear regression analysis and therefore the knock-down efficiency can be determined by various basic methods e.g. plate reading, flow cytometry or [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==Introduction==<br />
Micro RNAs regulate mainly the translation of their target genes by preferably interacting with regions in the 3’ untranslated region (UTR) of their target mRNA. Base-pairing with the miRNA binding site (BS) causes formation of diverse miRNA-mRNA duplexes {{HDref|reviewed by Fabian et al., 2010}}. The BS consists of a seven nucleotide long seed region that is perfectly matched to the miRNA, and surrounding regions that matched partially. The seed region is defined as being the minimal required base-pairing that can regulate the mRNA. Apart from the seed region, binding can be unspecific, creating mismatches and bulges. The position and properties of the bulges seem to play a central role in miRNA binding and therefore knockdown efficiency {{HDref|reviewed by Bartel et al., 2009}}. Since we were going to use synthetic miRNA BS in our genetherapeutic approach, we had to find a way to study their effects in a standardized manner that would be comparable and reproducible. <br />
One goal of the iGEM Team Heidelberg 2010 was to test the effects of changes in BS sequences on expression control. Thereby miRNA BS should be characterized. To standardize our measurements of knockdown according to BS specificity, we had to come up with a new standard that is independent from the endogenous cell machinery. We decided to bring synthetic miRNAs into play, hence we engineered BS for them creating an artificial regulatory circuit<!--, simulating naturally occurring miRNAs and miRNA BS without having to worry about the effect of endogenous targets-->. Of course there are also differences that arise through the availability of the enzymes involved in the miRNA pathway that may differ slightly from cell to cell. Therefore, we also measured the knockdown achieved by the perfect binding site and set this as 100% knockdown efficiency. Ideally, the miRNA would be stably expressed in the cell line, but a uniform co-transfection also leads to an even distribution of synthetic shRNA-like miRNAs (shRNA miRs). Additionally, miRNA levels can be adjusted by differing transfection ratios. <br />
The main purpose of our measurement standard, miMeasure, is to express two nearly identical but discernible proteins: one of them tagged with a BS, the other one unregulated (even though the possibility exists to clone in a reference binding site). The two reporters are expressed by a bidirectional CMV promoter to make sure their transcription rate is comparable. We used a destabilized version of GFP, dsEGFP and a dsEBFP2 that was derived from the same sequence ([https://2010.igem.org/Team:Heidelberg/Project/miMeasure#References Ai et al., 2007]). Thus, we could make sure that both proteins exhibit the same synthesis and degradation properties, making them directly comparable. Hereby, we can also neglect the difference between mRNA and protein knockdown and can take the fluorescence of the marker protein as a direct, linear output of mRNA down-regulation. We included a BBb standard site into our plasmid, which allows to clone BS behind the GFP. If co-transfected with the corresponding shRNA miR, GFP will be down-regulated, while BFP expression is maintained. The ratio of GFP to BFP expression can be used to conclude the knockdown efficiency (in percent, compared to perfect binding site=100% and no binding site=0%) of the BS. Having destabilized marker proteins with a turnover time of two hours enables us not only to avoid accumulation of marker proteins, which would make the knockdown harder to observe, but also to conduct time-lapse experiments. In the future, this could be for example a way to observe dynamic activity patterns of endogenous miRNAs.<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
<br />
<br />
===Analysis of Randomized Binding Sites Against Synthetic miRNA===<br />
<br />
====Confocal microscopy measurements====<br />
<br />
We used microscopy analysis to determine the EGFP expression in relation to EBFP2. EBFP2 serves as a normalization for transfection efficiency. Nine miMeasure constructs with different binding sites were designed. Those were cloned downstream of EGFP behind the miMeasure construct, whereas the EBFP2 expression stays unaffected. The GFP/BFP-ratio stand for the level of GFP-expression normalized to one copy per cell. We modified binding sites for the synthetic miRNA by introducing random basepairs surrounding the seed region as described above, thereby changing the knockdown efficiency. In figure 1 we plotted the knockdown percentage of our constructs. The miMeasure construct and negative control were [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection co-transfected] with either shRNA miRsAg expressed from a CMV promoter on pcDNA5 or an inert synthetic RNA as control in 1:4 ratio, respectively. <br />
<br />
[[Image:M12-M22_HeLa_daten.jpg|thumb|500px|center|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs M12-M22 including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Used Binding Sites and Their Features'''<br />
|sequence||binding site feature||Name<br />
|-<br />
|ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS<br />
|-<br />
|ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| 10-12 ACG<br />
|-<br />
|ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA<br />
|-<br />
|ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ACGG<br />
|-<br />
|ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ATGT<br />
|-<br />
|ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10 G<br />
|-<br />
|ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10 A<br />
|-<br />
|ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11 A<br />
|-<br />
|ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18 ATG<br />
|-<br />
|-||miMeasure without any binding site||NC (negative control)<br />
|-<br />
|}<br />
<br />
<br />
Comparing the GFP/BFP-ratio between the constructs, we can see a significant difference of GFP expression between the negative control and the construct containing the perfect binding site. Since the control is not downregulated due to lack of binding sites, we set it as 100% expression on this chart. It can be seen that the perfect binding sites causes the lowest GFP expression, approximately 50%, while other binding sites range in between 55% and 100% of expression. <br />
<br />
<!--discussion?The seed region is altered in M22. Since the seed region is considered the most important site for knock-down efficiency, its change diminishes the knock-down capability of the binding site completely. So the GFP expression in this case is as high as the negative control, where no binding site was inserted into the miMeasure plasmid. --><br />
<br />
<br />
<!--[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection Transfection] with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 4 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.<br />
<br />
Condition '''a''': cotransfection with stuffer (salmon sperm DNA) <br />
<br />
Condition '''b''': cotransfection with synthetic RNA miRsAg <br />
<br />
Condition '''c''': cotransfection with empty pcDNA5<br />
<br />
Condition '''d''': cotransfection with synthetic shRNA3<br />
<br />
A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d. The cells were used for measurements on day three.--><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
====Flow cytometry measurements====<br />
<br />
Hela cells transfected with the constructs (described above) are also taken for flow cytometry. Each measuremnet contains 10000 cells. The cells are plotted on a logarithmic scale in relation to EGFP and EBFP2 intensity. Each dot represents one fluorescent cell. The dots are colour coded, so that the orange dots represent cells cotransfected with different miMeasure constructs and the miRsAg and the blue one represent cells cotransfected with non-specific miRNA (miR-155), respectively. So the blue set of measurements represent the negative control. Both population of dots make up a line on the logarithmic scale, which shows the correlation of EGFP and EBFP2 very well. The cotransfection with miR-155 is therefore the negative control. If the two different coloured dots overlap, they become white. Thus both lines overlap almost completely in the negative control, whereas the orange line shifts to the left for the miMeasure construct with the perfect binding site. All the other constructs are like the negative control.<br />
Both coloured lines are more scattered on the linear scale, although the shifting of the orange dots are more visible for the construct containing the perfect binding site. All the other constructs have the same range of scattering as the negative control. <br />
<br />
[[Image:Flow1.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a logarithmic scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]^<br />
<br />
[[Image:Flow-linear-result.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a linear scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of miRaPCR Generated Binding Sites Against a Natural miRNA===<br />
<br />
<br />
<br />
The [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July miRaPCR] generates binding sites out of rationally designed fragments. These are aligned with each other by chance, whereby different spacer regions are inserted randomly in between. It has been suggested that having more than one binding site of for the same miRNA behind each other can lead to stronger down-regulation than a single one. If imperfect binding sites are aligned, it is also supposed to be stronger than a single one. This is what we tested using MiRaPCR for effortless assembly of binding site fragments.<br />
For our experiments, we took advantage of the high abundance of miRNA 122 in liver cells and tested different combinations of binding sites created by miRaPCR. We transfected HeLa and HuH7 cells with the constructs described in table 2. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells in 2:1 ratio. The result shows the ratio between GFP and BFP normalized to the negative control (miMeasure constructs without binding sites). The miMeasure constructs were also compared to the expression of miMeasure containing one perfect binding site for miRNA 122.<br />
<br />
The transfected HeLa are also imaged with the epifluorescent microscope. Large amount of cells in the negative control (miMeasure with perfect binding site cotransfected with miR-155, see a)are green, whereas most cells with the miMeasure construct containing the perfect binding sites (see b) are blue. <br />
<br />
[[Image:BLUE+green.jpg|thumb|600px|center|'''epifluorescent microscopy image (10x) of Hela cells transfected with miMeasure''' miMeasure with a perfect binding site is a) cotransfected with miR-155, which has no specificity to miR-122, b) cotransfected with miR-122, which is complementary to the perfect binding site. EGFP is regulated by miR-122, EBFP2 is unregulated and serves as transfection control.]]<br />
<br />
<br />
The image analysis of confocal microscopy gives the following results:<br />
<br />
[[Image:MiMeasure_miR122.jpg|thumb|500px|center|''' different binding sites for miR122, HeLa cotransfected with miR122 expression plasmid''']]<br />
<br />
<br />
The EGFP-expression normalized to the EGFB2 expression is set to 100% for the miMeasure construct transfected with the non-matching miRNA (in this case miR-155). The knock-down efficiency of one perfect binding site is around 30%, which also accounts for the three aligned perfect binding sites and the two aligned imperfect ones. The binding site with bulges from position 9-12 and 9-22 don't show any knock-down. <br />
<br />
<br />
[[Image:MiMeasure_miR122b.jpg|thumb|500px|left|''' different binding sites for miR122, Huh7 cells''']]<br />
<br />
<br />
<br />
<br />
<!--Discussion This experiment shows, that the binding site pattern with 3 aligned perfect binding sites miM-1.3-7 gives the strongest knock-down. Whereby the binding site pattern with two imperfect binding sites 1-8 is weaker, but still stronger than the negative control. If one binding site is randomized from nucleotide 9-12 or 9-22 miM-r12, miM-r22, it loses its capability of protein down-regulation.--><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, right"|'''Table2: miRaPCR Designed Binding Sites and Their Features<br />
|binding site feature'''||Name/number<br />
|-<br />
|miMeasure with 3 aligned perfect binding sites||miM-1.3-7<br />
|-<br />
|miMeasure with two imperfect binding sites||miM-3.1-8<br />
|-<br />
|miMeasure with randomised nucleotides 9-12||miM-r12<br />
|-<br />
|miMeasure with randomised nucleotides 9-22||miM-r22<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The Huh7 cells were also transfected with the 4 different constructs. Here a cotransfection with miR-122 is not necessary, since Huh7 cells express miR-122 themselves. The knock-down of the perfect binding sites are stronger than the knock-down in the Hela cells. Here the knock-down efficiency is 80% for the perfect binding site and the aligned constructs. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
====Flow cytometry====<br />
<br />
<br />
The same constructs in Hela cells were analyzed by flow cytometry, too. Here the orange dots also represent the miMeasure construct transfected with the specific miRNA and the blue dots make up the negative control. The orange dots from the construct containing the perfect and the aligned binding sites have lower EGFP expression compared to EBFP2 expression, since the EGFP trend doesn't correspond to the EBFP2 trend, but shifts to the laft. The orange dots rise with the fluorescence intensity and collapses to zero, when the EBFP2 intensity is high. For the other constructs the EGFP range fully corresponds with the EBFP2 range. <br />
The linear plot shows the orange and blue dots in more distinct lines. The orange dots from the construct containing the perfect and aligned binding sites assemble along the y-axis, where the EGFP fluorescence intensity is zero. For the other construct the EGFP line fully overlap with the EBFP2. <br />
<br />
<br />
[[Image:Flow_miR122.jpg|thumb|620px|center|'''EGFP2/EBFP correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
[[Image:Flow_miR122_linear.jpg|thumb|620px|center|'''EGFP/EBFP2 correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of endogenous miRNA===<br />
<br />
HepG2, another liver cell line, is also transfected with the constructs containing the perfect and the aligned constructs for miR-122. The cotransfection with miR-155 serves again as a negative control. For this cell line there was only a slight knock-down observed for all of the constructs, it is much less compared to the HuH7 cell line, where the knock-down ranges from 20-40%. <br />
The EGFP/EBFP2 ratio from each transfected HuH7 cell is calculated for 52 cells. The cells were transfected with the construct carriying the three aligned perfect binding sites against miR-122. The EGFP/EBFP2 ratio in each cell is different and ranges from 0.1 to 6.<br />
<br />
==Discussion==<br />
<br />
==Methods==<br />
<br />
The fluorescence of GFP and BFP can be compared using different methods, for example automated fluorescence plate reader systems, [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Flow_cytometry flow cytometry] or manual and automated fluorescence [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==References==<br />
<br />
Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry. 2007 May 22;46(20):5904-10.<br />
<br />
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009 Jan 23;136(2):215-33.<br />
<br />
Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 2010;79:351-79.<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/miMeasureTeam:Heidelberg/Project/miMeasure2010-10-27T21:56:45Z<p>Rudolf: /* Abstract */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|pro_miMeasure}}<br />
__NOTOC__<br />
{{:Team:Heidelberg/Side_Top}}<br />
[[Image:MiMeasure.png|frameless|250px|miMeasure Plasmid]]<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
=miMeasure=<br />
==Abstract==<br />
<br />
Recent advances in gene therapy approaches have seen a rising importance of small RNA molecules. The identification and characterization of miRNAs and their respective binding sites are therefore becoming crucial for innovative applications. In order to exploit the miRNA ability to target and regulate specific genes, we constructed a measurement standard not only able to characterize existing miRNAs but also to validate potential synthetic miRNAs for new therapeutic approaches. The synthetic miRNAs we have created are inert to endogenous targets and thus applicable for gene regulation without direct side effects. This opens new possibilities for precise gene expression tuning, especially in quantitative means. <br />
Our [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miMeasure] construct plasmid (see sidebar) normalizes knockdown of the green fluorescent protein (EGFP) to the blue fluorescent protein (EBFP2). This allows for an accurate study of binding site properties, since both fluorescent proteins are combined in the same construct and driven by the same [http://partsregistry.org/Part:BBa_K337017 bidirectional promoter]. Another advantage is that any desired binding site can be cloned easily into the miMeasure plasmid with the [http://dspace.mit.edu/handle/1721.1/45139 BB-2 standard]. As the binding site is inserted downstream of EGFP, the regulation of EGFP expression is to be expected. <br />
The knockdown percentage of each modified binding site can be calculated by the ratio of EGFP to EBFP2. The ratio is obtained from linear regression analysis and therefore the knock-down efficiency can be determined by various basic methods e.g. plate reading, flow cytometry or [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==Introduction==<br />
Micro RNAs regulate mainly the translation of their target genes by preferably interacting with regions in the 3’ untranslated region (UTR) of their target mRNA. Base-pairing with the miRNA binding site (BS) causes formation of diverse miRNA-mRNA duplexes {{HDref|reviewed by Fabian et al., 2010}}. The BS consists of a seven nucleotide long seed region that is perfectly matched to the miRNA, and surrounding regions that matched partially. The seed region is defined as being the minimal required base-pairing that can regulate the mRNA. Apart from the seed region, binding can be unspecific, creating mismatches and bulges. The position and properties of the bulges seem to play a central role in miRNA binding and therefore knockdown efficiency {{HDref|reviewed by Bartel et al., 2009}}. Since we were going to use synthetic miRNA BS in our genetherapeutic approach, we had to find a way to study their effects in a standardized manner that would be comparable and reproducible. <br />
One goal of the iGEM Team Heidelberg 2010 was to test the effects of changes in BS sequences on expression control. Thereby miRNA BS should be characterized. To standardize our measurements of knockdown according to BS specificity, we had to come up with a new standard that is independent from the endogenous cell machinery. We decided to bring synthetic miRNAs into play, hence we engineered BS for them creating an artificial regulatory circuit<!--, simulating naturally occurring miRNAs and miRNA BS without having to worry about the effect of endogenous targets-->. Of course there are also differences that arise through the availability of the enzymes involved in the miRNA pathway that may differ slightly from cell to cell. Therefore, we also measured the knockdown achieved by the perfect binding site and set this as 100% knockdown efficiency. Ideally, the miRNA would be stably expressed in the cell line, but a uniform co-transfection also leads to an even distribution of synthetic shRNA-like miRNAs (shRNA miRs). Additionally, miRNA levels can be adjusted by differing transfection ratios. <br />
The main purpose of our measurement standard, miMeasure, is to express two nearly identical but discernible proteins: one of them tagged with a BS, the other one unregulated (even though the possibility exists to clone in a reference binding site). The two reporters are expressed by a bidirectional CMV promoter to make sure their transcription rate is comparable. We used a destabilized version of GFP, dsEGFP and a dsEBFP2 that was derived from the same sequence ([https://2010.igem.org/Team:Heidelberg/Project/miMeasure#References Ai et al., 2007]). Thus, we could make sure that both proteins exhibit the same synthesis and degradation properties, making them directly comparable. Hereby, we can also neglect the difference between mRNA and protein knockdown and can take the fluorescence of the marker protein as a direct, linear output of mRNA down-regulation. We included a BBb standard site into our plasmid, which allows to clone BS behind the GFP. If co-transfected with the corresponding shRNA miR, GFP will be down-regulated, while BFP expression is maintained. The ratio of GFP to BFP expression can be used to conclude the knockdown efficiency (in percent, compared to perfect binding site=100% and no binding site=0%) of the BS. Having destabilized marker proteins with a turnover time of two hours enables us not only to avoid accumulation of marker proteins, which would make the knockdown harder to observe, but also to conduct time-lapse experiments. In the future, this could be for example a way to observe dynamic activity patterns of endogenous miRNAs.<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
<br />
<br />
===Analysis of Randomized Binding Sites Against Synthetic miRNA===<br />
<br />
====Confocal microscopy measurements====<br />
<br />
We used microscopy analysis to determine the EGFP expression in relation to EBFP2. EBFP2 serves as a normalization for transfection efficiency. Nine miMeasure constructs with different binding sites were designed. Those were cloned downstream of EGFP behind the miMeasure construct, whereas the EBFP2 expression stays unaffected. The GFP/BFP-ratio stand for the level of GFP-expression normalized to one copy per cell. We modified binding sites for the synthetic miRNA by introducing random basepairs surrounding the seed region as described above, thereby changing the knockdown efficiency. In figure 1 we plotted the knockdown percentage of our constructs. The miMeasure construct and negative control were [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection co-transfected] with either shRNA miRsAg expressed from a CMV promoter on pcDNA5 or an inert synthetic RNA as control in 1:4 ratio, respectively. <br />
<br />
[[Image:M12-M22_HeLa_daten.jpg|thumb|500px|center|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs M12-M22 including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Used Binding Sites and Their Features'''<br />
|sequence||binding site feature||Name<br />
|-<br />
|ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS<br />
|-<br />
|ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| 10-12 ACG<br />
|-<br />
|ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA<br />
|-<br />
|ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ACGG<br />
|-<br />
|ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ATGT<br />
|-<br />
|ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10 G<br />
|-<br />
|ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10 A<br />
|-<br />
|ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11 A<br />
|-<br />
|ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18 ATG<br />
|-<br />
|-||miMeasure without any binding site||NC (negative control)<br />
|-<br />
|}<br />
<br />
<br />
Comparing the GFP/BFP-ratio between the constructs, we can see a significant difference of GFP expression between the negative control and the construct containing the perfect binding site. Since the control is not downregulated due to lack of binding sites, we set it as 100% expression on this chart. It can be seen that the perfect binding sites causes the lowest GFP expression, approximately 50%, while other binding sites range in between 55% and 100% of expression. <br />
<br />
<!--discussion?The seed region is altered in M22. Since the seed region is considered the most important site for knock-down efficiency, its change diminishes the knock-down capability of the binding site completely. So the GFP expression in this case is as high as the negative control, where no binding site was inserted into the miMeasure plasmid. --><br />
<br />
<br />
<!--[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection Transfection] with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 4 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.<br />
<br />
Condition '''a''': cotransfection with stuffer (salmon sperm DNA) <br />
<br />
Condition '''b''': cotransfection with synthetic RNA miRsAg <br />
<br />
Condition '''c''': cotransfection with empty pcDNA5<br />
<br />
Condition '''d''': cotransfection with synthetic shRNA3<br />
<br />
A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d. The cells were used for measurements on day three.--><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
====Flow cytometry measurements====<br />
<br />
Hela cells transfected with the constructs (described above) are also taken for flow cytometry. Each measuremnet contains 10000 cells. The cells are plotted on a logarithmic scale in relation to EGFP and EBFP2 intensity. Each dot represents one fluorescent cell. The dots are colour coded, so that the orange dots represent cells cotransfected with different miMeasure constructs and the miRsAg and the blue one represent cells cotransfected with non-specific miRNA (miR-155), respectively. So the blue set of measurements represent the negative control. Both population of dots make up a line on the logarithmic scale, which shows the correlation of EGFP and EBFP2 very well. The cotransfection with miR-155 is therefore the negative control. If the two different coloured dots overlap, they become white. Thus both lines overlap almost completely in the negative control, whereas the orange line shifts to the left for the miMeasure construct with the perfect binding site. All the other constructs are like the negative control.<br />
Both coloured lines are more scattered on the linear scale, although the shifting of the orange dots are more visible for the construct containing the perfect binding site. All the other constructs have the same range of scattering as the negative control. <br />
<br />
[[Image:Flow1.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a logarithmic scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]^<br />
<br />
[[Image:Flow-linear-result.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a linear scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of miRaPCR Generated Binding Sites Against a Natural miRNA===<br />
<br />
<br />
<br />
The [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July miRaPCR] generates binding sites out of rationally designed fragments. These are aligned with each other by chance, whereby different spacer regions are inserted randomly in between. It has been suggested that having more than one binding site of for the same miRNA behind each other can lead to stronger down-regulation than a single one. If imperfect binding sites are aligned, it is also supposed to be stronger than a single one. This is what we tested using MiRaPCR for effortless assembly of binding site fragments.<br />
For our experiments, we took advantage of the high abundance of miRNA 122 in liver cells and tested different combinations of binding sites created by miRaPCR. We transfected HeLa and HuH7 cells with the constructs described in table 2. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells in 2:1 ratio. The result shows the ratio between GFP and BFP normalized to the negative control (miMeasure constructs without binding sites). The miMeasure constructs were also compared to the expression of miMeasure containing one perfect binding site for miRNA 122.<br />
<br />
The transfected HeLa are also imaged with the epifluorescent microscope. Large amount of cells in the negative control (miMeasure with perfect binding site cotransfected with miR-155, see a)are green, whereas most cells with the miMeasure construct containing the perfect binding sites (see b) are blue. <br />
<br />
[[Image:BLUE+green.jpg|thumb|600px|center|'''epifluorescent microscopy image (10x) of Hela cells transfected with miMeasure''' miMeasure with a perfect binding site is a) cotransfected with miR-155, which has no specificity to miR-122, b) cotransfected with miR-122, which is complementary to the perfect binding site. EGFP is regulated by miR-122, EBFP2 is unregulated and serves as transfection control.]]<br />
<br />
<br />
The image analysis of confocal microscopy gives the following results:<br />
<br />
[[Image:MiMeasure_miR122.jpg|thumb|500px|center|''' different binding sites for miR122, HeLa cotransfected with miR122 expression plasmid''']]<br />
<br />
<br />
The EGFP-expression normalized to the EGFB2 expression is set to 100% for the miMeasure construct transfected with the non-matching miRNA (in this case miR-155). The knock-down efficiency of one perfect binding site is around 30%, which also accounts for the three aligned perfect binding sites and the two aligned imperfect ones. The binding site with bulges from position 9-12 and 9-22 don't show any knock-down. <br />
<br />
<br />
[[Image:MiMeasure_miR122b.jpg|thumb|500px|left|''' different binding sites for miR122, Huh7 cells''']]<br />
<br />
<br />
<br />
<br />
<!--Discussion This experiment shows, that the binding site pattern with 3 aligned perfect binding sites miM-1.3-7 gives the strongest knock-down. Whereby the binding site pattern with two imperfect binding sites 1-8 is weaker, but still stronger than the negative control. If one binding site is randomized from nucleotide 9-12 or 9-22 miM-r12, miM-r22, it loses its capability of protein down-regulation.--><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, right"|'''Table2: miRaPCR Designed Binding Sites and Their Features<br />
|binding site feature'''||Name/number<br />
|-<br />
|miMeasure with 3 aligned perfect binding sites||miM-1.3-7<br />
|-<br />
|miMeasure with two imperfect binding sites||miM-3.1-8<br />
|-<br />
|miMeasure with randomised nucleotides 9-12||miM-r12<br />
|-<br />
|miMeasure with randomised nucleotides 9-22||miM-r22<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The Huh7 cells were also transfected with the 4 different constructs. Here a cotransfection with miR-122 is not necessary, since Huh7 cells express miR-122 themselves. The knock-down of the perfect binding sites are stronger than the knock-down in the Hela cells. Here the knock-down efficiency is 80% for the perfect binding site and the aligned constructs. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
====Flow cytometry====<br />
<br />
<br />
The same constructs in Hela cells were analyzed by flow cytometry, too. Here the orange dots also represent the miMeasure construct transfected with the specific miRNA and the blue dots make up the negative control. The orange dots from the construct containing the perfect and the aligned binding sites have lower EGFP expression compared to EBFP2 expression, since the EGFP trend doesn't correspond to the EBFP2 trend, but shifts to the laft. The orange dots rise with the fluorescence intensity and collapses to zero, when the EBFP2 intensity is high. For the other constructs the EGFP range fully corresponds with the EBFP2 range. <br />
The linear plot shows the orange and blue dots in more distinct lines. The orange dots from the construct containing the perfect and aligned binding sites assemble along the y-axis, where the EGFP fluorescence intensity is zero. For the other construct the EGFP line fully overlap with the EBFP2. <br />
<br />
<br />
[[Image:Flow_miR122.jpg|thumb|620px|center|'''EGFP2/EBFP correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
[[Image:Flow_miR122_linear.jpg|thumb|620px|center|'''EGFP/EBFP2 correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of endogenous miRNA===<br />
<br />
HepG2, another liver cell line, is also transfected with the constructs containing the perfect and the aligned constructs for miR-122. The cotransfection with miR-155 serves again as a negative control. For this cell line there was only a slight knock-down observed for all of the constructs, it is much less compared to the HuH7 cell line, where the knock-down ranges from 20-40%. <br />
The EGFP/EBFP2 ratio from each transfected HuH7 cell is calculated for 52 cells. The cells were transfected with the construct carriying the three aligned perfect binding sites against miR-122. The EGFP/EBFP2 ratio in each cell is different and ranges from 0.1 to 6.<br />
<br />
==Discussion==<br />
<br />
==Methods==<br />
<br />
The fluorescence of GFP and BFP can be compared using different methods, for example automated fluorescence plate reader systems, [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Flow_cytometry flow cytometry] or manual and automated fluorescence [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==References==<br />
<br />
Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry. 2007 May 22;46(20):5904-10.<br />
<br />
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009 Jan 23;136(2):215-33.<br />
<br />
Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 2010;79:351-79.<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolfhttp://2010.igem.org/Team:Heidelberg/Project/miMeasureTeam:Heidelberg/Project/miMeasure2010-10-27T21:44:38Z<p>Rudolf: /* Abstract */</p>
<hr />
<div>{{:Team:Heidelberg/Single}}<br />
{{:Team:Heidelberg/Single_Pagetop|pro_miMeasure}}<br />
__NOTOC__<br />
{{:Team:Heidelberg/Side_Top}}<br />
[[Image:MiMeasure.png|frameless|250px|miMeasure Plasmid]]<br />
{{:Team:Heidelberg/Side_Bottom}}<br />
=miMeasure=<br />
==Abstract==<br />
<br />
Rising importance of small RNA molecules in gene therapy calls for the identification and characterization of miRNAs and their binding sites which are crucial for innovative applications. In order to exploit the miRNA ability to target and regulate specific genes, we constructed a measurement standard not only able to characterize existing miRNAs but also to validate potential synthetic miRNAs for new therapeutic approaches. The synthetic miRNAs we have created are inert to endogenous targets and thus applicable for gene regulation without direct side effects. This opens new possibilities for precise gene expression tuning, especially in quantitative means. <br />
Our [https://2010.igem.org/Team:Heidelberg/Parts#final_constructs miMeasure] construct plasmid (see sidebar) normalizes knockdown of the green fluorescent protein (EGFP) to the blue fluorescent protein (EBFP2). This allows for an accurate study of binding site properties, since both fluorescent proteins are combined in the same construct and driven by the same [http://partsregistry.org/Part:BBa_K337017 bidirectional promoter]. Another advantage is that any desired binding site can be cloned easily into the miMeasure plasmid with the [http://dspace.mit.edu/handle/1721.1/45139 BB-2 standard]. As the binding site is inserted downstream of EGFP, the regulation of EGFP expression is to be expected. <br />
The knockdown percentage of each modified binding site can be calculated by the ratio of EGFP to EBFP2. The ratio is obtained from linear regression analysis and therefore the knock-down efficiency can be determined by various basic methods e.g. plate reading, flow cytometry or [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==Introduction==<br />
Micro RNAs regulate mainly the translation of their target genes by preferably interacting with regions in the 3’ untranslated region (UTR) of their target mRNA. Base-pairing with the miRNA binding site (BS) causes formation of diverse miRNA-mRNA duplexes {{HDref|reviewed by Fabian et al., 2010}}. The BS consists of a seven nucleotide long seed region that is perfectly matched to the miRNA, and surrounding regions that matched partially. The seed region is defined as being the minimal required base-pairing that can regulate the mRNA. Apart from the seed region, binding can be unspecific, creating mismatches and bulges. The position and properties of the bulges seem to play a central role in miRNA binding and therefore knockdown efficiency {{HDref|reviewed by Bartel et al., 2009}}. Since we were going to use synthetic miRNA BS in our genetherapeutic approach, we had to find a way to study their effects in a standardized manner that would be comparable and reproducible. <br />
One goal of the iGEM Team Heidelberg 2010 was to test the effects of changes in BS sequences on expression control. Thereby miRNA BS should be characterized. To standardize our measurements of knockdown according to BS specificity, we had to come up with a new standard that is independent from the endogenous cell machinery. We decided to bring synthetic miRNAs into play, hence we engineered BS for them creating an artificial regulatory circuit<!--, simulating naturally occurring miRNAs and miRNA BS without having to worry about the effect of endogenous targets-->. Of course there are also differences that arise through the availability of the enzymes involved in the miRNA pathway that may differ slightly from cell to cell. Therefore, we also measured the knockdown achieved by the perfect binding site and set this as 100% knockdown efficiency. Ideally, the miRNA would be stably expressed in the cell line, but a uniform co-transfection also leads to an even distribution of synthetic shRNA-like miRNAs (shRNA miRs). Additionally, miRNA levels can be adjusted by differing transfection ratios. <br />
The main purpose of our measurement standard, miMeasure, is to express two nearly identical but discernible proteins: one of them tagged with a BS, the other one unregulated (even though the possibility exists to clone in a reference binding site). The two reporters are expressed by a bidirectional CMV promoter to make sure their transcription rate is comparable. We used a destabilized version of GFP, dsEGFP and a dsEBFP2 that was derived from the same sequence ([https://2010.igem.org/Team:Heidelberg/Project/miMeasure#References Ai et al., 2007]). Thus, we could make sure that both proteins exhibit the same synthesis and degradation properties, making them directly comparable. Hereby, we can also neglect the difference between mRNA and protein knockdown and can take the fluorescence of the marker protein as a direct, linear output of mRNA down-regulation. We included a BBb standard site into our plasmid, which allows to clone BS behind the GFP. If co-transfected with the corresponding shRNA miR, GFP will be down-regulated, while BFP expression is maintained. The ratio of GFP to BFP expression can be used to conclude the knockdown efficiency (in percent, compared to perfect binding site=100% and no binding site=0%) of the BS. Having destabilized marker proteins with a turnover time of two hours enables us not only to avoid accumulation of marker proteins, which would make the knockdown harder to observe, but also to conduct time-lapse experiments. In the future, this could be for example a way to observe dynamic activity patterns of endogenous miRNAs.<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
==Results==<br />
<br />
<br />
<br />
===Analysis of Randomized Binding Sites Against Synthetic miRNA===<br />
<br />
====Confocal microscopy measurements====<br />
<br />
We used microscopy analysis to determine the EGFP expression in relation to EBFP2. EBFP2 serves as a normalization for transfection efficiency. Nine miMeasure constructs with different binding sites were designed. Those were cloned downstream of EGFP behind the miMeasure construct, whereas the EBFP2 expression stays unaffected. The GFP/BFP-ratio stand for the level of GFP-expression normalized to one copy per cell. We modified binding sites for the synthetic miRNA by introducing random basepairs surrounding the seed region as described above, thereby changing the knockdown efficiency. In figure 1 we plotted the knockdown percentage of our constructs. The miMeasure construct and negative control were [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection co-transfected] with either shRNA miRsAg expressed from a CMV promoter on pcDNA5 or an inert synthetic RNA as control in 1:4 ratio, respectively. <br />
<br />
[[Image:M12-M22_HeLa_daten.jpg|thumb|500px|center|'''GFP/BFP ratio normalized by the negative control''' The data are generated by confocal microscopy of Hela cells, which were transfected with different miMeasure constructs M12-M22 including the negative control (miMeasure construct without binding site). The negative control equals to 1.]]<br />
<br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, left"|'''Table 1: Used Binding Sites and Their Features'''<br />
|sequence||binding site feature||Name<br />
|-<br />
|ctcagtttactagtgccatttgttc||perfect binding site against miRsAg||perfect BS<br />
|-<br />
|ctcagtttactagacgcatttgttc||miMeasure with randomised nucleotides 10-12|| 10-12 ACG<br />
|-<br />
|ctcagtttactagtaacatttgttc||miMeasure with randomised nucleotides 11-12||11-12 AA<br />
|-<br />
|ctcagtttactagacggatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ACGG<br />
|-<br />
|ctcagtttactagatgtatttgttc||miMeasure with randomised nucleotides 9-12||9-12 ATGT<br />
|-<br />
|ctcagtttactagtggcatttgttc||miMeasure with mutated nucleotide 10||10 G<br />
|-<br />
|ctcagtttactagtgacatttgttc||miMeasure with mutated nucleotide 10||10 A<br />
|-<br />
|ctcagtttactagtaccatttgttc||miMeasure with mutated nucleotide 11||11 A<br />
|-<br />
|ctcagttatgtagtgccatttgttc||miMeasure with mutated nucleotide 16-18||16-18 ATG<br />
|-<br />
|-||miMeasure without any binding site||NC (negative control)<br />
|-<br />
|}<br />
<br />
<br />
Comparing the GFP/BFP-ratio between the constructs, we can see a significant difference of GFP expression between the negative control and the construct containing the perfect binding site. Since the control is not downregulated due to lack of binding sites, we set it as 100% expression on this chart. It can be seen that the perfect binding sites causes the lowest GFP expression, approximately 50%, while other binding sites range in between 55% and 100% of expression. <br />
<br />
<!--discussion?The seed region is altered in M22. Since the seed region is considered the most important site for knock-down efficiency, its change diminishes the knock-down capability of the binding site completely. So the GFP expression in this case is as high as the negative control, where no binding site was inserted into the miMeasure plasmid. --><br />
<br />
<br />
<!--[https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Transfection Transfection] with four different conditions were carried out on day two. The ratio of transfection is 1 (M construct) : 4 (stuffer/ miRsAg/ pcDNA5/ shRNA3) with a total amount of 50ng DNA.<br />
<br />
Condition '''a''': cotransfection with stuffer (salmon sperm DNA) <br />
<br />
Condition '''b''': cotransfection with synthetic RNA miRsAg <br />
<br />
Condition '''c''': cotransfection with empty pcDNA5<br />
<br />
Condition '''d''': cotransfection with synthetic shRNA3<br />
<br />
A control consisting of the empty miMeasure plasmid (without binding site) was also cotransfected with the same conditions a, b, c and d. The cells were used for measurements on day three.--><br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
====Flow cytometry measurements====<br />
<br />
Hela cells transfected with the constructs (described above) are also taken for flow cytometry. Each measuremnet contains 10000 cells. The cells are plotted on a logarithmic scale in relation to EGFP and EBFP2 intensity. Each dot represents one fluorescent cell. The dots are colour coded, so that the orange dots represent cells cotransfected with different miMeasure constructs and the miRsAg and the blue one represent cells cotransfected with non-specific miRNA (miR-155), respectively. So the blue set of measurements represent the negative control. Both population of dots make up a line on the logarithmic scale, which shows the correlation of EGFP and EBFP2 very well. The cotransfection with miR-155 is therefore the negative control. If the two different coloured dots overlap, they become white. Thus both lines overlap almost completely in the negative control, whereas the orange line shifts to the left for the miMeasure construct with the perfect binding site. All the other constructs are like the negative control.<br />
Both coloured lines are more scattered on the linear scale, although the shifting of the orange dots are more visible for the construct containing the perfect binding site. All the other constructs have the same range of scattering as the negative control. <br />
<br />
[[Image:Flow1.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a logarithmic scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]^<br />
<br />
[[Image:Flow-linear-result.jpg|thumb|610px|center|'''GFP/BFP correlation of single transfected Hela cells according to flow cytometry analysis on a linear scale''' different binding sites for miRsAg cotransfected with miRsAg or with mi-R155, respectively. The orange dots represent the cotransfected cells with miRsAg and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of miRaPCR Generated Binding Sites Against a Natural miRNA===<br />
<br />
<br />
<br />
The [https://2010.igem.org/Team:Heidelberg/Notebook/BSDesign/July miRaPCR] generates binding sites out of rationally designed fragments. These are aligned with each other by chance, whereby different spacer regions are inserted randomly in between. It has been suggested that having more than one binding site of for the same miRNA behind each other can lead to stronger down-regulation than a single one. If imperfect binding sites are aligned, it is also supposed to be stronger than a single one. This is what we tested using MiRaPCR for effortless assembly of binding site fragments.<br />
For our experiments, we took advantage of the high abundance of miRNA 122 in liver cells and tested different combinations of binding sites created by miRaPCR. We transfected HeLa and HuH7 cells with the constructs described in table 2. Since HuH7 cells express miR-122, the constructs will be affected in the HuH7 cells without cotransfecting any miRNAs, whereas miR-122 were cotransfected for the HeLa cells in 2:1 ratio. The result shows the ratio between GFP and BFP normalized to the negative control (miMeasure constructs without binding sites). The miMeasure constructs were also compared to the expression of miMeasure containing one perfect binding site for miRNA 122.<br />
<br />
The transfected HeLa are also imaged with the epifluorescent microscope. Large amount of cells in the negative control (miMeasure with perfect binding site cotransfected with miR-155, see a)are green, whereas most cells with the miMeasure construct containing the perfect binding sites (see b) are blue. <br />
<br />
[[Image:BLUE+green.jpg|thumb|600px|center|'''epifluorescent microscopy image (10x) of Hela cells transfected with miMeasure''' miMeasure with a perfect binding site is a) cotransfected with miR-155, which has no specificity to miR-122, b) cotransfected with miR-122, which is complementary to the perfect binding site. EGFP is regulated by miR-122, EBFP2 is unregulated and serves as transfection control.]]<br />
<br />
<br />
The image analysis of confocal microscopy gives the following results:<br />
<br />
[[Image:MiMeasure_miR122.jpg|thumb|500px|center|''' different binding sites for miR122, HeLa cotransfected with miR122 expression plasmid''']]<br />
<br />
<br />
The EGFP-expression normalized to the EGFB2 expression is set to 100% for the miMeasure construct transfected with the non-matching miRNA (in this case miR-155). The knock-down efficiency of one perfect binding site is around 30%, which also accounts for the three aligned perfect binding sites and the two aligned imperfect ones. The binding site with bulges from position 9-12 and 9-22 don't show any knock-down. <br />
<br />
<br />
[[Image:MiMeasure_miR122b.jpg|thumb|500px|left|''' different binding sites for miR122, Huh7 cells''']]<br />
<br />
<br />
<br />
<br />
<!--Discussion This experiment shows, that the binding site pattern with 3 aligned perfect binding sites miM-1.3-7 gives the strongest knock-down. Whereby the binding site pattern with two imperfect binding sites 1-8 is weaker, but still stronger than the negative control. If one binding site is randomized from nucleotide 9-12 or 9-22 miM-r12, miM-r22, it loses its capability of protein down-regulation.--><br />
{| class="wikitable sortable" border="0" align="center" style="text-align: left"<br />
|-bgcolor=#009be1<br />
|+ align="top, right"|'''Table2: miRaPCR Designed Binding Sites and Their Features<br />
|binding site feature'''||Name/number<br />
|-<br />
|miMeasure with 3 aligned perfect binding sites||miM-1.3-7<br />
|-<br />
|miMeasure with two imperfect binding sites||miM-3.1-8<br />
|-<br />
|miMeasure with randomised nucleotides 9-12||miM-r12<br />
|-<br />
|miMeasure with randomised nucleotides 9-22||miM-r22<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
The Huh7 cells were also transfected with the 4 different constructs. Here a cotransfection with miR-122 is not necessary, since Huh7 cells express miR-122 themselves. The knock-down of the perfect binding sites are stronger than the knock-down in the Hela cells. Here the knock-down efficiency is 80% for the perfect binding site and the aligned constructs. <br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
====Flow cytometry====<br />
<br />
<br />
The same constructs in Hela cells were analyzed by flow cytometry, too. Here the orange dots also represent the miMeasure construct transfected with the specific miRNA and the blue dots make up the negative control. The orange dots from the construct containing the perfect and the aligned binding sites have lower EGFP expression compared to EBFP2 expression, since the EGFP trend doesn't correspond to the EBFP2 trend, but shifts to the laft. The orange dots rise with the fluorescence intensity and collapses to zero, when the EBFP2 intensity is high. For the other constructs the EGFP range fully corresponds with the EBFP2 range. <br />
The linear plot shows the orange and blue dots in more distinct lines. The orange dots from the construct containing the perfect and aligned binding sites assemble along the y-axis, where the EGFP fluorescence intensity is zero. For the other construct the EGFP line fully overlap with the EBFP2. <br />
<br />
<br />
[[Image:Flow_miR122.jpg|thumb|620px|center|'''EGFP2/EBFP correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
[[Image:Flow_miR122_linear.jpg|thumb|620px|center|'''EGFP/EBFP2 correlation of single transfected Hela cells according to flow cytometry analysis''' different binding sites for miR122 cotransfected with miR-122 or with miR-155, respectively. The orange dots represent the cotransfected cells with miR122 and the blue dots the cotransfected cells with miR-155. Hela cells were used.]]<br />
<br />
===Analysis of endogenous miRNA===<br />
<br />
==Discussion==<br />
<br />
==Methods==<br />
<br />
The fluorescence of GFP and BFP can be compared using different methods, for example automated fluorescence plate reader systems, [https://2010.igem.org/Team:Heidelberg/Notebook/Methods#Flow_cytometry flow cytometry] or manual and automated fluorescence [https://2010.igem.org/Team:Heidelberg/Notebook/Material_Methods#Microscopy microscopy].<br />
<br />
==References==<br />
<br />
Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Exploration of new chromophore structures leads to the identification of improved blue fluorescent proteins. Biochemistry. 2007 May 22;46(20):5904-10.<br />
<br />
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009 Jan 23;136(2):215-33.<br />
<br />
Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 2010;79:351-79.<br />
<br />
<br />
<html><br />
<div class="backtop"><br />
<a href="#top">&uarr;</a><br />
</div><br />
</html><br />
<br />
{{:Team:Heidelberg/Single_Bottom}}</div>Rudolf