http://2010.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=50&target=Metugen&year=&month=
2010.igem.org - User contributions [en]
2024-03-29T09:45:15Z
From 2010.igem.org
MediaWiki 1.16.5
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/CS
Team:METU Turkey/Results Discussion/CS
2010-10-28T03:41:03Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br> -- </br><br />
<br />
<br>10/09/26<br />
<br />
<br><h3>Purification with CS BL21 pTriEx</h3><br />
<br />
<br>Loaded combined FPLC tubes from QS column(10/09/26) gave two close picks in CS column. First one corresponds to the CooA. The elutions of CooA are C13,C14 and C15. We combined them for further analyzes with EMSA and ITC and stored @+4. C16 AND C17 are combined to reload to CS column because they are contaminated another protein which is close to 40kDa.<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/7/74/Br15.jpg"></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/d/d8/Br16.jpg"></a></div></html><br />
<br />
<br />
<br>10/10/12 CS<br />
<br />
<br><h3>Purification with CS BL21 pTriEx</h3><br />
<br />
<br>According to SDS-GEL, we combined 4,6,7,8 and 9 tubes containing 0,5ml and concentrated to 1ml for furhter analyzes such EMSA and ITF. We measured absorbance of combined @ 280,260 and 420 as respectively 2.76, 2.83 and 0.837. CooA concentration was determined as 7.75 uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We didnot take 5th tube because it contains much more impurities than other tubes.<br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/9/90/Br17.jpg"></a></div></html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/CooA_Expression_and_Purification
Team:METU Turkey/Results Discussion/CooA Expression and Purification
2010-10-28T03:39:05Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br> -- </br><br />
<br />
<!-- ***** New entry ***** --> <br />
<div class="main_item"> <br />
<h2><br />
3-CooA Expression and Purification<br />
</h2><br />
<table><br />
<tr><br />
<td style="padding-right:20px;"><br />
<br />
</td><br />
<td><br />
<p style="font-size:110%; color:#576f91; font-family:georgia,serif;"><br> <br />
<br />
<br> <h2>1-Overexpression optimization</h2><br />
<br />
<br> <h3>A. Expression vector comparison (pKK versus pTriEx)</h3><br />
<br />
<br>When we compare the below results, the expression of pTriEx vector is higher than the expression of pTriEx vector<br />
<br />
<br> <h3>A.1. Expression in BL21 with pTriEx</h3><br />
<br />
<br> In this expression experiment, we obtained 2 different bands in BL21 pTriEx from BL21 negative control as indicated gel photo. CooA is found in two form (monomer and dimer).<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/3/35/Br1.jpg"></a></div><br />
<br />
<br> <h3>A.2. Expression in JM109 and BL21 with pKK vector</h3><br />
<br />
We failed to express pKK vector in JM109. We have a little expression in BL21.<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/b9/Br2.jpg"></a></div><br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/pKK_versus_pTriEx"><strong>Details...</strong></a></div></html><br />
<br />
<br />
<br />
<br> <h3>B. Expression host comparison (JM109 versus BL21)</h3><br />
<br />
<br> BL21 is better host than JM109 for CooA.<br />
<br />
<br> <h3>C. IPTG induction studies</h3> <br />
<br />
<br> Expression comparison with different IPTG Concentration of pTriEx vector.<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/6/6a/Br3.jpg"></a></div></html><br />
<br />
<br> Our CooA pTriEx vector is expressed without IPTG induction but is less than others. When 2mM IPTG was added to culture, expression of CooA was decreased. It has probably a toxic effect on our bacteria.<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/IPTG_induction"><strong>Details...</strong></a></div></html><br />
<br />
<br> <h3>D. Ferric Citrate effect</h3><br />
<br />
<br> Time Dependent Expression of pTriEx vector with Ferric Citrate and without Ferric Citrate<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/5/5f/Br4.jpg"></a></div></html><br />
<br />
<br> According to the SDS-Page result, Ferric Citrate increses the expression of CooA. It is probably releated to heme characteristic of CooA. The best IPTG induction time among 3-5-7-9 hours is 5 hour. <br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Ferric_Citrate_effect"><strong>Details...</strong></a></div></html><br />
<br />
<br> <h3>E. Soluble versus insoluble fraction</h3><br />
<br />
<br> Lysis Buffer with Urea and without Urea<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/4/43/Br5.jpg"></a></div></html><br />
<br />
<br> Results are seen in the SDS-Page photograph, there is no difference between bands of same samples (look at all the 50kDa bands). Thus,we concluded that CooA does not accumulate in inclusion body.<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Soluble_vs_insoluble_fraction"><strong>Details...</strong></a></div></html><br />
<br />
<br> <h2>2-Purification optimization</h2><br />
<br />
<br> <h3>A. Ion exchange chromatography with Sepharose Q (QS)</h3><br />
<br />
<br> Purification QS with BL21 pTriEx: Yellowish color indicates our CooA protein. Then we looaded 27,28,29,30 and 31 to SDS-Gel the elutes which have a high value at 420nm because oxidized CooA gives a Sorret peak at 420 nm according to Aono. CooA concentration was determined according to extinction coefficient of heme (Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono.<br />
<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/QS_results"><strong>Details...</strong></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/1/14/Br13.jpg"></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/7/76/B30.jpg"></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/9/93/Br14.jpg"></a></div></html><br />
<br />
<br> <h3>B. Affinity chromatography with chealating sepharose(CS)</h3><br />
<br />
<br> Purification with CS BL21 pTriEx: Loaded combined FPLC tubes from QS column(10/09/26) gave two close picks in CS column. First one corresponds to the CooA. The elutions of CooA are C13,C14 and C15. We combined them for further analyzes with EMSA and ITC and stored @+4. C16 AND C17 are combined to reload to CS column because they are contaminated another protein which is close to 40kDa.<br />
<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/CS"><strong>Details...</strong></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/7/74/Br15.jpg"></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/d/d8/Br16.jpg"></a></div></html><br />
<br />
<br />
<br> <h2>C. Concentrated CooA</h2><br />
<br />
<br> CooA protein contains heme group therefore its solution is seen yellow to orange<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/be/Br18.jpg"></a></div></html><br />
<br />
<br />
<br />
<br />
<br> -- </br></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/CooA_Expression_and_Purification
Team:METU Turkey/Results Discussion/CooA Expression and Purification
2010-10-28T03:36:41Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<!-- ***** New entry ***** --> <br />
<div class="main_item"> <br />
<h2><br />
3-CooA Expression and Purification<br />
</h2><br />
<table><br />
<tr><br />
<td style="padding-right:20px;"><br />
<br />
</td><br />
<td><br />
<p style="font-size:110%; color:#576f91; font-family:georgia,serif;"><br> <br />
<br />
<br> <h2>1-Overexpression optimization</h2><br />
<br />
<br> <h3>A. Expression vector comparison (pKK versus pTriEx)</h3><br />
<br />
<br>When we compare the below results, the expression of pTriEx vector is higher than the expression of pTriEx vector<br />
<br />
<br> <h3>A.1. Expression in BL21 with pTriEx</h3><br />
<br />
<br> In this expression experiment, we obtained 2 different bands in BL21 pTriEx from BL21 negative control as indicated gel photo. CooA is found in two form (monomer and dimer).<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/3/35/Br1.jpg"></a></div><br />
<br />
<br> <h3>A.2. Expression in JM109 and BL21 with pKK vector</h3><br />
<br />
We failed to express pKK vector in JM109. We have a little expression in BL21.<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/b9/Br2.jpg"></a></div><br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/pKK_versus_pTriEx"><strong>Details...</strong></a></div></html><br />
<br />
<br />
<br />
<br> <h3>B. Expression host comparison (JM109 versus BL21)</h3><br />
<br />
<br> BL21 is better host than JM109 for CooA.<br />
<br />
<br> <h3>C. IPTG induction studies</h3> <br />
<br />
<br> Expression comparison with different IPTG Concentration of pTriEx vector.<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/6/6a/Br3.jpg"></a></div></html><br />
<br />
<br> Our CooA pTriEx vector is expressed without IPTG induction but is less than others. When 2mM IPTG was added to culture, expression of CooA was decreased. It has probably a toxic effect on our bacteria.<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/IPTG_induction"><strong>Details...</strong></a></div></html><br />
<br />
<br> <h3>D. Ferric Citrate effect</h3><br />
<br />
<br> Time Dependent Expression of pTriEx vector with Ferric Citrate and without Ferric Citrate<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/5/5f/Br4.jpg"></a></div></html><br />
<br />
<br> According to the SDS-Page result, Ferric Citrate increses the expression of CooA. It is probably releated to heme characteristic of CooA. The best IPTG induction time among 3-5-7-9 hours is 5 hour. <br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Ferric_Citrate_effect"><strong>Details...</strong></a></div></html><br />
<br />
<br> <h3>E. Soluble versus insoluble fraction</h3><br />
<br />
<br> Lysis Buffer with Urea and without Urea<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/4/43/Br5.jpg"></a></div></html><br />
<br />
<br> Results are seen in the SDS-Page photograph, there is no difference between bands of same samples (look at all the 50kDa bands). Thus,we concluded that CooA does not accumulate in inclusion body.<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Soluble_vs_insoluble_fraction"><strong>Details...</strong></a></div></html><br />
<br />
<br> <h2>2-Purification optimization</h2><br />
<br />
<br> <h3>A. Ion exchange chromatography with Sepharose Q (QS)</h3><br />
<br />
<br> Purification QS with BL21 pTriEx: Yellowish color indicates our CooA protein. Then we looaded 27,28,29,30 and 31 to SDS-Gel the elutes which have a high value at 420nm because oxidized CooA gives a Sorret peak at 420 nm according to Aono. CooA concentration was determined according to extinction coefficient of heme (Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono.<br />
<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/QS_results"><strong>Details...</strong></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/1/14/Br13.jpg"></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/7/76/B30.jpg"></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/9/93/Br14.jpg"></a></div></html><br />
<br />
<br> <h3>B. Affinity chromatography with chealating sepharose(CS)</h3><br />
<br />
<br> Purification with CS BL21 pTriEx: Loaded combined FPLC tubes from QS column(10/09/26) gave two close picks in CS column. First one corresponds to the CooA. The elutions of CooA are C13,C14 and C15. We combined them for further analyzes with EMSA and ITC and stored @+4. C16 AND C17 are combined to reload to CS column because they are contaminated another protein which is close to 40kDa.<br />
<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/CS"><strong>Details...</strong></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/7/74/Br15.jpg"></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/d/d8/Br16.jpg"></a></div></html><br />
<br />
<br />
<br> <h2>C. Concentrated CooA</h2><br />
<br />
<br> CooA protein contains heme group therefore its solution is seen yellow to orange<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 400px; height: 400px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/be/Br18.jpg"></a></div></html><br />
<br />
<br />
<br />
<br />
<br> -- </br></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/Cell_Sensor_Experiments
Team:METU Turkey/Results Discussion/Cell Sensor Experiments
2010-10-28T03:34:04Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br />
<!-- ***** New entry ***** --> <br />
<div class="main_item"> <br />
<h2><br />
2- Cell Sensor Experiments<br />
</h2><br />
<table><br />
<tr><br />
<td style="padding-right:20px;"><br />
<br />
</td><br />
<td><br />
<p style="font-size:110%; color:#576f91; font-family:georgia,serif;"><br> <br />
<br />
<br><br />
<br><h2>Fermentor studies</h2><br />
<br><br />
<br>- <h3>Culturing:</h3> These studies showed that our E.coli BL21 DE3 strain grow well until absorbance at 600 nm reaches 2.2. However, because of high growing capacity of fermentor, sufficient time is not present for Carbon monoxide induction. Therefore, we changed fermentor to flask in order to have higher induction time period of carbon monoxide<br />
<br>- <h3>Viability:</h3> Cells having absorbance at 0.05 have reached the stationary phase in 3 hours and starting from 4th hour, our bacteria cultures started to die. <br />
<br>- <h3>Reproducibility:</h3> Our data acquired from fermentor studies are not reproducible because CO was induced to death cells. <br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 572px; height: 350px;" alt="w7" src="https://static.igem.org/mediawiki/2010/3/3b/Growth_curve_alpha_1.JPG"></a></div><br />
<br />
<br>- <h3>Myoglobin Assay:</h3> Our data acquired from myoglobin assay is not clear because absorbance acquired from cell density have interefered with myoglogin assay data.<br />
<br>- <h3>CFU(Colony Forming Unit):</h3> We couldn’t observe growth of bacteria starting from 4th hour of fermentation.<br />
<br>- <h3>Fluorescence measurements:</h3> Fluorescence was detected due to auto-fluorescence of CooA proteins. Since our bacteria cultures have expression vector, CooA is highly expressed which in turn causes fluorescence.</br><br />
<br />
<br />
<br><br />
<br><h2>Flask experiments</h2></br><br />
<br />
<br><br />
<br />
<br>- <h3>Culturing:</h3> We didn’t have enough time to test our final vector. Instead, we have used BBa_K352017 to test the RFP production. We have used 300 mL flasks with 80 mL LB culture. We have applied 80 Ml Carbon monoxide to some. The results were successful. Cultures induced with carbon monoxide successfully expressed red fluorescent protein.<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 963px; height: 393px;" alt="w7" src="https://static.igem.org/mediawiki/2010/4/49/Culturing_alpha_1.JPG"></a></div><br />
<br />
<br />
<br><br />
<br><h2>Myoglobin assay optimization</h2></br><br />
<br><br />
<br />
<br />
<br>- We have planned to measure CO presence with myoglobin assay. We used myoglobin purchased from Sigma to detect levels of Carbon monoxide. In our experiments, we couldn’t measure exact CO in the environment owing to the fact that sensitivity level of the myoglobin bonded with CO was not sufficient to observe absorbance at 540 nm.<br />
Signal quantification with fluorescence spectroscopy <br />
<br />
<br><br />
<br><h3>Signal Quantification of pCooF-RBS-GFP-TT:</h3> </br><br />
<br><br />
<br />
<br>For this experiment, the bacteria containing the vector having the construct and expression vector pTriEx is incubated in E.coli BL21 strain at different conditions. The results are as the following; <br />
<br><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 902px; height: 390px;" alt="w7" src="https://static.igem.org/mediawiki/2010/1/1b/PCooF_experiment_alpha_1_florasan_grafik.JPG"></a></div><br />
<br />
<br />
<br>- From the data acquired from spectrophotometer, we observed that neither CO presence nor the presence of pCooF-RBS-GFP-TT affected GFP intensity. We acknowledged that fluorescence increase in the intensity of 510 nm was result of fluorescent nature of CooA. It is suspected that the result is dependent on our strain, BL21, caused the unexpected results. <br />
Signal Quantification of pCooM-RBS-RFP-TT-pLac-RBS-CooA: We have tried another construct pCooM-RBS-RFP-TT-pLac-RBS-CooA at TOP10 strain. The results were successful. We have put our construct in different environments (flasks with different conditions) and compared the RFP fluorescence.<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 900px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/b6/BU_SEFER_TAMAM.JPG"></a></div><br />
<br />
<br />
</br><br />
<div align="center"><br><br />
Figure 3: Fluorescence spectra of RFP constructs and controls</br></div><br />
<br />
<br><br />
<br> <h3>Signal Visualization of pCooM-RBS-RFP-TT-pLac-RBS-CooA:</h3><br />
<br><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 422px; height: 413px;" alt="w7" src="https://static.igem.org/mediawiki/2010/2/26/Confocal_sa%C4%9F.JPG "></a></div><br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 433px; height: 432px;" alt="w7" src="https://static.igem.org/mediawiki/2010/a/ae/Confocal_sol.JPG "></a></div><br />
<br />
<br />
</br><br />
<br />
<br />
.</p><br />
<br />
</td><br />
</tr><br />
</table> <br />
</div> <!-- close main item --></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Planning
Team:METU Turkey/Planning
2010-10-28T03:33:07Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br><br />
<br><br />
<br>---</br><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 950px; height: 300px;" alt="w7" src="http://partsregistry.org/wiki/images/d/d0/Schedule.JPG"></a></div><br />
<br><br />
<br><h2>PLANNING</h2><br />
<br><br />
<br><br />
<br><h3>Cloning</h3><br />
<br> - Design and ordering of DNA parts<br />
<br> - Preparation of competent cells <br />
<br> - Cloning<br />
<br> - Construction of Cell Sensor modules<br />
<br> - Validation<br />
<br> - Assembly of final construct<br />
<br />
<br><br />
<br><h3>Cell Sensor Experiments</h3><br />
<br> - Fermentor studies<br />
<br> - Flask experiments<br />
<br> - Solid culture experiments<br />
<br> - Myoglobin assay optimization<br />
<br> - Signal quantification with fluorescence spectroscopy <br />
<br> - Imaging with confocal laser scanning microscopy <br />
<br />
<br><br />
<br><h3>CooA Expression and Purification</h3><br />
<br> - Overexpression optimization<br />
<br> - Purification optimization<br />
<br />
<br><br />
<br><h3>Characterization: Isothermal Titration Calorimetry (ITC)</h3><br />
<br> - DNA component preparation<br />
<br> - Optimization studies<br />
<br> - Determination of Response Element - Transcription Factor Affinities<br />
<br />
<br><br />
<br><h3>Characterization: Electrophoretic Mobility Shift Assay (EMSA)</h3><br />
<br> - Optimization studies<br />
<br> - Determination of Response Element - Transcription Factor Affinities<br />
<br />
<br><br />
<br><h3>Characterization: Intrinsic Tryptophan Fluorescence (ITF)</h3><br />
<br> - Optimization studies<br />
<br> - Determination of Response Element - Transcription Factor Affinities<br />
<br><br />
<br />
<br />
<br>---</br></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Planning
Team:METU Turkey/Planning
2010-10-28T03:32:29Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br><br />
<br><br />
<br>---</br><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 950px; height: 300px;" alt="w7" src="http://partsregistry.org/wiki/images/d/d0/Schedule.JPG"></a></div><br />
<br><br />
<br><h2>PLANNING</h2><br />
<br><br />
<br><br />
<br><h3>Cloning</h3><br />
<br> - Design and ordering of DNA parts<br />
<br> - Preparation of competent cells <br />
<br> - Cloning<br />
<br> - Construction of Cell Sensor modules<br />
<br> - Validation<br />
<br> - Assembly of final construct<br />
<br />
<br><br />
<br><h3>Cell Sensor Experiments</h3><br />
<br> - Fermentor studies<br />
<br> - Flask experiments<br />
<br> - Solid culture experiments<br />
<br> - Myoglobin assay optimization<br />
<br> - Signal quantification with fluorescence spectroscopy <br />
<br> - Imaging with confocal laser scanning microscopy <br />
<br />
<br><br />
<br><h3>CooA Expression and Purification</h3><br />
<br> - Overexpression optimization<br />
<br> - Purification optimization<br />
<br />
<br><br />
<br><h3>Characterization: Isothermal Titration Calorimetry (ITC)</h3><br />
<br> - DNA component preparation<br />
<br> - Optimization studies<br />
<br> - Determination of Response Element - Transcription Factor Affinities<br />
<br />
<br><br />
<br><h3>Characterization: Electrophoretic Mobility Shift Assay (EMSA)</h3><br />
<br> - Optimization studies<br />
<br> - Determination of Response Element - Transcription Factor Affinities<br />
<br />
<br><br />
<br><h3>Characterization: Intrinsic Tryptophan Fluorescence (ITF)</h3><br />
<br> - Optimization studies<br />
<br> - Determination of Response Element - Transcription Factor Affinities<br />
<br></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Conclusions
Team:METU Turkey/Conclusions
2010-10-28T03:26:18Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<!-- ***** New entry ***** --> <br />
<div class="main_item"> <br />
<h2><br />
Conclusions<br />
</h2><br />
<table><br />
<tr><br />
<td style="padding-right:20px;"><br />
<br />
</td><br />
<td><br />
<br />
'''<br><br />
<br>- Cell sensor constructs which were based on CooA under T7 promoter in pTriEx vector transformed into E.coli BL21 DE3 host have failed to function.<br />
<br> <br />
<br>- Alternative sensor construct with pCooM promoter/RFP signal and CooA under pLac promoter in pSB1C3 vector transformed into E.coli Top10 host worked successfully ! E.coli cells transformed with this construct produces very noticable RFP signal -even by naked eye- when exposed to carbon monoxide.<br />
<br> <br />
<br>- 16 biobricks are constructed and submitted to the registry of standart parts. 12 of 16 parts are sent to IGEM HQ as DNA samples.<br />
<br> <br />
<br>- CooA overexpression and purification procedures were optimized. <br />
<br> <br />
<br>- CooA binds to response elements in the absence and presence of CO as indicated by EMSA studies and basal level GFP/RFP expression. On the other hand,<br />
there is a significant increase in expression levels when CO activates CooA.<br />
<br> <br />
<br>Human Practice<br />
<br> <br />
<br>- We hope to provide a technical guideline for other future gas sensing cell sensor projects with our E-CO sensor with enhanced dynamic range project.<br />
<br><br />
'''</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Conclusions
Team:METU Turkey/Conclusions
2010-10-28T03:25:41Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<!-- ***** New entry ***** --> <br />
<div class="main_item"> <br />
<h2><br />
Conclusions<br />
</h2><br />
<table><br />
<tr><br />
<td style="padding-right:20px;"><br />
<br />
</td><br />
<td><br />
<br />
<br><br />
<br>- Cell sensor constructs which were based on CooA under T7 promoter in pTriEx vector transformed into E.coli BL21 DE3 host have failed to function.<br />
<br> <br />
<br>- Alternative sensor construct with pCooM promoter/RFP signal and CooA under pLac promoter in pSB1C3 vector transformed into E.coli Top10 host worked successfully ! E.coli cells transformed with this construct produces very noticable RFP signal -even by naked eye- when exposed to carbon monoxide.<br />
<br> <br />
<br>- 16 biobricks are constructed and submitted to the registry of standart parts. 12 of 16 parts are sent to IGEM HQ as DNA samples.<br />
<br> <br />
<br>- CooA overexpression and purification procedures were optimized. <br />
<br> <br />
<br>- CooA binds to response elements in the absence and presence of CO as indicated by EMSA studies and basal level GFP/RFP expression. On the other hand,<br />
there is a significant increase in expression levels when CO activates CooA.<br />
<br> <br />
<br>Human Practice<br />
<br> <br />
<br>- We hope to provide a technical guideline for other future gas sensing cell sensor projects with our E-CO sensor with enhanced dynamic range project.<br />
<br></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Conclusions
Team:METU Turkey/Conclusions
2010-10-28T03:25:16Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<!-- ***** New entry ***** --> <br />
<div class="main_item"> <br />
<h2><br />
Conclusions<br />
</h2><br />
<table><br />
<tr><br />
<td style="padding-right:20px;"><br />
<br />
</td><br />
<td><br />
<br />
<br><br />
<br>- Cell sensor constructs which were based on CooA under T7 promoter in pTriEx vector transformed into E.coli BL21 DE3 host have failed to function.<br />
<br> <br />
<br>- Alternative sensor construct with pCooM promoter/RFP signal and CooA under pLac promoter in pSB1C3 vector transformed into E.coli Top10 host worked successfully ! E.coli cells transformed with this construct produces very noticable RFP signal -even by naked eye- when exposed to carbon monoxide.<br />
<br> <br />
<br>- 16 biobricks are constructed and submitted to the registry of standart parts. 12 of 16 parts are sent to IGEM HQ as DNA samples.<br />
<br> <br />
<br>- CooA overexpression and purification procedures were optimized. <br />
<br> <br />
<br>- CooA binds to response elements in the absence and presence of CO as indicated by EMSA studies and basal level GFP/RFP expression. On the other hand,<br />
there is a significant increase in expression levels when CO activates CooA.<br />
<br> <br />
<br>Human Practice<br />
<br> <br />
<br>- We hope to provide a technical guideline for other future gas sensing cell sensor projects with our E-CO sensor with enhanced dynamic range project.<br />
<br><br />
</td></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Safety
Team:METU Turkey/Safety
2010-10-28T03:24:06Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planing">Planing</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> |</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br>---</br><br />
<br> - All experiments listed in this project were conducted under standard laboratory safety rules.<br />
<br> <br />
<br>- In experiments where CO feeding was required, a sensitive electronic carbon monoxide sensor was used to detect CO in case of any leakage.<br />
<br> <br />
<br>- Host organism and constructed DNA parts used in this project pose no risk to public health- All experiments listed in this project were conducted under standard laboratory safety rules.<br />
<br> <br />
<br>- In experiments where CO feeding was required, a sensitive electronic carbon monoxide sensor was used to detect CO in case of any leakage.<br />
<br> <br />
<br>- Host organism and constructed DNA parts used in this project pose no risk to public health<br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</br></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Bravo
Team:METU Turkey/Bravo
2010-10-28T03:12:51Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br><h3> Purification with pTriEX vector</h3><br />
<br />
<br> 10/09/26<br />
<br />
<br> Objectives:<br />
<br />
<br> - 0.5 L culture of BL21 pTriEx-Rr-CooA French Pressed <br />
<br> - FPLC <br />
<br />
<br><h3> Standard Experimental Parameters:</h3><br />
<br />
<br> - Tris-HCI buffer is prepared again.<br />
<br> NOTE: As Temperature of Tris-HCl between 25-4 C decrease in 1 unit, pH of buffer increase in 0.003 unit.<br />
<br> - Buffer A:<br />
<br> 20 mM Na2HPO4 [141.96 g/mol] <br />
<br> 1 M NaCl [58.44 g/mol]<br />
<br> pH:7.2<br />
<br> - Buffer B :<br />
<br> Buffer A + Imidazole [6.81 g for 1L buffer A]<br />
<br> - Chelating column charged with zincsulfate-heptahydrate<br />
<br> [Applichem zincsulfate-heptahydrate A3439 ---- 287.54 g/mol] <br />
<br> 1.44 g in 50 mL dH2O (100mM)<br />
<br> - Buffer A for chelating column 900 mL<br />
<br> - Buffer B for chelating column 900 mL<br />
<br> - Cleaning : 1 mL/min Buffer B 5 mL (5dk)<br />
<br> - Wash: 1 mL/min Buffer A 5 mL (5dk)<br />
<br> - 20 mL diluted sample <br />
<br> - 70 mL sample<br />
<br> - 0.5 mL elution tubes<br />
<br> - After FPLC results we combined the C13+C14+C15 tubes and C16+C17 tubes <br />
<br> Pooling fractions = [delay volume/fraction]+tube number<br />
<br> - SDS-Page<br />
<br />
<br> <h3>Purification with QS BL21 pTriEx</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/5/5f/Br4.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/4/43/Br5.jpg"></a></div></html><br />
<br />
<br />
<br />
<br> This is the first experiment of BL21 pTriEx with FPLC. We obeyed the general protein purification procedure except sonication. We lysed pellets with French Press. Then we centrifued the crude lysate @ 32000 g for 60 min. We took a sample for SDS-PAGE. Then we continue with filtration. Filtered crude lysate was looaded to Q-sepharose. According to FPLC graph, we have a sharp peak @ 280nm which contains proteins. We pick up the tubes between 9 and 14. SDS-Page shows the sharp peak contains CooA. F11 is the top of the sharp peak. We also check small peak which corresponds to 46th tube. We combined the F10,F11 and F12 elutes for further purification with chelating sepharose column. <br />
<br />
<br />
<br />
<br> <h3>Purification CS BL21 pTriEx</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/e/eb/Br6.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/c/c9/Br7.jpg "></a></div></html><br />
<br />
<br />
<br> Loaded combined FPLC tubes gave two close picks in CS column. First one corresponds to the CooA. The elutions of CooA are C13,C14 and C15. We combined them for further analyzes with EMSA and ITC and stored @+4. C16 AND C17 are combined to reload to CS column because they are contaminated another protein which is close to 40kDa.<br />
<br />
<br> 10/09/30<br />
<br><h3> Purification QS BL21 with pTriEx</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/f/fd/Br8.jpg "></a></div></html><br />
<br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/7/77/Br9.jpg "></a></div></html><br />
<br />
<br />
<br />
<br> 10/10/10<br />
<br> We desingned an experiment for characterization of CooA pTriEX vector.<br />
<br> We divided 1L culture into :<br />
<br> 7 x 10 ml culture in 50 ml falcon x2 for IPTG concentration test<br />
<br> 1 x 100 ml culture in 500 ml flask w/ Ferric Citrate<br />
<br> 1 x 100 ml culture in 500 ml flask w/out Ferric Citrate<br />
<br> 500 ml culture was used for purification of CooA<br />
<br />
<br> Our parameters was:<br />
<br> IPTG (1mM) w/ Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG (1mM) w/out Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG concentration: 0/0.05/0.5/0.1/0.25/0.5/1/2 mM @5 hours<br />
<br> For purification, we used general protein purification procedure.<br />
<br />
<br> Ferric concentration is 4mg/ml<br />
<br> We harvest 20 ml culture from 100ml flask for each IPTG (1mM) w/ Ferric Citrate and IPTG (1mM) w/out Ferric Citrate at time intervals 3-5-7-9. Then pellets was kept @-80 until sonication<br />
was performed. Pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> IPTG added to falcons:<br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="http://partsregistry.org/wiki/images/4/4f/Bbbbbbbbbbbbbbbbbbbbbbbbbb.jpg"></a></div></html><br />
<br />
<br />
<br> After 5 hours induction with different IPTG concentration, pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> We used french press for 500 ml Culture pellet BL21 pTriEx. We resuspended pellet in 50 ml Buffer A+ 25 ul protease inhibitor. Then Frech press and centrifugation in 32000 g for 60 min was done. The supernatant was used for SDS-PAGE.<br />
<br />
<br> 10/10/10<br />
<br> <h3>Purification QS</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/8/89/Br10.jpg"></a></div></html><br />
<br />
<br />
<br />
<br> Purification QS cont. <br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/3/32/Br11.jpg"></a></div></html><br />
<br />
<br />
<br />
<br />
<br> This gel photos indicate the elutes of 500ml culture which contains Bl21 with pTriEx. The crude lysate was loaded to Q-Sepharose column. In crude lysate, we observe the dimer and monomer forms of CooA. In Elute 27, we obtained high amount of CooA. We measured absorbance of combined @ 280,260 and 420 as respectively ?, ? and ?. CooA concentration was determined as ? uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We used it for further analyzes for EMSA and ITF.<br />
<br />
<br> 10/10/12<br />
<br> <h3>Purification QS</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/0/01/Br12.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="http://partsregistry.org/wiki/images/5/59/BB30.jpg "></a></div></html><br />
<br />
<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,3031,32,33 and 34 to SDS-Gel the elutes which have a high value of OD420 because CooA gives a sorret peak at 420 nm according to Aono.Oxidized CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono. According to OD420 values, we combined the 7 tubes containing 1.5ml between 27-33,concentrated to 1ml and then diluted 10x with CS buffer A.<br />
<br />
<br />
<br> 10/10/12 CS <br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/1/14/Br13.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="http://partsregistry.org/wiki/images/8/8d/BB31.jpg"></a></div></html><br />
<br />
<br />
<br />
<br> According to SDS-GEL, we combined 4,6,7,8 and 9 tubes containing 0,5ml and concentrated to 1ml for furhter analyzes such EMSA and ITF. We measured absorbance of combined @ 280,260 and 420 as respectively 2.76, 2.83 and 0.837. CooA concentration was determined as 7.75 uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We didnot take 5th tube because it contains much more impurities than other tubes.<br />
<br />
<br />
<br> 10/10/21<br />
<br> <h3>Purification QS</h3><br />
<br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/9/93/Br14.jpg"></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="http://partsregistry.org/wiki/images/4/43/BB32.jpg"></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/7/74/Br15.jpg "></a></div></html><br />
<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,30 and 31 to SDS-Gel the elutes which have a high value of OD420 because oxidized CooA gives a sorret peak at 420 nm according to Aono.CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono.<br />
<br />
<br> <h3>Concentrated CooA</h3><br />
<br />
<br> CooA protein contains heme group therefore its solution is seen yellow to orange<br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/d/d8/Br16.jpg "></a></div></html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Delta
Team:METU Turkey/Delta
2010-10-28T03:10:19Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br />
<br>----</br><br />
<br />
<br> <h2>PROTEIN-DNA INTERACTIONS</h2><br />
<br />
<br> Aim:<br />
<br> To show the interaction thermodynamics of COOA protein and target promoter pCooF and pCooM and changes in binding affinity of protein with respect to mutational changes in its target DNA. <br />
<br />
<br> Methods<br />
<br> - Isothermal Titration Calorimetry (ITC)<br />
<br> - Electrophoretic Mobility Shift Assay (EMSA)<br />
<br > - Intrinsic Tryptophan Fluorescence (ITF)<br />
<br />
<br>Both these methods require short oligonucleotides as DNA template and especially for ITC experiment we need high amounts of DNA template. In order to propagate enough DNA, we design primers for promoters and sequences, which include response elements. <br />
<br> 1.Isothermal Titration Calorimetry (ITC)<br />
<br />
<br> Scenarios for DNA component preparation:<br />
<br />
<br> 30bp<br />
<br> The possible sequence of oligonucleotide that we are planning to use in ITC measurements:<br />
<br> GGA TAA CTG TCA TCT GGC CGA CAG ACG GGG <br />
<br>Response (RE) Response (RE)<br />
<br> Element Element <br />
<br />
<br>- MW : 18594.2 g/mole<br />
<br> - GC content: 60% <br />
<br> - Length: 30bp<br />
<br> - Average MW of a base is 325 g/mole (our MW prediction is applicable acc to that info.)<br />
<br> - for an ITC experiment min 1uM DNA ( max: 100uM) is required in sample cell (Vcell 1.8mL)<br />
<br> - we will prepare 2.5 mL per experiment ( it is calculated as 2.5 nmole - 18kDa x 2.5nmole= 45ug)<br />
<br> - for 1uM DNA we require 45ug DNA in 2.5 mL <br />
<br />
<br> If we propagate our oligonucleotide w/ PCR: <br />
<br> - min 70 bp is required for using a QIAGEN PCR purification kit >>>it is problem for us<br />
<br> - max yield is 10ug <br />
<br> - so we will use 5 kit per experiment for getting 45ug <br />
<br />
<br />
<br />
<br>50bp <br />
<br> TAA AAA CTC TGG ATA ACT GTC ATC TGG CCG ACA GAC GGG GGC CGG GCT TT <br />
<br> - Length: 50bp <br />
<br> - MW: 30773g/mole ~31 kDa<br />
<br> - for ITC 1uM (Vcell = 2.5 mL) <br />
<br> 1umol in 1 L ; so we need 2.5nmole for 2.5 mL <br />
<br>1 mole is nearly 31000 g ; so we need 77.7 ug - w/ invitrogen plasmid purification kit we get 800ug plasmids from 100ml culture - we can extract 800ug plasmid from 2ml culture - if we assume that our vector plasmid is nearly 5000bp long, it will be 100 fold of our fragment DNA (50bp) - 800/100 we get 8ug fragments after restriction digestion.<br />
<br> - w/ qiagen gel extraction kit we can get 10ug DNA once <br />
<br> - so, we need 8 kit gel extraction and 10 plasmid purification kit for one ITC experiment <br />
<br> - 50bp fragment recovery 50% (Fermentas)<br />
<br> - for 50 bp we require ~80ug<br />
<br> - one kit elutes 25x 0.05= 12.5ug in once<br />
<br> - for 80ug we require 80/12.5= 6.4= 7 <br />
<br />
<br />
<br> <h3>Experimental plan [Best Case]</h3><br />
<br />
<br> - Full plasmid is used as template <br />
<br> - Plasmids from Mr Gene : about 3 weeks <br />
<br> -Plasmids from Mr gene last year <br />
<br> -pAny-amphicilline<br />
<br> -2300bp+gene <br />
<br> -5 ug<br />
<br> - our DNA components is 137 bp >>>Total palsmid lenght is about 2500 bp. <br />
<br> - average MW of a base is 325 g/mole<br />
<br> - MW: 325 x 2500 x 2 = 1625000 g/mole<br />
<br> - V(sample cell) = 2.5 ml<br />
<br> - we assume that we use 1 uM DNA <br />
<br> - so we need 2.5 nmole DNA<br />
<br> - for 2.5 nmole we require 2.5 x 1625000= 4062500x10^-9 ng = 1063 x 10^-6 = ~4mg <br />
<br> - transformation of the plasmids (2days)<br />
<br> - plasmid purification (3rd day)<br />
<br> - Invitrogen PureLink™ HiPure Plasmid Gigaprep Kit<br />
<br> - Cat. No. K2100-09<br />
<br> - Unit Size 2 preps<br />
<br> - DNA yield is 7.5mg- 10mg (depends on copy number type, size)<br />
<br> - Invitrogen PureLink™ HiPure Plasmid Megaprep Kit<br />
<br> - Cat. No. K2100-08<br />
<br> - Unit Size 4 preps<br />
<br> - DNA yield is 1.5mg-2.5mg (depends on copy number type, size)<br />
<br> - we can get ~4mg plasmid by using 2 x megakit or 1x gigakit<br />
<br />
<br />
<br> - confirmation of transformation w/ single cut and restriction digestion gel (3rd day)<br />
<br> - Gel extraction (4th day) <br />
<br> - PureLink™ Quick Gel Extraction and PCR Purification Combo Kit<br />
<br> - Cat. No. K220001<br />
<br> - Unit Size: 50 prep<br />
<br> - DNA yield is 40ug <br />
<br> - Unit size 50 prep<br />
<br />
<br> - we can get 4mg plasmid by using 100 kit :( <br />
<br> - we search plasmid isolation kit which gives more yield than usual. <br />
<br />
<br />
<br />
<br> Richie Rich (50 bp case)<br />
<br> - 50 bp seq is 77.5 ug/mol (~80 ug/mol)<br />
<br> - we need 2.5 ml so 2.5 nmol for 1 uM in sample cell<br />
<br> - IDT sends 100 nmol (4 nmol after HPLC) ds 50 bp oligo which costs 200 USA dolars in total<br />
<br> - we can perform 2 experiments from one oligo order<br />
<br> - we need 2.5 nmol DNA per experiment. If we make optimization with WT Response Element, we will make al least 8 experiment. <br />
<br> - w/ mutants 10 oligos in total<br />
<br> - 10 experiment x 2.5 nmol = 25 nmol (after HPLC)<br />
<br> - To be ordered 625 nmol >>> 1.750 TL >>> ~1250 USA dollars :(<br />
<br />
<br> IDT Contact <br />
<br> - 100 nmole DNA is € 0.46 /base. <br />
<br> - Annealing is € 23,00/duplex.<br />
<br> - For 50 bp cost is € 69,00. <br />
<br> - Shipping to Turkey is € 50,00.<br />
<br> - lyophilized <br />
<br> - You should have 6 OD of duplex which is 12 nmole depending upon sequence composition.<br />
<br />
<br> Primer Design <br />
<br> pcooF<br />
<br />
<br> forward: 5' TAAAAACTCTGGATAAC <br />
<br />
<br> - Avoid polyXs YES<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] YES <br />
<br> - Length: 17<br />
<br> - GC : 29%<br />
<br> - Tm : 37C<br />
<br> - self complementarity NONE<br />
<br> OR<br />
<br> forward: 5' ccgaattcgcggccgcttctagagCTCTGGATAAC >>>>is it better?<br />
<br />
<br> - Avoid polyXs NO<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] YES <br />
<br> - Length: 11<br />
<br> - GC : 45% YES<br />
<br> - Tm: 32 C<br />
<br> - self complementarity NONE<br />
<br />
<br> reverse: 5' cctactagtagcggccgctgcagAAAAGCCCGGCCCCGTC<br />
<br> - Avoid polyXs YES<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) NO<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 17<br />
<br> - GC : 71%<br />
<br> - Tm: 54 C <br />
<br> - self complementarity NONE<br />
<br> - All potential self-annealing sites are marked in red (allowing 1 mis-match):<br />
<br />
<br> 5' AAAAGCCCGGCCCCGTC 3'<br />
<br> 3' CTGCCCCGGCCCGAAAA 5'<br />
<br />
<br> 5' AAAAGCCCGGCCCCGTC 3'<br />
<br> 3' CTGCCCCGGCCCGAAAA 5'<br />
<br />
<br> OR<br />
<br> reverse: 5' cctactagtagcggccgctgcagGCCCGGCCCCGTC<br />
<br> - Avoid polyXs NO (yinr de gg cc tekrarları var)<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) NO<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 13<br />
<br> - GC : 92% NO<br />
<br> - Tm: 50 C<br />
<br> - self complementarity NONE<br />
<br> - hairpin: NONE<br />
<br />
<br> pCooM<br />
<br> forward: 5' ccgaattcgcggccgcttctagagACAGCATGACGAG <br />
<br> - Avoid polyXs NO <br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) NO<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 13<br />
<br> - GC : 54 % NO<br />
<br> - Tm: 40 C<br />
<br> - self complementarity NONE<br />
<br> - hairpin: NONE<br />
<br />
<br> reverse: 5' cctactagtagcggccgctgcagCGCCACCTGGGCG <br />
<br> - Avoid polyXs NO <br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) NO<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 13<br />
<br> - Tm: 48 C<br />
<br> - self complementarity NONE<br />
<br> - hairpin: NONE<br />
<br />
<br> Short primer design <br />
<br> pcooF: >>> OK CATAAAAACTCTGGATAACTGTCATCTGGCCGACAGACGGGGCCGGGCTTTTTGTCG<br />
<br> - Length: 57<br />
<br> - GC : 53%<br />
<br> - Tm : 75 C<br />
<br> <br />
<br />
<br> forward: 5' CATAAAAACTCTGG<br />
<br> - Avoid polyXs NO<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 14<br />
<br> - GC : 36%<br />
<br> - Tm : 32C<br />
<br> - hairpin: NONE<br />
<br> - self dimer (free energy): 0<br />
<br> - cross dimer (free energy): 0<br />
<br />
<br> reverse: 5' CGACAAAAAGC<br />
<br> - Avoid polyXs YES<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 11<br />
<br> - GC : 45%<br />
<br> - Tm : 32C<br />
<br> - MW: 3343 g/mole<br />
<br> - hairpin: NONE<br />
<br> - self dimer (free energy): 0<br />
<br> - cross dimer (free energy): 0<br />
<br />
<br> pcooM: >>> OK GAGTGTCGGCCAAGTGACG<br />
<br> forward: 5' ACAGCATGAC<br />
<br> - Avoid polyXs YES<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] YES <br />
<br> - Length: 10<br />
<br> - GC : 50%<br />
<br> - Tm : 30C<br />
<br> - MW: 3021 g/mole<br />
<br> - hairpin: NONE<br />
<br> - self dimer (free energy): -2.3<br />
<br> - cross dimer (free energy): 0<br />
<br />
<br> reverse: 5' AGTACGCCAC<br />
<br> - Avoid polyXs YES<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO<br />
<br> - Length: 10<br />
<br> - GC : 60%<br />
<br> <br />
<br> - MW: 2997 g/mole<br />
<br> - hairpin: NONE<br />
<br> - self dimer (free energy): -2.0<br />
<br> - cross dimer (free energy): 0<br />
<br />
<br />
<br />
<br> Preparation of DNA Component<br />
<br />
<br> DNA Components to be produced<br />
<br />
<br> Promoters:<br />
<br />
- <br> pCooM<br />
- <br> pCooF<br />
- <br> pCooF C4G<br />
- <br> pCooF C9G<br />
- <br> pCooF G2C<br />
- <br> pCooF G7C<br />
<br />
<br> Response Elements (RE)<br />
<br />
- <br> pCooM<br />
- <br> pCooF<br />
- <br> pCooF C4G<br />
- <br> pCooF C9G<br />
- <br> pCooF G2C<br />
- <br> pCooF G7C<br />
<br />
<br> 1.Transformation <br />
<br />
<br> 2.Plasmid purification <br />
<br> It is started with 5ml overnight culture from glycerol stock<br />
<br> Fermentas Gene jet miniprep kit is used<br />
<br> Final volume is 50ul <br />
<br />
<br> 3. Restriction digestion for confirmation of the plasmids<br />
Fermentas fast digest kit is used<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D1.jpg"></a></div></html><br />
<br />
<br />
<br> 4.Concentration measurement with alpha UV spectrophotometer<br />
<br />
<br />
<br> 5.PCR for promoters<br />
<br> Primers: <br />
<br> Primers for pCooF promoter/mutants: <br />
<br> Long promoter<br />
<br />
<br> Forward: CCGAATTCGCGGCCGCTTCTAGAGTTCGGCGTCTTTTCATACCC<br />
<br> Reverse: CTACTAGTAGCGGCCGCTGCAGCCTGGCGCCGAGTAAGC<br />
<br />
<br> Short promoter <br />
<br />
<br> forward: TTCGGCGTCTTTTCATACCC<br />
<br> reverse: CCTGGCGCCGAGTAAGC<br />
<br> primers for pCooM promoter:<br />
<br> long promoter<br />
<br> forward: CCGAATTCGCGGCCGCTTCTAGAGCAGCATGACGAGTGTCGGCCAAG<br />
<br> reverse: CCTACTAGTAGCGGCCGCTGCAGGAAGAACGGGAGTACGCCACCTG<br />
<br />
<br> short promoter<br />
<br />
<br> forward: CAGCATGACGAGTGTCGGCCAAG<br />
<br> reverse: GAAGAACGGGAGTACGCCACCTG<br />
<br />
<br />
<br> PCR reaction mix (fermantas) for 1 reaction:<br />
<br />
<br> 10X Taq Buffer 3ul<br />
<br> dNTPs 3ul<br />
<br> 25mM MgCl2 3ul<br />
<br> f-primer 3ul<br />
<br> r-primer 3ul<br />
<br> 5 u/ul Taq polymerase 0.25ul<br />
<br> 2.5u/ul Pfu polymerase 0.015ul<br />
<br> Template 3ul<br />
<br> Nuc free H2O 11.75ul<br />
<br />
<br> TOTAL: 30ul<br />
<br />
<br />
<br> PCR reaction conditions (Techne TC-512)<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:PCR_reaction_(1).JPG"></a></div></html><br />
<br />
<br />
<br> <h3>6.Agarose gel electrophoresis</h3><br />
<br> - % 1 agarose<br />
<br> - 75V<br />
<br> - 45 min<br />
<br />
<br> pCooF promoter <br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D2.jpg"></a></div></html> <br />
<br> pCooF mutant C4G <br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D3.jpg"></a></div></html> <br />
<br> pCooF mutantC9G<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D4.jpg"></a></div></html> <br />
<br> pCooF mutant G2C<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D5.jpg"></a></div></html><br />
<br> pCooF G7C <br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D6.jpg"></a></div></html> <br />
<br> pCooM promoter(long)<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D7.jpg"></a></div></html><br />
<br />
<br> 7.Gel extraction<br />
<br> Gene jet gel extraction kit is used<br />
<br />
<br> 8.Concentration of samples with vacuum concentrator<br />
<br> 1hr in 200mbar for 100 ul reduction<br />
<br />
<br> 9.Concentration measurement with alpha uv spectrophotometer<br />
<br />
<br />
<br> 10.PCR for response element<br />
<br> Primers<br />
<br> primers for pCooF/mutants RE<br />
<br> forward: CATAAAAACTCTGG<br />
<br> reverse: CGACAAAAAGC<br />
<br />
<br> primers for pCooM RE<br />
<br> forward: ACAGCATGAC<br />
<br> reverse: AGTACGCCAC<br />
<br />
<br />
<br> PCR reaction mix (fermantas) for 1 reaction:<br />
<br />
<br> 10X Taq Buffer 3ul<br />
<br> dNTPs 3ul<br />
<br> 25mM MgCl2 3ul<br />
<br> f-primer 3ul<br />
<br> r-primer 3ul<br />
<br> 5 u/ul Taq polymerase 0.25ul<br />
<br> 2.5u/ul Pfu polymerase 0.015ul<br />
<br> Template 3ul<br />
<br> Nuc free H2O 11.75<br />
<br />
<br> TOTAL: 30ul<br />
<br />
<br />
<br> PCR conditions<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:Pcr_conditions.JPG"></a></div></html><br />
<br />
<br />
<br />
<br> <h2> 1. Agarose gel electrophoresis for RE</h2><br />
<br> - % 1 agarose<br />
<br> - 100V<br />
<br> - 75 min<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D8.jpg"></a></div></html><br />
<br />
<br />
<br> <h3>12. Gel extraction </h3><br />
<br> Gene jet gel extraction kit is used<br />
<br> <h3>13.Concentration measurement with alpha uv spectrophotometer</h3><br />
<br />
<br> Oligonucleotides that include response elements are too short (57bp). Although we reach the good amount of products from the Agarose gel electrophoresis, we lost most of our samples during the gel extraction process, because the recovery of the gel extraction kit reduces with oligos shorter than 100bp. Therefore, we had to use promoters (~100bp) rather than response elements. <br />
Unfortunately, ITC experiments cannot be performed because of inadequate production of DNA and protein components. <br />
<br />
<br> <h2> 2. EMSA</h2><br />
<br> 151010-EMSA (w/ Lightshift Chemiluminescence EMSA Kit (PIERCE))<br />
<br> Gel<br />
<br> 8.3ml 30% polyacrylamide solution (29:1)<br />
<br> 2.5ml 10X TBE <br />
<br> 39.2ml ddH2O<br />
<br> 50ul TEMED<br />
<br> 500ul APS (10%)<br />
<br> DNA&PROTEIN:<br />
<br> pCooM: <br />
<br> MW: ~66kDa<br />
<br> 330ng in 10ul<br />
<br> 330x10-9 / 66 kDa= 5 pmol<br />
<br> pCooF:<br />
<br> MW: 57 kDa<br />
<br> 91.6ng in 10 ul<br />
<br> 91.6x10-9 / 57kDa= 1.7 pmol<br />
<br> CooA:<br />
<br> MW: 48 kDa <br />
<br> 1ug/ul in 500 ul <br />
<br> Oxidized protein is untreated CooA<br />
<br> Reduced protein is 2ul DTT added into 1000 ul CooA<br />
<br> Reduced +CO is degassed, reduced with DTT and 5 min CO is sparged. <br />
<br> Binding Reaction Component (w/ Lightshift Chemiluminescence EMSA Kit (PIERCE))<br />
tablo<br />
<br> Reactions:<br />
tablo<br />
<br> Reaction is incubated 20min at 4C and 20 min at room temperature before running<br />
<br> Pre run: 100V 45min at 4C<br />
<br> Run: 100V 1 h at 4C<br />
<br> Staining: After run is compleated, gel is staining with Et-Br by shaking 30 min to stain DNA.<br />
<br> Results:<br />
D9<br />
<br> In conclusion, there is not a meaningful retardation. Binding conditions may not be sustained because gel is not anoxic. Not only reaction buffer but also running buffer and gel should have to be reduced for proper binding of CooA to the DNA<br />
<br />
<br> EMSA[211010] [He at al. (1995)]<br />
<br> Gel<br />
<br> 6% polyacryamide gel <br />
<br> 8.3ml 30% polyacrylamide solution (29:1)<br />
<br> 2.5ml 10X TBE <br />
<br> 39.2ml ddH2O<br />
<br> 50ul TEMED<br />
<br> 500ul APS (10%)<br />
<br> 3 ml 170 mM sodium dithionite <br />
<br> DNA&PROTEIN:<br />
<br> pCooM: <br />
<br> MW: ~66kDa<br />
<br> 330ng in 10ul<br />
<br> 330x10-9 / 66 kDa= 5 pmol<br />
<br />
<br> pCooF:<br />
<br> MW: 57 kDa<br />
<br> 91.6ng in 10 ul<br />
<br> 91.6x10-9 / 57kDa= 1.7 pmol<br />
<br> CooA:<br />
<br> MW: 48 kDa<br />
<br> 1ug/ul in 500 ul <br />
<br> Reduced protein is 2ul DTT added into 1000 ul CooA. <br />
<br> Reduced +CO is degassed, reduced with DTT and 5 min CO is sparged. <br />
<br />
<br> Reactions:<br />
tablo<br />
<br> Reaction is incubated 20min at 4C and 20 min at room temperature before running<br />
<br> Pre run: 100V 45min at 4C<br />
<br> Run: 100V 1. 5 hrs at 4C<br />
<br> Staining: After run is completed, gel is staining with Et-Br by shaking 15 min to stain DNA.<br />
<br> Results: <br />
D10<br />
<br />
<br> In conclusion, there is a little retardation. Binding conditions may not be sustained because gel is not anoxic. Not only reaction buffer but also running buffer and gel should have to be reduced for proper binding of CooA to the DNA. <br />
<br> EMSA [231010]<br />
<br> Gel<br />
<br> 8.3ml 30% polyacrylamide solution (29:1)<br />
<br> 2.5ml 10X TBE <br />
<br> 39.2ml ddH2O<br />
<br> 50ul TEMED<br />
<br> 500ul APS (10%)<br />
<br> Argon is sparged for 5 min to get an anoxic gel <br />
<br> 45min pre-run is completed at 100V before reaction in order to remove APS/TEMED<br />
<br> 1.7mM sodium dithionate is added in to the running buffer <br />
<br> DNA&PROTEIN:<br />
<br> pCooF:<br />
<br> MW: 57 kDa<br />
<br> 200 ng in 8 ul<br />
<br> 200x10-9 / 57kDa= 3.5 pmol<br />
<br> pCooM: <br />
<br> MW: ~66kDa<br />
<br> 264ng in 8ul<br />
<br> 264x10-9 / 66 kDa= 4 pmol<br />
<br />
<br> CooA:<br />
<br> MW: 48 kDa<br />
<br> 1ug/ul in 500ul <br />
<br> 12ul is added to reaction mix. <br />
<br> Reduced protein is 2ul DTT added into 1000 ul CooA. <br />
<br> Reduced +CO is degassed, reduced with DTT and 5 min CO is sparged. <br />
<br />
<br> Binding Reaction <br />
<br> Binding solution (2X)<br />
<br> 80ul 1M TRIS-HCl (ph:7.6)<br />
<br> 1120ul 25mM MgCl2<br />
<br> 40ul 5M KCl<br />
<br> 40ul 1M DTT<br />
<br> 100ul glycerol<br />
<br> 20 ul 10mg/ml BSA<br />
<br> 20ul 170 mM sodium dithionate <br />
<br> 580ul pure water<br />
<br> Reactions:<br />
tablo<br />
<br> Reaction is incubated 20min at room temperature before running<br />
<br> Run: 100V 1 h at 4C<br />
<br> Staining: After run is compleated, gel is staining with Et-Br by shaking for 15 min to stain DNA.<br />
<br> Results:<br />
D11<br />
<br> We cannot get a clear image of the gel because of uneven polymerization of the gel. We think the argon amount is too much so our gel cannot solidify properly. DNA marker which cannot be open accurately is the evidence for failed polymerization<br />
<br />
<br> <h2>4. ITF</h2><br />
<br />
<br> Intrinsic Tryptophan Fluorescence (ITF) <br />
<br> Samples<br />
<br> DNA: 28 Nm ; 56 Nm ; 74 nM : 93 nM pCooF (eluted with elution buffer )<br />
<br> Protein: 50 nM reduced –CO bounded; reduced; oxidized CooA <br />
<br> Buffer s <br />
<br> For oxidized CooA : 2X Buffer <br />
<br> -40 mM Tris-HCl ( pH: 7.6)<br />
<br> - 14 mM MgCl2<br />
<br> - 100 mM KCl <br />
<br> -10 % glycerol <br />
<br> For reduced –CO bounded & reduced CooA : 2X buffer <br />
<br />
<br> -40 mM Tris-HCl (ph:7.6)<br />
<br> - 14 mM MgCl2<br />
<br> - 100 mM KCl <br />
<br> -10 % glycerol <br />
<br> -20 mM DTT <br />
<br> -3.4 mM sodium dithionite<br />
<br />
<br> Parameters:<br />
<br> Excitation: 280 nm <br />
<br> Emission: 300- 400 nm <br />
<br> Slit number: 4 nm ( 2 turn) <br />
<br> Temperature: 25 C <br />
<br> Blank: buffer (1X) <br />
<br />
<br> Measurements <br />
<br> 1 -Blank: 1X buffer ( for oxidized , reduced-CO / reduced CooA ) <br />
<br> 2- 50 nM oxidized CooA in oxidized buffer <br />
<br> 3- 50 nM oxidized CooA+ 28 nM pCOOF + 20. Min <br />
<br> 4- Negative control :50 nM oxidized CooA + 10 ul elution buffer + 20. Min<br />
<br> 5- 50 nM oxidized CooA+ 56 nM pCOOF + 40. Min<br />
<br> 6- Negative control : 50 nM oxidized CooA + 20 ul elution buffer + 40. Min<br />
<br> 7- 50 nM reduced –CO bounded CooA in reduced buffer <br />
<br> 8- 50 nM reduced –CO bounded CooA + 28 nM pCOOF + 20 min <br />
<br> 9- Negative control : 50 nM reduced –CO bounded CooA + 10 ul elution buffer + 20. min<br />
<br> 10-50 nM reduced –CO bounded CooA + 56 nM pCOOF + 40. Min<br />
<br> 11-Negative control :50 nM reduced –CO bounded CooA + 20 ul elution buffer + 40. Min<br />
<br> 12- 50 nM reduced –CO bounded CooA + 74 nM pCOOF + 60. Min<br />
<br> 13-Negative control: 50 nM reduced –CO bounded CooA + 30 ul elution buffer + 60. Min<br />
<br> 14-50 nM reduced –CO bounded CooA + 93 nM pCOOF + 80. Min<br />
<br> 15- Negative control: 50 nM reduced –CO bounded CooA + 40 ul elution buffer + 80.min<br />
<br> 16-50 nM reduced CooA in reduced buffer <br />
<br> 17- 50 nM reduced CooA + 28 nM pCOOF + 20. Min<br />
<br> 18-Negative control: 50 nM reduced CooA + 10 ul elution buffer + 20. Min<br />
<br> 19- 50 nM reduced CooA + 56 nM pCOOF + 40.min<br />
<br> 20-Negative control: 50 nM reduced CooA + 20 ul elution buffer + 40.min<br />
<br />
<br> Result :<br />
<br />
D13<br />
<br> yellow : red/Co 28 nM pcoof 20 .min<br />
<br />
<br> pink:red/ CO + buffer <br />
<br />
<br> blue: red/ CO 56 nM pcoof 40. min <br />
<br />
<br> green: NC red/ co 10 ul elution buffer 20.min <br />
<br />
<br> purple: NC red/ CO 20 ul elution 40. min <br />
<br />
D14<br />
<br />
<br> Blue line : reduced –CO bounded CooA + 56 nM pCOOf <br />
<br> White line :oxidized CooA + 56 nM pCOOF <br />
<br />
<br> <h3>Conclusion: </h3><br />
<br> The structure of the CooA protein has two residues of Tryptophan. Carbon monoxide binding to protein and DNA binding to protein can cause conformational change in the protein structure so tryptophan orientation change in the protein . Intrinsic tryptophan fluorescence experiment shows that any fluorescence intensity change and fluorescence shift resulting from the change of tryptophan. We see a little difference between binding of promoter of oxidized and reduced CO bounded CooA protein. Decrease in the intensity is obtained. The structure of CooA is given above :<br />
D12</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Delta
Team:METU Turkey/Delta
2010-10-28T03:06:36Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br />
<br />
<br />
<br> <h2>PROTEIN-DNA INTERACTIONS</h2><br />
<br />
<br> Aim:<br />
<br> To show the interaction thermodynamics of COOA protein and target promoter pCooF and pCooM and changes in binding affinity of protein with respect to mutational changes in its target DNA. <br />
<br />
<br> Methods<br />
<br> - Isothermal Titration Calorimetry (ITC)<br />
<br> - Electrophoretic Mobility Shift Assay (EMSA)<br />
<br > - Intrinsic Tryptophan Fluorescence (ITF)<br />
<br />
<br>Both these methods require short oligonucleotides as DNA template and especially for ITC experiment we need high amounts of DNA template. In order to propagate enough DNA, we design primers for promoters and sequences, which include response elements. <br />
<br> 1.Isothermal Titration Calorimetry (ITC)<br />
<br />
<br> Scenarios for DNA component preparation:<br />
<br />
<br> 30bp<br />
<br> The possible sequence of oligonucleotide that we are planning to use in ITC measurements:<br />
<br> GGA TAA CTG TCA TCT GGC CGA CAG ACG GGG <br />
<br>Response (RE) Response (RE)<br />
<br> Element Element <br />
<br />
<br>- MW : 18594.2 g/mole<br />
<br> - GC content: 60% <br />
<br> - Length: 30bp<br />
<br> - Average MW of a base is 325 g/mole (our MW prediction is applicable acc to that info.)<br />
<br> - for an ITC experiment min 1uM DNA ( max: 100uM) is required in sample cell (Vcell 1.8mL)<br />
<br> - we will prepare 2.5 mL per experiment ( it is calculated as 2.5 nmole - 18kDa x 2.5nmole= 45ug)<br />
<br> - for 1uM DNA we require 45ug DNA in 2.5 mL <br />
<br />
<br> If we propagate our oligonucleotide w/ PCR: <br />
<br> - min 70 bp is required for using a QIAGEN PCR purification kit >>>it is problem for us<br />
<br> - max yield is 10ug <br />
<br> - so we will use 5 kit per experiment for getting 45ug <br />
<br />
<br />
<br />
<br>50bp <br />
<br> TAA AAA CTC TGG ATA ACT GTC ATC TGG CCG ACA GAC GGG GGC CGG GCT TT <br />
<br> - Length: 50bp <br />
<br> - MW: 30773g/mole ~31 kDa<br />
<br> - for ITC 1uM (Vcell = 2.5 mL) <br />
<br> 1umol in 1 L ; so we need 2.5nmole for 2.5 mL <br />
<br>1 mole is nearly 31000 g ; so we need 77.7 ug - w/ invitrogen plasmid purification kit we get 800ug plasmids from 100ml culture - we can extract 800ug plasmid from 2ml culture - if we assume that our vector plasmid is nearly 5000bp long, it will be 100 fold of our fragment DNA (50bp) - 800/100 we get 8ug fragments after restriction digestion.<br />
<br> - w/ qiagen gel extraction kit we can get 10ug DNA once <br />
<br> - so, we need 8 kit gel extraction and 10 plasmid purification kit for one ITC experiment <br />
<br> - 50bp fragment recovery 50% (Fermentas)<br />
<br> - for 50 bp we require ~80ug<br />
<br> - one kit elutes 25x 0.05= 12.5ug in once<br />
<br> - for 80ug we require 80/12.5= 6.4= 7 <br />
<br />
<br />
<br> <h3>Experimental plan [Best Case]</h3><br />
<br />
<br> - Full plasmid is used as template <br />
<br> - Plasmids from Mr Gene : about 3 weeks <br />
<br> -Plasmids from Mr gene last year <br />
<br> -pAny-amphicilline<br />
<br> -2300bp+gene <br />
<br> -5 ug<br />
<br> - our DNA components is 137 bp >>>Total palsmid lenght is about 2500 bp. <br />
<br> - average MW of a base is 325 g/mole<br />
<br> - MW: 325 x 2500 x 2 = 1625000 g/mole<br />
<br> - V(sample cell) = 2.5 ml<br />
<br> - we assume that we use 1 uM DNA <br />
<br> - so we need 2.5 nmole DNA<br />
<br> - for 2.5 nmole we require 2.5 x 1625000= 4062500x10^-9 ng = 1063 x 10^-6 = ~4mg <br />
<br> - transformation of the plasmids (2days)<br />
<br> - plasmid purification (3rd day)<br />
<br> - Invitrogen PureLink™ HiPure Plasmid Gigaprep Kit<br />
<br> - Cat. No. K2100-09<br />
<br> - Unit Size 2 preps<br />
<br> - DNA yield is 7.5mg- 10mg (depends on copy number type, size)<br />
<br> - Invitrogen PureLink™ HiPure Plasmid Megaprep Kit<br />
<br> - Cat. No. K2100-08<br />
<br> - Unit Size 4 preps<br />
<br> - DNA yield is 1.5mg-2.5mg (depends on copy number type, size)<br />
<br> - we can get ~4mg plasmid by using 2 x megakit or 1x gigakit<br />
<br />
<br />
<br> - confirmation of transformation w/ single cut and restriction digestion gel (3rd day)<br />
<br> - Gel extraction (4th day) <br />
<br> - PureLink™ Quick Gel Extraction and PCR Purification Combo Kit<br />
<br> - Cat. No. K220001<br />
<br> - Unit Size: 50 prep<br />
<br> - DNA yield is 40ug <br />
<br> - Unit size 50 prep<br />
<br />
<br> - we can get 4mg plasmid by using 100 kit :( <br />
<br> - we search plasmid isolation kit which gives more yield than usual. <br />
<br />
<br />
<br />
<br> Richie Rich (50 bp case)<br />
<br> - 50 bp seq is 77.5 ug/mol (~80 ug/mol)<br />
<br> - we need 2.5 ml so 2.5 nmol for 1 uM in sample cell<br />
<br> - IDT sends 100 nmol (4 nmol after HPLC) ds 50 bp oligo which costs 200 USA dolars in total<br />
<br> - we can perform 2 experiments from one oligo order<br />
<br> - we need 2.5 nmol DNA per experiment. If we make optimization with WT Response Element, we will make al least 8 experiment. <br />
<br> - w/ mutants 10 oligos in total<br />
<br> - 10 experiment x 2.5 nmol = 25 nmol (after HPLC)<br />
<br> - To be ordered 625 nmol >>> 1.750 TL >>> ~1250 USA dollars :(<br />
<br />
<br> IDT Contact <br />
<br> - 100 nmole DNA is € 0.46 /base. <br />
<br> - Annealing is € 23,00/duplex.<br />
<br> - For 50 bp cost is € 69,00. <br />
<br> - Shipping to Turkey is € 50,00.<br />
<br> - lyophilized <br />
<br> - You should have 6 OD of duplex which is 12 nmole depending upon sequence composition.<br />
<br />
<br> Primer Design <br />
<br> pcooF<br />
<br />
<br> forward: 5' TAAAAACTCTGGATAAC <br />
<br />
<br> - Avoid polyXs YES<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] YES <br />
<br> - Length: 17<br />
<br> - GC : 29%<br />
<br> - Tm : 37C<br />
<br> - self complementarity NONE<br />
<br> OR<br />
<br> forward: 5' ccgaattcgcggccgcttctagagCTCTGGATAAC >>>>is it better?<br />
<br />
<br> - Avoid polyXs NO<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] YES <br />
<br> - Length: 11<br />
<br> - GC : 45% YES<br />
<br> - Tm: 32 C<br />
<br> - self complementarity NONE<br />
<br />
<br> reverse: 5' cctactagtagcggccgctgcagAAAAGCCCGGCCCCGTC<br />
<br> - Avoid polyXs YES<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) NO<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 17<br />
<br> - GC : 71%<br />
<br> - Tm: 54 C <br />
<br> - self complementarity NONE<br />
<br> - All potential self-annealing sites are marked in red (allowing 1 mis-match):<br />
<br />
<br> 5' AAAAGCCCGGCCCCGTC 3'<br />
<br> 3' CTGCCCCGGCCCGAAAA 5'<br />
<br />
<br> 5' AAAAGCCCGGCCCCGTC 3'<br />
<br> 3' CTGCCCCGGCCCGAAAA 5'<br />
<br />
<br> OR<br />
<br> reverse: 5' cctactagtagcggccgctgcagGCCCGGCCCCGTC<br />
<br> - Avoid polyXs NO (yinr de gg cc tekrarları var)<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) NO<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 13<br />
<br> - GC : 92% NO<br />
<br> - Tm: 50 C<br />
<br> - self complementarity NONE<br />
<br> - hairpin: NONE<br />
<br />
<br> pCooM<br />
<br> forward: 5' ccgaattcgcggccgcttctagagACAGCATGACGAG <br />
<br> - Avoid polyXs NO <br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) NO<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 13<br />
<br> - GC : 54 % NO<br />
<br> - Tm: 40 C<br />
<br> - self complementarity NONE<br />
<br> - hairpin: NONE<br />
<br />
<br> reverse: 5' cctactagtagcggccgctgcagCGCCACCTGGGCG <br />
<br> - Avoid polyXs NO <br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) NO<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 13<br />
<br> - Tm: 48 C<br />
<br> - self complementarity NONE<br />
<br> - hairpin: NONE<br />
<br />
<br> Short primer design <br />
<br> pcooF: >>> OK CATAAAAACTCTGGATAACTGTCATCTGGCCGACAGACGGGGCCGGGCTTTTTGTCG<br />
<br> - Length: 57<br />
<br> - GC : 53%<br />
<br> - Tm : 75 C<br />
<br> <br />
<br />
<br> forward: 5' CATAAAAACTCTGG<br />
<br> - Avoid polyXs NO<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 14<br />
<br> - GC : 36%<br />
<br> - Tm : 32C<br />
<br> - hairpin: NONE<br />
<br> - self dimer (free energy): 0<br />
<br> - cross dimer (free energy): 0<br />
<br />
<br> reverse: 5' CGACAAAAAGC<br />
<br> - Avoid polyXs YES<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO <br />
<br> - Length: 11<br />
<br> - GC : 45%<br />
<br> - Tm : 32C<br />
<br> - MW: 3343 g/mole<br />
<br> - hairpin: NONE<br />
<br> - self dimer (free energy): 0<br />
<br> - cross dimer (free energy): 0<br />
<br />
<br> pcooM: >>> OK GAGTGTCGGCCAAGTGACG<br />
<br> forward: 5' ACAGCATGAC<br />
<br> - Avoid polyXs YES<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] YES <br />
<br> - Length: 10<br />
<br> - GC : 50%<br />
<br> - Tm : 30C<br />
<br> - MW: 3021 g/mole<br />
<br> - hairpin: NONE<br />
<br> - self dimer (free energy): -2.3<br />
<br> - cross dimer (free energy): 0<br />
<br />
<br> reverse: 5' AGTACGCCAC<br />
<br> - Avoid polyXs YES<br />
<br> - 3’ end: Avoid T (greater tolerance of mismatch) YES<br />
<br> - 3′ end: G or C (stronger clamping to the template) [Fernandez] YES<br />
<br> - 3′ end region: only 2 G or C in the last 5 [Sayler Lab] NO<br />
<br> - Length: 10<br />
<br> - GC : 60%<br />
<br> <br />
<br> - MW: 2997 g/mole<br />
<br> - hairpin: NONE<br />
<br> - self dimer (free energy): -2.0<br />
<br> - cross dimer (free energy): 0<br />
<br />
<br />
<br />
<br> Preparation of DNA Component<br />
<br />
<br> DNA Components to be produced<br />
<br />
<br> Promoters:<br />
<br />
- <br> pCooM<br />
- <br> pCooF<br />
- <br> pCooF C4G<br />
- <br> pCooF C9G<br />
- <br> pCooF G2C<br />
- <br> pCooF G7C<br />
<br />
<br> Response Elements (RE)<br />
<br />
- <br> pCooM<br />
- <br> pCooF<br />
- <br> pCooF C4G<br />
- <br> pCooF C9G<br />
- <br> pCooF G2C<br />
- <br> pCooF G7C<br />
<br />
<br> 1.Transformation <br />
<br />
<br> 2.Plasmid purification <br />
<br> It is started with 5ml overnight culture from glycerol stock<br />
<br> Fermentas Gene jet miniprep kit is used<br />
<br> Final volume is 50ul <br />
<br />
<br> 3. Restriction digestion for confirmation of the plasmids<br />
Fermentas fast digest kit is used<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D1.jpg"></a></div></html><br />
<br />
<br />
<br> 4.Concentration measurement with alpha UV spectrophotometer<br />
<br />
<br />
<br> 5.PCR for promoters<br />
<br> Primers: <br />
<br> Primers for pCooF promoter/mutants: <br />
<br> Long promoter<br />
<br />
<br> Forward: CCGAATTCGCGGCCGCTTCTAGAGTTCGGCGTCTTTTCATACCC<br />
<br> Reverse: CTACTAGTAGCGGCCGCTGCAGCCTGGCGCCGAGTAAGC<br />
<br />
<br> Short promoter <br />
<br />
<br> forward: TTCGGCGTCTTTTCATACCC<br />
<br> reverse: CCTGGCGCCGAGTAAGC<br />
<br> primers for pCooM promoter:<br />
<br> long promoter<br />
<br> forward: CCGAATTCGCGGCCGCTTCTAGAGCAGCATGACGAGTGTCGGCCAAG<br />
<br> reverse: CCTACTAGTAGCGGCCGCTGCAGGAAGAACGGGAGTACGCCACCTG<br />
<br />
<br> short promoter<br />
<br />
<br> forward: CAGCATGACGAGTGTCGGCCAAG<br />
<br> reverse: GAAGAACGGGAGTACGCCACCTG<br />
<br />
<br />
<br> PCR reaction mix (fermantas) for 1 reaction:<br />
<br />
<br> 10X Taq Buffer 3ul<br />
<br> dNTPs 3ul<br />
<br> 25mM MgCl2 3ul<br />
<br> f-primer 3ul<br />
<br> r-primer 3ul<br />
<br> 5 u/ul Taq polymerase 0.25ul<br />
<br> 2.5u/ul Pfu polymerase 0.015ul<br />
<br> Template 3ul<br />
<br> Nuc free H2O 11.75ul<br />
<br />
<br> TOTAL: 30ul<br />
<br />
<br />
<br> PCR reaction conditions (Techne TC-512)<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:PCR_reaction_(1).JPG"></a></div></html><br />
<br />
<br />
<br> <h3>6.Agarose gel electrophoresis</h3><br />
<br> - % 1 agarose<br />
<br> - 75V<br />
<br> - 45 min<br />
<br />
<br> pCooF promoter <br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D2.jpg"></a></div></html> <br />
<br> pCooF mutant C4G <br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D3.jpg"></a></div></html> <br />
<br> pCooF mutantC9G<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D4.jpg"></a></div></html> <br />
<br> pCooF mutant G2C<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D5.jpg"></a></div></html><br />
<br> pCooF G7C <br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D6.jpg"></a></div></html> <br />
<br> pCooM promoter(long)<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D7.jpg"></a></div></html><br />
<br />
<br> 7.Gel extraction<br />
<br> Gene jet gel extraction kit is used<br />
<br />
<br> 8.Concentration of samples with vacuum concentrator<br />
<br> 1hr in 200mbar for 100 ul reduction<br />
<br />
<br> 9.Concentration measurement with alpha uv spectrophotometer<br />
<br />
<br />
<br> 10.PCR for response element<br />
<br> Primers<br />
<br> primers for pCooF/mutants RE<br />
<br> forward: CATAAAAACTCTGG<br />
<br> reverse: CGACAAAAAGC<br />
<br />
<br> primers for pCooM RE<br />
<br> forward: ACAGCATGAC<br />
<br> reverse: AGTACGCCAC<br />
<br />
<br />
<br> PCR reaction mix (fermantas) for 1 reaction:<br />
<br />
<br> 10X Taq Buffer 3ul<br />
<br> dNTPs 3ul<br />
<br> 25mM MgCl2 3ul<br />
<br> f-primer 3ul<br />
<br> r-primer 3ul<br />
<br> 5 u/ul Taq polymerase 0.25ul<br />
<br> 2.5u/ul Pfu polymerase 0.015ul<br />
<br> Template 3ul<br />
<br> Nuc free H2O 11.75<br />
<br />
<br> TOTAL: 30ul<br />
<br />
<br />
<br> PCR conditions<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:Pcr_conditions.JPG"></a></div></html><br />
<br />
<br />
<br />
<br> <h2> 1. Agarose gel electrophoresis for RE</h2><br />
<br> - % 1 agarose<br />
<br> - 100V<br />
<br> - 75 min<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://2010.igem.org/Image:D8.jpg"></a></div></html><br />
<br />
<br />
<br> <h3>12. Gel extraction </h3><br />
<br> Gene jet gel extraction kit is used<br />
<br> <h3>13.Concentration measurement with alpha uv spectrophotometer</h3><br />
<br />
<br> Oligonucleotides that include response elements are too short (57bp). Although we reach the good amount of products from the Agarose gel electrophoresis, we lost most of our samples during the gel extraction process, because the recovery of the gel extraction kit reduces with oligos shorter than 100bp. Therefore, we had to use promoters (~100bp) rather than response elements. <br />
Unfortunately, ITC experiments cannot be performed because of inadequate production of DNA and protein components. <br />
<br />
<br> <h2> 2. EMSA</h2><br />
<br> 151010-EMSA (w/ Lightshift Chemiluminescence EMSA Kit (PIERCE))<br />
<br> Gel<br />
<br> 8.3ml 30% polyacrylamide solution (29:1)<br />
<br> 2.5ml 10X TBE <br />
<br> 39.2ml ddH2O<br />
<br> 50ul TEMED<br />
<br> 500ul APS (10%)<br />
<br> DNA&PROTEIN:<br />
<br> pCooM: <br />
<br> MW: ~66kDa<br />
<br> 330ng in 10ul<br />
<br> 330x10-9 / 66 kDa= 5 pmol<br />
<br> pCooF:<br />
<br> MW: 57 kDa<br />
<br> 91.6ng in 10 ul<br />
<br> 91.6x10-9 / 57kDa= 1.7 pmol<br />
<br> CooA:<br />
<br> MW: 48 kDa <br />
<br> 1ug/ul in 500 ul <br />
<br> Oxidized protein is untreated CooA<br />
<br> Reduced protein is 2ul DTT added into 1000 ul CooA<br />
<br> Reduced +CO is degassed, reduced with DTT and 5 min CO is sparged. <br />
<br> Binding Reaction Component (w/ Lightshift Chemiluminescence EMSA Kit (PIERCE))<br />
tablo<br />
<br> Reactions:<br />
tablo<br />
<br> Reaction is incubated 20min at 4C and 20 min at room temperature before running<br />
<br> Pre run: 100V 45min at 4C<br />
<br> Run: 100V 1 h at 4C<br />
<br> Staining: After run is compleated, gel is staining with Et-Br by shaking 30 min to stain DNA.<br />
<br> Results:<br />
D9<br />
<br> In conclusion, there is not a meaningful retardation. Binding conditions may not be sustained because gel is not anoxic. Not only reaction buffer but also running buffer and gel should have to be reduced for proper binding of CooA to the DNA<br />
<br />
<br> EMSA[211010] [He at al. (1995)]<br />
<br> Gel<br />
<br> 6% polyacryamide gel <br />
<br> 8.3ml 30% polyacrylamide solution (29:1)<br />
<br> 2.5ml 10X TBE <br />
<br> 39.2ml ddH2O<br />
<br> 50ul TEMED<br />
<br> 500ul APS (10%)<br />
<br> 3 ml 170 mM sodium dithionite <br />
<br> DNA&PROTEIN:<br />
<br> pCooM: <br />
<br> MW: ~66kDa<br />
<br> 330ng in 10ul<br />
<br> 330x10-9 / 66 kDa= 5 pmol<br />
<br />
<br> pCooF:<br />
<br> MW: 57 kDa<br />
<br> 91.6ng in 10 ul<br />
<br> 91.6x10-9 / 57kDa= 1.7 pmol<br />
<br> CooA:<br />
<br> MW: 48 kDa<br />
<br> 1ug/ul in 500 ul <br />
<br> Reduced protein is 2ul DTT added into 1000 ul CooA. <br />
<br> Reduced +CO is degassed, reduced with DTT and 5 min CO is sparged. <br />
<br />
<br> Reactions:<br />
tablo<br />
<br> Reaction is incubated 20min at 4C and 20 min at room temperature before running<br />
<br> Pre run: 100V 45min at 4C<br />
<br> Run: 100V 1. 5 hrs at 4C<br />
<br> Staining: After run is completed, gel is staining with Et-Br by shaking 15 min to stain DNA.<br />
<br> Results: <br />
D10<br />
<br />
<br> In conclusion, there is a little retardation. Binding conditions may not be sustained because gel is not anoxic. Not only reaction buffer but also running buffer and gel should have to be reduced for proper binding of CooA to the DNA. <br />
<br> EMSA [231010]<br />
<br> Gel<br />
<br> 8.3ml 30% polyacrylamide solution (29:1)<br />
<br> 2.5ml 10X TBE <br />
<br> 39.2ml ddH2O<br />
<br> 50ul TEMED<br />
<br> 500ul APS (10%)<br />
<br> Argon is sparged for 5 min to get an anoxic gel <br />
<br> 45min pre-run is completed at 100V before reaction in order to remove APS/TEMED<br />
<br> 1.7mM sodium dithionate is added in to the running buffer <br />
<br> DNA&PROTEIN:<br />
<br> pCooF:<br />
<br> MW: 57 kDa<br />
<br> 200 ng in 8 ul<br />
<br> 200x10-9 / 57kDa= 3.5 pmol<br />
<br> pCooM: <br />
<br> MW: ~66kDa<br />
<br> 264ng in 8ul<br />
<br> 264x10-9 / 66 kDa= 4 pmol<br />
<br />
<br> CooA:<br />
<br> MW: 48 kDa<br />
<br> 1ug/ul in 500ul <br />
<br> 12ul is added to reaction mix. <br />
<br> Reduced protein is 2ul DTT added into 1000 ul CooA. <br />
<br> Reduced +CO is degassed, reduced with DTT and 5 min CO is sparged. <br />
<br />
<br> Binding Reaction <br />
<br> Binding solution (2X)<br />
<br> 80ul 1M TRIS-HCl (ph:7.6)<br />
<br> 1120ul 25mM MgCl2<br />
<br> 40ul 5M KCl<br />
<br> 40ul 1M DTT<br />
<br> 100ul glycerol<br />
<br> 20 ul 10mg/ml BSA<br />
<br> 20ul 170 mM sodium dithionate <br />
<br> 580ul pure water<br />
<br> Reactions:<br />
tablo<br />
<br> Reaction is incubated 20min at room temperature before running<br />
<br> Run: 100V 1 h at 4C<br />
<br> Staining: After run is compleated, gel is staining with Et-Br by shaking for 15 min to stain DNA.<br />
<br> Results:<br />
D11<br />
<br> We cannot get a clear image of the gel because of uneven polymerization of the gel. We think the argon amount is too much so our gel cannot solidify properly. DNA marker which cannot be open accurately is the evidence for failed polymerization<br />
<br />
<br> <h2>4. ITF</h2><br />
<br />
<br> Intrinsic Tryptophan Fluorescence (ITF) <br />
<br> Samples<br />
<br> DNA: 28 Nm ; 56 Nm ; 74 nM : 93 nM pCooF (eluted with elution buffer )<br />
<br> Protein: 50 nM reduced –CO bounded; reduced; oxidized CooA <br />
<br> Buffer s <br />
<br> For oxidized CooA : 2X Buffer <br />
<br> -40 mM Tris-HCl ( pH: 7.6)<br />
<br> - 14 mM MgCl2<br />
<br> - 100 mM KCl <br />
<br> -10 % glycerol <br />
<br> For reduced –CO bounded & reduced CooA : 2X buffer <br />
<br />
<br> -40 mM Tris-HCl (ph:7.6)<br />
<br> - 14 mM MgCl2<br />
<br> - 100 mM KCl <br />
<br> -10 % glycerol <br />
<br> -20 mM DTT <br />
<br> -3.4 mM sodium dithionite<br />
<br />
<br> Parameters:<br />
<br> Excitation: 280 nm <br />
<br> Emission: 300- 400 nm <br />
<br> Slit number: 4 nm ( 2 turn) <br />
<br> Temperature: 25 C <br />
<br> Blank: buffer (1X) <br />
<br />
<br> Measurements <br />
<br> 1 -Blank: 1X buffer ( for oxidized , reduced-CO / reduced CooA ) <br />
<br> 2- 50 nM oxidized CooA in oxidized buffer <br />
<br> 3- 50 nM oxidized CooA+ 28 nM pCOOF + 20. Min <br />
<br> 4- Negative control :50 nM oxidized CooA + 10 ul elution buffer + 20. Min<br />
<br> 5- 50 nM oxidized CooA+ 56 nM pCOOF + 40. Min<br />
<br> 6- Negative control : 50 nM oxidized CooA + 20 ul elution buffer + 40. Min<br />
<br> 7- 50 nM reduced –CO bounded CooA in reduced buffer <br />
<br> 8- 50 nM reduced –CO bounded CooA + 28 nM pCOOF + 20 min <br />
<br> 9- Negative control : 50 nM reduced –CO bounded CooA + 10 ul elution buffer + 20. min<br />
<br> 10-50 nM reduced –CO bounded CooA + 56 nM pCOOF + 40. Min<br />
<br> 11-Negative control :50 nM reduced –CO bounded CooA + 20 ul elution buffer + 40. Min<br />
<br> 12- 50 nM reduced –CO bounded CooA + 74 nM pCOOF + 60. Min<br />
<br> 13-Negative control: 50 nM reduced –CO bounded CooA + 30 ul elution buffer + 60. Min<br />
<br> 14-50 nM reduced –CO bounded CooA + 93 nM pCOOF + 80. Min<br />
<br> 15- Negative control: 50 nM reduced –CO bounded CooA + 40 ul elution buffer + 80.min<br />
<br> 16-50 nM reduced CooA in reduced buffer <br />
<br> 17- 50 nM reduced CooA + 28 nM pCOOF + 20. Min<br />
<br> 18-Negative control: 50 nM reduced CooA + 10 ul elution buffer + 20. Min<br />
<br> 19- 50 nM reduced CooA + 56 nM pCOOF + 40.min<br />
<br> 20-Negative control: 50 nM reduced CooA + 20 ul elution buffer + 40.min<br />
<br />
<br> Result :<br />
<br />
D13<br />
<br> yellow : red/Co 28 nM pcoof 20 .min<br />
<br />
<br> pink:red/ CO + buffer <br />
<br />
<br> blue: red/ CO 56 nM pcoof 40. min <br />
<br />
<br> green: NC red/ co 10 ul elution buffer 20.min <br />
<br />
<br> purple: NC red/ CO 20 ul elution 40. min <br />
<br />
D14<br />
<br />
<br> Blue line : reduced –CO bounded CooA + 56 nM pCOOf <br />
<br> White line :oxidized CooA + 56 nM pCOOF <br />
<br />
<br> <h3>Conclusion: </h3><br />
<br> The structure of the CooA protein has two residues of Tryptophan. Carbon monoxide binding to protein and DNA binding to protein can cause conformational change in the protein structure so tryptophan orientation change in the protein . Intrinsic tryptophan fluorescence experiment shows that any fluorescence intensity change and fluorescence shift resulting from the change of tryptophan. We see a little difference between binding of promoter of oxidized and reduced CO bounded CooA protein. Decrease in the intensity is obtained. The structure of CooA is given above :<br />
D12</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Gallery
Team:METU Turkey/Gallery
2010-10-28T03:02:35Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
----<br />
<br />
<br />
<br> </br><br />
<br />
<br> </br><br />
<div align="center"><br />
<embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="600" height="400" flashvars="host=picasaweb.google.com&hl=en_US&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2Fcanozen2%2Falbumid%2F5478646406318920785%3Falt%3Drss%26kind%3Dphoto%26hl%3Den_US" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Procedures
Team:METU Turkey/Procedures
2010-10-28T02:58:13Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Cloning "><strong>1. Cloning </strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Transformation"><strong>2. Transformation </strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Protein_expression"><strong>3. Protein Expression</strong></a></div></html><br />
<br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/ITF"><strong>4. Intrinsic Tryptophan Fluorescence</strong></a></div></html><br />
<br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Ethanol_precipitation"><strong>5. Ethanol Precipitation</strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/SDS-Page"><strong>6. SDS-Page</strong></a></div></html><br />
<br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Genomic_DNA_purification"><strong>7. Genomic DNA Purification</strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Alkaline_Phosphatasen"><strong>8. Alkaline Phosphatase</strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Competent_Cell_Preparation"><strong>9. Competent Cell Preparation</strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Restriction_Digestion"><strong>10. Restriction Digestion</strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Gel_Extraction"><strong>11. Gel Extraction</strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Cell_Imaging "><strong>12. Cell Imaging </strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Plasmid_purification "><strong>13. Plasmid purification</strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Glycerol_stock_preparation "><strong>14. Glycerol Stock Preparation</strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Isothermal_Titration_Calorimetry (ITC)"><strong>15. Isothermal Titration Calorimetry (ITC)</strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/PCR "><strong>16. PCR</strong></a></div></html><br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/LIGATION "><strong>17. Ligation</strong></a></div></html><br />
<br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/Agarose_Gel_Electrophoresis "><strong>18. Agarose Gel Electrophoresis</strong></a></div></html><br />
<br />
<br />
<br />
<html><br />
<div align="center"><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/PCR_Purification"><strong>19. PCR Purification</strong></a></div></html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Bravo
Team:METU Turkey/Bravo
2010-10-28T02:52:50Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br><h3> Purification with pTriEX vector</h3><br />
<br />
<br> 10/09/26<br />
<br />
<br> Objectives:<br />
<br />
<br> - 0.5 L culture of BL21 pTriEx-Rr-CooA French Pressed <br />
<br> - FPLC <br />
<br />
<br><h3> Standard Experimental Parameters:</h3><br />
<br />
<br> - Tris-HCI buffer is prepared again.<br />
<br> NOTE: As Temperature of Tris-HCl between 25-4 C decrease in 1 unit, pH of buffer increase in 0.003 unit.<br />
<br> - Buffer A:<br />
<br> 20 mM Na2HPO4 [141.96 g/mol] <br />
<br> 1 M NaCl [58.44 g/mol]<br />
<br> pH:7.2<br />
<br> - Buffer B :<br />
<br> Buffer A + Imidazole [6.81 g for 1L buffer A]<br />
<br> - Chelating column charged with zincsulfate-heptahydrate<br />
<br> [Applichem zincsulfate-heptahydrate A3439 ---- 287.54 g/mol] <br />
<br> 1.44 g in 50 mL dH2O (100mM)<br />
<br> - Buffer A for chelating column 900 mL<br />
<br> - Buffer B for chelating column 900 mL<br />
<br> - Cleaning : 1 mL/min Buffer B 5 mL (5dk)<br />
<br> - Wash: 1 mL/min Buffer A 5 mL (5dk)<br />
<br> - 20 mL diluted sample <br />
<br> - 70 mL sample<br />
<br> - 0.5 mL elution tubes<br />
<br> - After FPLC results we combined the C13+C14+C15 tubes and C16+C17 tubes <br />
<br> Pooling fractions = [delay volume/fraction]+tube number<br />
<br> - SDS-Page<br />
<br />
<br> <h3>Purification with QS BL21 pTriEx</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/5/5f/Br4.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/4/43/Br5.jpg"></a></div></html><br />
<br />
<br />
<br />
<br> This is the first experiment of BL21 pTriEx with FPLC. We obeyed the general protein purification procedure except sonication. We lysed pellets with French Press. Then we centrifued the crude lysate @ 32000 g for 60 min. We took a sample for SDS-PAGE. Then we continue with filtration. Filtered crude lysate was looaded to Q-sepharose. According to FPLC graph, we have a sharp peak @ 280nm which contains proteins. We pick up the tubes between 9 and 14. SDS-Page shows the sharp peak contains CooA. F11 is the top of the sharp peak. We also check small peak which corresponds to 46th tube. We combined the F10,F11 and F12 elutes for further purification with chelating sepharose column. <br />
<br />
<br />
<br />
<br> <h3>Purification CS BL21 pTriEx</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/e/eb/Br6.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/c/c9/Br7.jpg "></a></div></html><br />
<br />
<br />
<br> Loaded combined FPLC tubes gave two close picks in CS column. First one corresponds to the CooA. The elutions of CooA are C13,C14 and C15. We combined them for further analyzes with EMSA and ITC and stored @+4. C16 AND C17 are combined to reload to CS column because they are contaminated another protein which is close to 40kDa.<br />
<br />
<br> 10/09/30<br />
<br><h3> Purification QS BL21 with pTriEx</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/f/fd/Br8.jpg "></a></div></html><br />
<br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/7/77/Br9.jpg "></a></div></html><br />
<br />
<br />
<br />
<br> 10/10/10<br />
<br> We desingned an experiment for characterization of CooA pTriEX vector.<br />
<br> We divided 1L culture into :<br />
<br> 7 x 10 ml culture in 50 ml falcon x2 for IPTG concentration test<br />
<br> 1 x 100 ml culture in 500 ml flask w/ Ferric Citrate<br />
<br> 1 x 100 ml culture in 500 ml flask w/out Ferric Citrate<br />
<br> 500 ml culture was used for purification of CooA<br />
<br />
<br> Our parameters was:<br />
<br> IPTG (1mM) w/ Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG (1mM) w/out Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG concentration: 0/0.05/0.5/0.1/0.25/0.5/1/2 mM @5 hours<br />
<br> For purification, we used general protein purification procedure.<br />
<br />
<br> Ferric concentration is 4mg/ml<br />
<br> We harvest 20 ml culture from 100ml flask for each IPTG (1mM) w/ Ferric Citrate and IPTG (1mM) w/out Ferric Citrate at time intervals 3-5-7-9. Then pellets was kept @-80 until sonication<br />
was performed. Pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> IPTG added to falcons:<br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="http://partsregistry.org/wiki/images/4/4f/Bbbbbbbbbbbbbbbbbbbbbbbbbb.jpg"></a></div></html><br />
<br />
<br />
<br> After 5 hours induction with different IPTG concentration, pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> We used french press for 500 ml Culture pellet BL21 pTriEx. We resuspended pellet in 50 ml Buffer A+ 25 ul protease inhibitor. Then Frech press and centrifugation in 32000 g for 60 min was done. The supernatant was used for SDS-PAGE.<br />
<br />
<br> 10/10/10<br />
<br> <h3>Purification QS</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/8/89/Br10.jpg"></a></div></html><br />
<br />
<br />
<br />
<br> Purification QS cont. <br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/3/32/Br11.jpg"></a></div></html><br />
<br />
<br />
<br />
<br />
<br> This gel photos indicate the elutes of 500ml culture which contains Bl21 with pTriEx. The crude lysate was loaded to Q-Sepharose column. In crude lysate, we observe the dimer and monomer forms of CooA. In Elute 27, we obtained high amount of CooA. We measured absorbance of combined @ 280,260 and 420 as respectively ?, ? and ?. CooA concentration was determined as ? uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We used it for further analyzes for EMSA and ITF.<br />
<br />
<br> 10/10/12<br />
<br> <h3>Purification QS</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/0/01/Br12.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="http://partsregistry.org/wiki/images/5/59/BB30.jpg "></a></div></html><br />
<br />
<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,3031,32,33 and 34 to SDS-Gel the elutes which have a high value of OD420 because CooA gives a sorret peak at 420 nm according to Aono.Oxidized CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono. According to OD420 values, we combined the 7 tubes containing 1.5ml between 27-33,concentrated to 1ml and then diluted 10x with CS buffer A.<br />
<br />
<br />
<br> 10/10/12 CS <br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/1/14/Br13.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="http://partsregistry.org/wiki/images/8/8d/BB31.jpg"></a></div></html><br />
<br />
<br />
<br />
<br> According to SDS-GEL, we combined 4,6,7,8 and 9 tubes containing 0,5ml and concentrated to 1ml for furhter analyzes such EMSA and ITF. We measured absorbance of combined @ 280,260 and 420 as respectively 2.76, 2.83 and 0.837. CooA concentration was determined as 7.75 uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We didnot take 5th tube because it contains much more impurities than other tubes.<br />
<br />
<br />
<br> 10/10/21<br />
<br> <h3>Purification QS</h3><br />
<br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/9/93/Br14.jpg"></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="http://partsregistry.org/wiki/images/4/43/BB32.jpg"></a></div></html><br />
<br />
<br />
BB14<br />
<br />
BB32<br />
BB15<br />
<br />
<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,30 and 31 to SDS-Gel the elutes which have a high value of OD420 because oxidized CooA gives a sorret peak at 420 nm according to Aono.CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono.<br />
<br />
<br> <h3>Concentrated CooA</h3><br />
<br />
<br> CooA protein contains heme group therefore its solution is seen yellow to orange<br />
<br />
BB16</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Bravo
Team:METU Turkey/Bravo
2010-10-28T02:41:40Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planing">Planing</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br><h3> Purification with pTriEX vector</h3><br />
<br />
<br> 10/09/26<br />
<br />
<br> Objectives:<br />
<br />
<br> - 0.5 L culture of BL21 pTriEx-Rr-CooA French Pressed <br />
<br> - FPLC <br />
<br />
<br><h3> Standard Experimental Parameters:</h3><br />
<br />
<br> - Tris-HCI buffer is prepared again.<br />
<br> NOTE: As Temperature of Tris-HCl between 25-4 C decrease in 1 unit, pH of buffer increase in 0.003 unit.<br />
<br> - Buffer A:<br />
<br> 20 mM Na2HPO4 [141.96 g/mol] <br />
<br> 1 M NaCl [58.44 g/mol]<br />
<br> pH:7.2<br />
<br> - Buffer B :<br />
<br> Buffer A + Imidazole [6.81 g for 1L buffer A]<br />
<br> - Chelating column charged with zincsulfate-heptahydrate<br />
<br> [Applichem zincsulfate-heptahydrate A3439 ---- 287.54 g/mol] <br />
<br> 1.44 g in 50 mL dH2O (100mM)<br />
<br> - Buffer A for chelating column 900 mL<br />
<br> - Buffer B for chelating column 900 mL<br />
<br> - Cleaning : 1 mL/min Buffer B 5 mL (5dk)<br />
<br> - Wash: 1 mL/min Buffer A 5 mL (5dk)<br />
<br> - 20 mL diluted sample <br />
<br> - 70 mL sample<br />
<br> - 0.5 mL elution tubes<br />
<br> - After FPLC results we combined the C13+C14+C15 tubes and C16+C17 tubes <br />
<br> Pooling fractions = [delay volume/fraction]+tube number<br />
<br> - SDS-Page<br />
<br />
<br> <h3>Purification with QS BL21 pTriEx</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/5/5f/Br4.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/4/43/Br5.jpg"></a></div></html><br />
<br />
<br />
<br />
<br> This is the first experiment of BL21 pTriEx with FPLC. We obeyed the general protein purification procedure except sonication. We lysed pellets with French Press. Then we centrifued the crude lysate @ 32000 g for 60 min. We took a sample for SDS-PAGE. Then we continue with filtration. Filtered crude lysate was looaded to Q-sepharose. According to FPLC graph, we have a sharp peak @ 280nm which contains proteins. We pick up the tubes between 9 and 14. SDS-Page shows the sharp peak contains CooA. F11 is the top of the sharp peak. We also check small peak which corresponds to 46th tube. We combined the F10,F11 and F12 elutes for further purification with chelating sepharose column. <br />
<br />
<br />
<br />
<br> <h3>Purification CS BL21 pTriEx</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/e/eb/Br6.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/c/c9/Br7.jpg "></a></div></html><br />
<br />
<br />
<br> Loaded combined FPLC tubes gave two close picks in CS column. First one corresponds to the CooA. The elutions of CooA are C13,C14 and C15. We combined them for further analyzes with EMSA and ITC and stored @+4. C16 AND C17 are combined to reload to CS column because they are contaminated another protein which is close to 40kDa.<br />
<br />
<br> 10/09/30<br />
<br><h3> Purification QS BL21 with pTriEx</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/f/fd/Br8.jpg "></a></div></html><br />
<br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/7/77/Br9.jpg "></a></div></html><br />
<br />
<br />
<br />
<br> 10/10/10<br />
<br> We desingned an experiment for characterization of CooA pTriEX vector.<br />
<br> We divided 1L culture into :<br />
<br> 7 x 10 ml culture in 50 ml falcon x2 for IPTG concentration test<br />
<br> 1 x 100 ml culture in 500 ml flask w/ Ferric Citrate<br />
<br> 1 x 100 ml culture in 500 ml flask w/out Ferric Citrate<br />
<br> 500 ml culture was used for purification of CooA<br />
<br />
<br> Our parameters was:<br />
<br> IPTG (1mM) w/ Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG (1mM) w/out Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG concentration: 0/0.05/0.5/0.1/0.25/0.5/1/2 mM @5 hours<br />
<br> For purification, we used general protein purification procedure.<br />
<br />
<br> Ferric concentration is 4mg/ml<br />
<br> We harvest 20 ml culture from 100ml flask for each IPTG (1mM) w/ Ferric Citrate and IPTG (1mM) w/out Ferric Citrate at time intervals 3-5-7-9. Then pellets was kept @-80 until sonication<br />
was performed. Pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> IPTG added to falcons:<br />
<br />
bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb<br />
<br />
<br />
<br> After 5 hours induction with different IPTG concentration, pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> We used french press for 500 ml Culture pellet BL21 pTriEx. We resuspended pellet in 50 ml Buffer A+ 25 ul protease inhibitor. Then Frech press and centrifugation in 32000 g for 60 min was done. The supernatant was used for SDS-PAGE.<br />
<br />
<br> 10/10/10<br />
<br> <h3>Purification QS</h3><br />
BB10<br />
<br />
<br> Purification QS cont. <br />
BB11<br />
<br />
<br />
<br> This gel photos indicate the elutes of 500ml culture which contains Bl21 with pTriEx. The crude lysate was loaded to Q-Sepharose column. In crude lysate, we observe the dimer and monomer forms of CooA. In Elute 27, we obtained high amount of CooA. We measured absorbance of combined @ 280,260 and 420 as respectively ?, ? and ?. CooA concentration was determined as ? uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We used it for further analyzes for EMSA and ITF.<br />
<br />
<br> 10/10/12<br />
<br> <h3>Purification QS</h3><br />
<br />
BB12<br />
<br />
BB30<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,3031,32,33 and 34 to SDS-Gel the elutes which have a high value of OD420 because CooA gives a sorret peak at 420 nm according to Aono.Oxidized CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono. According to OD420 values, we combined the 7 tubes containing 1.5ml between 27-33,concentrated to 1ml and then diluted 10x with CS buffer A.<br />
<br />
<br />
<br> 10/10/12 CS <br />
<br />
BB13<br />
<br />
BB31<br />
<br />
<br />
<br> According to SDS-GEL, we combined 4,6,7,8 and 9 tubes containing 0,5ml and concentrated to 1ml for furhter analyzes such EMSA and ITF. We measured absorbance of combined @ 280,260 and 420 as respectively 2.76, 2.83 and 0.837. CooA concentration was determined as 7.75 uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We didnot take 5th tube because it contains much more impurities than other tubes.<br />
<br />
<br />
<br> 10/10/21<br />
<br> <h3>Purification QS</h3><br />
<br />
BB14<br />
<br />
BB32<br />
BB15<br />
<br />
<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,30 and 31 to SDS-Gel the elutes which have a high value of OD420 because oxidized CooA gives a sorret peak at 420 nm according to Aono.CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono.<br />
<br />
<br> <h3>Concentrated CooA</h3><br />
<br />
<br> CooA protein contains heme group therefore its solution is seen yellow to orange<br />
<br />
BB16</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Bravo
Team:METU Turkey/Bravo
2010-10-28T02:35:36Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planing">Planing</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br><h3> Purification with pTriEX vector</h3><br />
<br />
<br> 10/09/26<br />
<br />
<br> Objectives:<br />
<br />
<br> - 0.5 L culture of BL21 pTriEx-Rr-CooA French Pressed <br />
<br> - FPLC <br />
<br />
<br><h3> Standard Experimental Parameters:</h3><br />
<br />
<br> - Tris-HCI buffer is prepared again.<br />
<br> NOTE: As Temperature of Tris-HCl between 25-4 C decrease in 1 unit, pH of buffer increase in 0.003 unit.<br />
<br> - Buffer A:<br />
<br> 20 mM Na2HPO4 [141.96 g/mol] <br />
<br> 1 M NaCl [58.44 g/mol]<br />
<br> pH:7.2<br />
<br> - Buffer B :<br />
<br> Buffer A + Imidazole [6.81 g for 1L buffer A]<br />
<br> - Chelating column charged with zincsulfate-heptahydrate<br />
<br> [Applichem zincsulfate-heptahydrate A3439 ---- 287.54 g/mol] <br />
<br> 1.44 g in 50 mL dH2O (100mM)<br />
<br> - Buffer A for chelating column 900 mL<br />
<br> - Buffer B for chelating column 900 mL<br />
<br> - Cleaning : 1 mL/min Buffer B 5 mL (5dk)<br />
<br> - Wash: 1 mL/min Buffer A 5 mL (5dk)<br />
<br> - 20 mL diluted sample <br />
<br> - 70 mL sample<br />
<br> - 0.5 mL elution tubes<br />
<br> - After FPLC results we combined the C13+C14+C15 tubes and C16+C17 tubes <br />
<br> Pooling fractions = [delay volume/fraction]+tube number<br />
<br> - SDS-Page<br />
<br />
<br> <h3>Purification with QS BL21 pTriEx</h3><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/5/5f/Br4.jpg "></a></div></html><br />
<br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/5/5f/Br5.jpg "></a></div></html><br />
<br />
<br />
<br />
<br> This is the first experiment of BL21 pTriEx with FPLC. We obeyed the general protein purification procedure except sonication. We lysed pellets with French Press. Then we centrifued the crude lysate @ 32000 g for 60 min. We took a sample for SDS-PAGE. Then we continue with filtration. Filtered crude lysate was looaded to Q-sepharose. According to FPLC graph, we have a sharp peak @ 280nm which contains proteins. We pick up the tubes between 9 and 14. SDS-Page shows the sharp peak contains CooA. F11 is the top of the sharp peak. We also check small peak which corresponds to 46th tube. We combined the F10,F11 and F12 elutes for further purification with chelating sepharose column. <br />
<br />
<br />
<br />
<br />
<br />
<br> <h3>Purification CS BL21 pTriEx</h3><br />
<br />
BB6<br />
BB7<br />
<br />
<br> Loaded combined FPLC tubes gave two close picks in CS column. First one corresponds to the CooA. The elutions of CooA are C13,C14 and C15. We combined them for further analyzes with EMSA and ITC and stored @+4. C16 AND C17 are combined to reload to CS column because they are contaminated another protein which is close to 40kDa.<br />
<br />
<br> 10/09/30<br />
<br><h3> Purification QS BL21 with pTriEx</h3><br />
<br />
BB8<br />
BB9<br />
<br />
<br />
<br />
<br />
<br> 10/10/10<br />
<br> We desingned an experiment for characterization of CooA pTriEX vector.<br />
<br> We divided 1L culture into :<br />
<br> 7 x 10 ml culture in 50 ml falcon x2 for IPTG concentration test<br />
<br> 1 x 100 ml culture in 500 ml flask w/ Ferric Citrate<br />
<br> 1 x 100 ml culture in 500 ml flask w/out Ferric Citrate<br />
<br> 500 ml culture was used for purification of CooA<br />
<br />
<br> Our parameters was:<br />
<br> IPTG (1mM) w/ Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG (1mM) w/out Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG concentration: 0/0.05/0.5/0.1/0.25/0.5/1/2 mM @5 hours<br />
<br> For purification, we used general protein purification procedure.<br />
<br />
<br> Ferric concentration is 4mg/ml<br />
<br> We harvest 20 ml culture from 100ml flask for each IPTG (1mM) w/ Ferric Citrate and IPTG (1mM) w/out Ferric Citrate at time intervals 3-5-7-9. Then pellets was kept @-80 until sonication<br />
was performed. Pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> IPTG added to falcons:<br />
<br />
bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb<br />
<br />
<br />
<br> After 5 hours induction with different IPTG concentration, pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> We used french press for 500 ml Culture pellet BL21 pTriEx. We resuspended pellet in 50 ml Buffer A+ 25 ul protease inhibitor. Then Frech press and centrifugation in 32000 g for 60 min was done. The supernatant was used for SDS-PAGE.<br />
<br />
<br> 10/10/10<br />
<br> <h3>Purification QS</h3><br />
BB10<br />
<br />
<br> Purification QS cont. <br />
BB11<br />
<br />
<br />
<br> This gel photos indicate the elutes of 500ml culture which contains Bl21 with pTriEx. The crude lysate was loaded to Q-Sepharose column. In crude lysate, we observe the dimer and monomer forms of CooA. In Elute 27, we obtained high amount of CooA. We measured absorbance of combined @ 280,260 and 420 as respectively ?, ? and ?. CooA concentration was determined as ? uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We used it for further analyzes for EMSA and ITF.<br />
<br />
<br> 10/10/12<br />
<br> <h3>Purification QS</h3><br />
<br />
BB12<br />
<br />
BB30<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,3031,32,33 and 34 to SDS-Gel the elutes which have a high value of OD420 because CooA gives a sorret peak at 420 nm according to Aono.Oxidized CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono. According to OD420 values, we combined the 7 tubes containing 1.5ml between 27-33,concentrated to 1ml and then diluted 10x with CS buffer A.<br />
<br />
<br />
<br> 10/10/12 CS <br />
<br />
BB13<br />
<br />
BB31<br />
<br />
<br />
<br> According to SDS-GEL, we combined 4,6,7,8 and 9 tubes containing 0,5ml and concentrated to 1ml for furhter analyzes such EMSA and ITF. We measured absorbance of combined @ 280,260 and 420 as respectively 2.76, 2.83 and 0.837. CooA concentration was determined as 7.75 uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We didnot take 5th tube because it contains much more impurities than other tubes.<br />
<br />
<br />
<br> 10/10/21<br />
<br> <h3>Purification QS</h3><br />
<br />
BB14<br />
<br />
BB32<br />
BB15<br />
<br />
<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,30 and 31 to SDS-Gel the elutes which have a high value of OD420 because oxidized CooA gives a sorret peak at 420 nm according to Aono.CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono.<br />
<br />
<br> <h3>Concentrated CooA</h3><br />
<br />
<br> CooA protein contains heme group therefore its solution is seen yellow to orange<br />
<br />
BB16</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Bravo
Team:METU Turkey/Bravo
2010-10-28T02:23:18Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planing">Planing</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br><h3> Purification with pTriEX vector</h3><br />
<br />
<br> 10/09/26<br />
<br />
<br> Objectives:<br />
<br />
<br> - 0.5 L culture of BL21 pTriEx-Rr-CooA French Pressed <br />
<br> - FPLC <br />
<br />
<br><h3> Standard Experimental Parameters:</h3><br />
<br />
<br> - Tris-HCI buffer is prepared again.<br />
<br> NOTE: As Temperature of Tris-HCl between 25-4 C decrease in 1 unit, pH of buffer increase in 0.003 unit.<br />
<br> - Buffer A:<br />
<br> 20 mM Na2HPO4 [141.96 g/mol] <br />
<br> 1 M NaCl [58.44 g/mol]<br />
<br> pH:7.2<br />
<br> - Buffer B :<br />
<br> Buffer A + Imidazole [6.81 g for 1L buffer A]<br />
<br> - Chelating column charged with zincsulfate-heptahydrate<br />
<br> [Applichem zincsulfate-heptahydrate A3439 ---- 287.54 g/mol] <br />
<br> 1.44 g in 50 mL dH2O (100mM)<br />
<br> - Buffer A for chelating column 900 mL<br />
<br> - Buffer B for chelating column 900 mL<br />
<br> - Cleaning : 1 mL/min Buffer B 5 mL (5dk)<br />
<br> - Wash: 1 mL/min Buffer A 5 mL (5dk)<br />
<br> - 20 mL diluted sample <br />
<br> - 70 mL sample<br />
<br> - 0.5 mL elution tubes<br />
<br> - After FPLC results we combined the C13+C14+C15 tubes and C16+C17 tubes <br />
<br> Pooling fractions = [delay volume/fraction]+tube number<br />
<br> - SDS-Page<br />
<br />
<br> <h3>Purification with QS BL21 pTriEx</h3><br />
<br />
BB4<br />
BB5<br />
<br />
<br />
<br />
<br> This is the first experiment of BL21 pTriEx with FPLC. We obeyed the general protein purification procedure except sonication. We lysed pellets with French Press. Then we centrifued the crude lysate @ 32000 g for 60 min. We took a sample for SDS-PAGE. Then we continue with filtration. Filtered crude lysate was looaded to Q-sepharose. According to FPLC graph, we have a sharp peak @ 280nm which contains proteins. We pick up the tubes between 9 and 14. SDS-Page shows the sharp peak contains CooA. F11 is the top of the sharp peak. We also check small peak which corresponds to 46th tube. We combined the F10,F11 and F12 elutes for further purification with chelating sepharose column. <br />
<br />
<br />
<br />
<br />
<br />
<br> <h3>Purification CS BL21 pTriEx</h3><br />
<br />
BB6<br />
BB7<br />
<br />
<br> Loaded combined FPLC tubes gave two close picks in CS column. First one corresponds to the CooA. The elutions of CooA are C13,C14 and C15. We combined them for further analyzes with EMSA and ITC and stored @+4. C16 AND C17 are combined to reload to CS column because they are contaminated another protein which is close to 40kDa.<br />
<br />
<br> 10/09/30<br />
<br><h3> Purification QS BL21 with pTriEx</h3><br />
<br />
BB8<br />
BB9<br />
<br />
<br />
<br />
<br />
<br> 10/10/10<br />
<br> We desingned an experiment for characterization of CooA pTriEX vector.<br />
<br> We divided 1L culture into :<br />
<br> 7 x 10 ml culture in 50 ml falcon x2 for IPTG concentration test<br />
<br> 1 x 100 ml culture in 500 ml flask w/ Ferric Citrate<br />
<br> 1 x 100 ml culture in 500 ml flask w/out Ferric Citrate<br />
<br> 500 ml culture was used for purification of CooA<br />
<br />
<br> Our parameters was:<br />
<br> IPTG (1mM) w/ Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG (1mM) w/out Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG concentration: 0/0.05/0.5/0.1/0.25/0.5/1/2 mM @5 hours<br />
<br> For purification, we used general protein purification procedure.<br />
<br />
<br> Ferric concentration is 4mg/ml<br />
<br> We harvest 20 ml culture from 100ml flask for each IPTG (1mM) w/ Ferric Citrate and IPTG (1mM) w/out Ferric Citrate at time intervals 3-5-7-9. Then pellets was kept @-80 until sonication<br />
was performed. Pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> IPTG added to falcons:<br />
<br />
bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb<br />
<br />
<br />
<br> After 5 hours induction with different IPTG concentration, pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> We used french press for 500 ml Culture pellet BL21 pTriEx. We resuspended pellet in 50 ml Buffer A+ 25 ul protease inhibitor. Then Frech press and centrifugation in 32000 g for 60 min was done. The supernatant was used for SDS-PAGE.<br />
<br />
<br> 10/10/10<br />
<br> <h3>Purification QS</h3><br />
BB10<br />
<br />
<br> Purification QS cont. <br />
BB11<br />
<br />
<br />
<br> This gel photos indicate the elutes of 500ml culture which contains Bl21 with pTriEx. The crude lysate was loaded to Q-Sepharose column. In crude lysate, we observe the dimer and monomer forms of CooA. In Elute 27, we obtained high amount of CooA. We measured absorbance of combined @ 280,260 and 420 as respectively ?, ? and ?. CooA concentration was determined as ? uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We used it for further analyzes for EMSA and ITF.<br />
<br />
<br> 10/10/12<br />
<br> <h3>Purification QS</h3><br />
<br />
BB12<br />
<br />
BB30<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,3031,32,33 and 34 to SDS-Gel the elutes which have a high value of OD420 because CooA gives a sorret peak at 420 nm according to Aono.Oxidized CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono. According to OD420 values, we combined the 7 tubes containing 1.5ml between 27-33,concentrated to 1ml and then diluted 10x with CS buffer A.<br />
<br />
<br />
<br> 10/10/12 CS <br />
<br />
BB13<br />
<br />
BB31<br />
<br />
<br />
<br> According to SDS-GEL, we combined 4,6,7,8 and 9 tubes containing 0,5ml and concentrated to 1ml for furhter analyzes such EMSA and ITF. We measured absorbance of combined @ 280,260 and 420 as respectively 2.76, 2.83 and 0.837. CooA concentration was determined as 7.75 uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We didnot take 5th tube because it contains much more impurities than other tubes.<br />
<br />
<br />
<br> 10/10/21<br />
<br> <h3>Purification QS</h3><br />
<br />
BB14<br />
<br />
BB32<br />
BB15<br />
<br />
<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,30 and 31 to SDS-Gel the elutes which have a high value of OD420 because oxidized CooA gives a sorret peak at 420 nm according to Aono.CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono.<br />
<br />
<br> <h3>Concentrated CooA</h3><br />
<br />
<br> CooA protein contains heme group therefore its solution is seen yellow to orange<br />
<br />
BB16</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Bravo
Team:METU Turkey/Bravo
2010-10-28T02:20:36Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planing">Planing</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br> Purification with pTriEX vector<br />
<br />
<br> 10/09/26<br />
<br />
<br> Objectives:<br />
<br />
<br> - 0.5 L culture of BL21 pTriEx-Rr-CooA French Pressed <br />
<br> - FPLC <br />
<br />
<br> Standard Experimental Parameters:<br />
<br />
<br> - Tris-HCI buffer is prepared again.<br />
<br> NOTE: As Temperature of Tris-HCl between 25-4 C decrease in 1 unit, pH of buffer increase in 0.003 unit.<br />
<br> - Buffer A:<br />
<br> 20 mM Na2HPO4 [141.96 g/mol] <br />
<br> 1 M NaCl [58.44 g/mol]<br />
<br> pH:7.2<br />
<br> - Buffer B :<br />
<br> Buffer A + Imidazole [6.81 g for 1L buffer A]<br />
<br> - Chelating column charged with zincsulfate-heptahydrate<br />
<br> [Applichem zincsulfate-heptahydrate A3439 ---- 287.54 g/mol] <br />
<br> 1.44 g in 50 mL dH2O (100mM)<br />
<br> - Buffer A for chelating column 900 mL<br />
<br> - Buffer B for chelating column 900 mL<br />
<br> - Cleaning : 1 mL/min Buffer B 5 mL (5dk)<br />
<br> - Wash: 1 mL/min Buffer A 5 mL (5dk)<br />
<br> - 20 mL diluted sample <br />
<br> - 70 mL sample<br />
<br> - 0.5 mL elution tubes<br />
<br> - After FPLC results we combined the C13+C14+C15 tubes and C16+C17 tubes <br />
<br> Pooling fractions = [delay volume/fraction]+tube number<br />
<br> - SDS-Page<br />
<br />
<br> Purification with QS BL21 pTriEx<br />
<br />
BB4<br />
BB5<br />
<br />
<br />
<br />
<br> This is the first experiment of BL21 pTriEx with FPLC. We obeyed the general protein purification procedure except sonication. We lysed pellets with French Press. Then we centrifued the crude lysate @ 32000 g for 60 min. We took a sample for SDS-PAGE. Then we continue with filtration. Filtered crude lysate was looaded to Q-sepharose. According to FPLC graph, we have a sharp peak @ 280nm which contains proteins. We pick up the tubes between 9 and 14. SDS-Page shows the sharp peak contains CooA. F11 is the top of the sharp peak. We also check small peak which corresponds to 46th tube. We combined the F10,F11 and F12 elutes for further purification with chelating sepharose column. <br />
<br />
<br />
<br />
<br />
<br />
<br> Purification CS BL21 pTriEx<br />
<br />
BB6<br />
BB7<br />
<br />
<br> Loaded combined FPLC tubes gave two close picks in CS column. First one corresponds to the CooA. The elutions of CooA are C13,C14 and C15. We combined them for further analyzes with EMSA and ITC and stored @+4. C16 AND C17 are combined to reload to CS column because they are contaminated another protein which is close to 40kDa.<br />
<br />
<br> 10/09/30<br />
<br> Purification QS BL21 with pTriEx<br />
<br />
BB8<br />
BB9<br />
<br />
<br />
<br />
<br />
<br> 10/10/10<br />
<br> We desingned an experiment for characterization of CooA pTriEX vector.<br />
<br> We divided 1L culture into :<br />
<br> 7 x 10 ml culture in 50 ml falcon x2 for IPTG concentration test<br />
<br> 1 x 100 ml culture in 500 ml flask w/ Ferric Citrate<br />
<br> 1 x 100 ml culture in 500 ml flask w/out Ferric Citrate<br />
<br> 500 ml culture was used for purification of CooA<br />
<br />
<br> Our parameters was:<br />
<br> IPTG (1mM) w/ Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG (1mM) w/out Ferric Citrate: 3/5/7/9 hours<br />
<br> IPTG concentration: 0/0.05/0.5/0.1/0.25/0.5/1/2 mM @5 hours<br />
<br> For purification, we used general protein purification procedure.<br />
<br />
<br> Ferric concentration is 4mg/ml<br />
<br> We harvest 20 ml culture from 100ml flask for each IPTG (1mM) w/ Ferric Citrate and IPTG (1mM) w/out Ferric Citrate at time intervals 3-5-7-9. Then pellets was kept @-80 until sonication<br />
was performed. Pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> IPTG added to falcons:<br />
<br />
bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb<br />
<br />
<br />
<br> After 5 hours induction with different IPTG concentration, pellets was sonicated then centrifugated at 20000g for 20 min. Supernatant was used for SDS-PAGE.<br />
<br />
<br> We used french press for 500 ml Culture pellet BL21 pTriEx. We resuspended pellet in 50 ml Buffer A+ 25 ul protease inhibitor. Then Frech press and centrifugation in 32000 g for 60 min was done. The supernatant was used for SDS-PAGE.<br />
<br />
<br> 10/10/10<br />
<br> Purification QS<br />
BB10<br />
<br />
<br> Purification QS cont. <br />
BB11<br />
<br />
<br />
<br> This gel photos indicate the elutes of 500ml culture which contains Bl21 with pTriEx. The crude lysate was loaded to Q-Sepharose column. In crude lysate, we observe the dimer and monomer forms of CooA. In Elute 27, we obtained high amount of CooA. We measured absorbance of combined @ 280,260 and 420 as respectively ?, ? and ?. CooA concentration was determined as ? uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We used it for further analyzes for EMSA and ITF.<br />
<br />
<br> 10/10/12<br />
<br> Purification QS<br />
<br />
BB12<br />
<br />
BB30<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,3031,32,33 and 34 to SDS-Gel the elutes which have a high value of OD420 because CooA gives a sorret peak at 420 nm according to Aono.Oxidized CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono. According to OD420 values, we combined the 7 tubes containing 1.5ml between 27-33,concentrated to 1ml and then diluted 10x with CS buffer A.<br />
<br />
<br />
<br> 10/10/12 CS <br />
<br />
BB13<br />
<br />
BB31<br />
<br />
<br />
<br> According to SDS-GEL, we combined 4,6,7,8 and 9 tubes containing 0,5ml and concentrated to 1ml for furhter analyzes such EMSA and ITF. We measured absorbance of combined @ 280,260 and 420 as respectively 2.76, 2.83 and 0.837. CooA concentration was determined as 7.75 uM according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. We didnot take 5th tube because it contains much more impurities than other tubes.<br />
<br />
<br />
<br> 10/10/21<br />
<br> Purification QS<br />
<br />
BB14<br />
<br />
BB32<br />
BB15<br />
<br />
<br />
<br />
<br> This purification is done according to general protein purification procedure. BL21 was transformed with our pTriEx plasmid. We loaded 500 ml lik pellet to QS. We looked OD @ 260,280 and 420 according to the colors of the tubes. Yellowish color indicates our CooA protein. Then we looaded 27,28,29,30 and 31 to SDS-Gel the elutes which have a high value of OD420 because oxidized CooA gives a sorret peak at 420 nm according to Aono.CooA concentration was determined according to extinction coefficient of heme(Ferric State) which is 108 mM-1 cm-1 according to Aono. The SDS gel indicates that our protein is colose to 50 kDa in dimer. MW of monomer is estimated 24-25kDa according to Aono.<br />
<br />
<br> Concentrated CooA<br />
<br />
<br> CooA protein contains heme group therefore its solution is seen yellow to orange<br />
<br />
BB16</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Links
Team:METU Turkey/Links
2010-10-28T02:14:22Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
----<br />
<br />
<br> </br><br />
<br><html><br />
<div align="center"><a href="http://www.igem.metu.edu.tr"><strong><h3>METUSYBORG</h3></strong></a></div></html><br />
<br />
<br><html><br />
<div align="center"><a href="http://www.metu.edu.tr"><strong><h3>Middle East Teachnical University</h3></strong></a></div></html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Links
Team:METU Turkey/Links
2010-10-28T02:13:35Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br> </br><br />
<br><html><br />
<div align="center"><a href="http://www.igem.metu.edu.tr"><strong><h3>METUSYBORG</h3></strong></a></div></html><br />
<br />
<br><html><br />
<div align="center"><a href="http://www.metu.edu.tr"><strong><h3>Middle East Teachnical University</h3></strong></a></div></html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Links
Team:METU Turkey/Links
2010-10-28T02:13:14Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br />
<br><html><br />
<div align="center"><a href="http://www.igem.metu.edu.tr"><strong><h3>METUSYBORG</h3></strong></a></div></html><br />
<br />
<br><html><br />
<div align="center"><a href="http://www.metu.edu.tr"><strong><h3>Middle East Teachnical University</h3></strong></a></div></html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Links
Team:METU Turkey/Links
2010-10-28T02:12:45Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br />
<html><br />
<div align="center"><a href="http://www.igem.metu.edu.tr"><strong><h3>METUSYBORG</h3></strong></a></div></html><br />
<br />
<html><br />
<div align="center"><a href="http://www.metu.edu.tr"><strong><h3>Middle East Teachnical University</h3></strong></a></div></html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/Cell_Sensor_Experiments
Team:METU Turkey/Results Discussion/Cell Sensor Experiments
2010-10-28T02:08:39Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br />
<!-- ***** New entry ***** --> <br />
<div class="main_item"> <br />
<h2><br />
2- Cell Sensor Experiments<br />
</h2><br />
<table><br />
<tr><br />
<td style="padding-right:20px;"><br />
<br />
</td><br />
<td><br />
<p style="font-size:110%; color:#576f91; font-family:georgia,serif;"><br> <br />
<br />
<br><br />
<br>Fermentor studies<br />
<br />
<br><br />
<br>- Culturing: These studies showed that our E.coli BL21 DE3 strain grow well until absorbance at 600 nm reaches 2.2. However, because of high growing capacity of fermentor, sufficient time is not present for Carbon monoxide induction. Therefore, we changed fermentor to flask in order to have higher induction time period of carbon monoxide<br />
<br>- Viability: Cells having absorbance at 0.05 have reached the stationary phase in 3 hours and starting from 4th hour, our bacteria cultures started to die. <br />
<br>- Reproducibility: Our data acquired from fermentor studies are not reproducible because CO was induced to death cells. <br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 572px; height: 350px;" alt="w7" src="https://static.igem.org/mediawiki/2010/3/3b/Growth_curve_alpha_1.JPG"></a></div><br />
<br />
<br>- Myoglobin Assay: Our data acquired from myoglobin assay is not clear because absorbance acquired from cell density have interefered with myoglogin assay data.<br />
<br>- CFU(Colony Forming Unit): We couldn’t observe growth of bacteria starting from 4th hour of fermentation.<br />
<br>- Fluorescence measurements: Fluorescence was detected due to auto-fluorescence of CooA proteins. Since our bacteria cultures have expression vector, CooA is highly expressed which in turn causes fluorescence.</br><br />
<br />
<br />
<br><br />
<br>Flask experiments</br><br />
<br />
<br><br />
<br />
<br>- Culturing: We didn’t have enough time to test our final vector. Instead, we have used BBa_K352017 to test the RFP production. We have used 300 mL flasks with 80 mL LB culture. We have applied 80 Ml Carbon monoxide to some. The results were successful. Cultures induced with carbon monoxide successfully expressed red fluorescent protein.<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 963px; height: 393px;" alt="w7" src="https://static.igem.org/mediawiki/2010/4/49/Culturing_alpha_1.JPG"></a></div><br />
<br />
<br />
<br><br />
<br>Myoglobin assay optimization</br><br />
<br><br />
<br />
<br />
<br>- We have planned to measure CO presence with myoglobin assay. We used myoglobin purchased from Sigma to detect levels of Carbon monoxide. In our experiments, we couldn’t measure exact CO in the environment owing to the fact that sensitivity level of the myoglobin bonded with CO was not sufficient to observe absorbance at 540 nm.<br />
Signal quantification with fluorescence spectroscopy <br />
<br />
<br><br />
<br>Signal Quantification of pCooF-RBS-GFP-TT: </br><br />
<br><br />
<br />
<br>For this experiment, the bacteria containing the vector having the construct and expression vector pTriEx is incubated in E.coli BL21 strain at different conditions. The results are as the following; <br />
<br><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 902px; height: 390px;" alt="w7" src="https://static.igem.org/mediawiki/2010/1/1b/PCooF_experiment_alpha_1_florasan_grafik.JPG"></a></div><br />
<br />
<br />
<br>- From the data acquired from spectrophotometer, we observed that neither CO presence nor the presence of pCooF-RBS-GFP-TT affected GFP intensity. We acknowledged that fluorescence increase in the intensity of 510 nm was result of fluorescent nature of CooA. It is suspected that the result is dependent on our strain, BL21, caused the unexpected results. <br />
Signal Quantification of pCooM-RBS-RFP-TT-pLac-RBS-CooA: We have tried another construct pCooM-RBS-RFP-TT-pLac-RBS-CooA at TOP10 strain. The results were successful. We have put our construct in different environments (flasks with different conditions) and compared the RFP fluorescence.<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 900px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/b6/BU_SEFER_TAMAM.JPG"></a></div><br />
<br />
<br />
</br><br />
<div align="center"><br><br />
FIGURE3:Imaging with confocal laser scanning microscopy</br></div><br />
<br />
<br><br />
<br> Signal Visualization of pCooM-RBS-RFP-TT-pLac-RBS-CooA:<br />
<br><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 422px; height: 413px;" alt="w7" src="https://static.igem.org/mediawiki/2010/2/26/Confocal_sa%C4%9F.JPG "></a></div><br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 433px; height: 432px;" alt="w7" src="https://static.igem.org/mediawiki/2010/a/ae/Confocal_sol.JPG "></a></div><br />
<br />
<br />
</br><br />
<br />
<br />
.</p><br />
<br />
</td><br />
</tr><br />
</table> <br />
</div> <!-- close main item --></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Collaboration
Team:METU Turkey/Collaboration
2010-10-28T01:19:03Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br />
<br />
<br />
<h2>BETA-TESTING</h2><br />
<br />
We have performed beta testing of the algorithm developed by METU_TURKEY_SOFTWARE and the BioGUIDE software has been performed by METU_TURKEY on case studies. Moreover we have tested some constructs which are some protein generators we interested and some mostly searched biobricks including constructs with the software program. This Bio Guide Version 1.0 has been developed for 2010 competition, to increase usability of parts and to provide relations and to find I/O informations, with our algorithm. With this development and its mostly related developed survey which has been related with further development and standardization of the Part Registry and bottlenecks about Submission of parts and their characterization data processing.<br />
<br />
<html><br />
<center> <img style="border: 0px solid ; width: 600px; height: 380px;" alt="w7" src="<br />
https://static.igem.org/mediawiki/2010/1/1f/Col1.jpg<br />
" alt="" style="border: 1px solid #fff"/> </center><br />
<br />
</html><br />
<br />
<br>In case studies, we have concantrated on easy usage and understandable, user-friendly software program. Then, we assumed to find a promoter which would have 3 different features such as looking for placI promoter. For now, in the limited time the program has been developed well and considering most of standardization rules generally provided in part pages. Also, needs of further standardization of the part registry have been discussed, causing to start a survey conducted by the software team.<br />
<br />
<br> Therefore, with the help of analyzing of a part, they could develop further with novel functions. And, in the Parts registry system, via colloborations with us, the system has been modelled and stimulated by the software team. <br />
<br />
<br />
<br />
<br><br />
<h2>SURVEY</h2><br />
<br />
We have participated into two survey conducted by METU_TURKEY_SOFTWARE and Mexico_UNAM Teams. First of them is mostly related with us to develop more usable the new registry. And, second one is about synthetic biology concept knowledge and spreading over new younger scientists.</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Collaboration
Team:METU Turkey/Collaboration
2010-10-28T01:12:00Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br />
<br />
<br />
<h2>BETA-TESTING</h2><br />
<br />
We have performed beta testing of the algorithm developed by METU_TURKEY_SOFTWARE and the BioGUIDE software has been performed by METU_TURKEY on case studies. Moreover we have tested some constructs which are some protein generators we interested and some mostly searched biobricks including constructs with the software program. This Bio Guide Version 1.0 has been developed for 2010 competition, to increase usability of parts and to provide relations and to find I/O informations, with our algorithm. With this development and its mostly related developed survey which has been related with further development and standardization of the Part Registry and bottlenecks about Submission of parts and their characterization data processing.<br />
<br />
<html><br />
<center> <img style="border: 0px solid ; width: 600px; height: 380px;" alt="w7" src="<br />
https://static.igem.org/mediawiki/2010/1/1f/Col1.jpg<br />
" alt="" style="border: 1px solid #fff"/> </center><br />
<br />
</html><br />
<br />
In case studies, we have concantrated on easy usage and understandable, user-friendly software program. Then, we assumed to find a promoter which would have 3 different features such as looking for placI promoter. For now, in the limited time the program has been developed well and considering most of standardization rules generally provided in part pages. Also, needs of further standardization of the part registry have been discussed, causing to start a survey conducted by the software team.<br />
<br />
<br />
<br />
<br />
<br><br />
<h2>SURVEY</h2><br />
<br />
We have participated into two</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Collaboration
Team:METU Turkey/Collaboration
2010-10-28T01:06:56Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br><br />
<br><br />
<h2>BETA-TESTING</h2><br />
<br />
We have performed beta testing of the algorithm developed by METU_TURKEY_SOFTWARE and the BioGUIDE software has been performed by METU_TURKEY on case studies. Moreover we have tested some constructs which are some protein generators we interested and some mostly searched biobricks including constructs with the software program. This Bio Guide Version 1.0 has been developed for 2010 competition, to increase usability of parts and to provide relations and to find I/O informations, with our algorithm. With this development and its mostly related developed survey which has been related with further development and standardization of the Part Registry and bottlenecks about Submission of parts and their characterization data processing.<br />
<br />
<html><br />
<center> <img style="border: 0px solid ; width: 600px; height: 380px;" alt="w7" src="<br />
https://static.igem.org/mediawiki/2010/1/1f/Col1.jpg<br />
" alt="" style="border: 1px solid #fff"/> </center><br />
<br />
</html><br />
<br />
<br><br />
<h2>SURVEY</h2><br />
<br />
We have participated into two</div>
Metugen
http://2010.igem.org/File:Col1.jpg
File:Col1.jpg
2010-10-28T01:02:20Z
<p>Metugen: </p>
<hr />
<div></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Collaboration
Team:METU Turkey/Collaboration
2010-10-28T00:54:09Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<h2>BETA-TESTING</h2><br />
<br />
We have performed beta testing of the algorithm developed by METU_TURKEY_SOFTWARE and the BioGUIDE software has been performed by METU_TURKEY on case studies. Moreover we have tested some constructs which are some protein generators we interested and some mostly searched biobricks including constructs with the software program. This Bio Guide Version 1.0 has been developed for 2010 competition, to increase usability of parts and to provide relations and to find I/O informations, with our algorithm. <br />
<br />
<h2>SURVEY</h2></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Project
Team:METU Turkey/Project
2010-10-28T00:31:26Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> |</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br> <br />
<h2>ABSTRACT</h2><br />
<br><br />
<br> Cells can sense and respond to the presence of various gas molecules such as oxygen, nitrogen and carbon monoxide using gas sensor proteins.<br />
<br> <br />
<br> CooA is a carbon monoxide (CO) sensing transcription factor. It is a member of the cAMP receptor protein (CRP)/fumavate nitrate reduction (FNR) family of transcriptional regulators. CooA switches on oxidation enzymes in Rhodospirillum rubrum (a purple, nonsulfur, phototrophic bacterium) which enables the bacterium to use CO as a carbon source. <br />
<br> <br />
<br>CO is an odorless and colorless gas which can be extremely lethal. Our aim is to develop a cell sensor which can detect a wide range of CO concentration in the environment.<br />
<br> <br />
<br>We are building CooA and CooA-responsive promoter biobricks which will be transformed into E.coli. Fluorescent proteins (GFP and RFP) will be utilized as dose-responsive signals of ambient CO. <br />
<br> <br />
<br />
------<br />
<br> <br />
<br>PROJECT DESCRIPTION<br />
<br> <br />
<br>Objectives<br />
<br> <br />
<br> - To construct a carbon monoxide sensing cell sensor<br />
<br>- To increase the dynamic range of CO sensor with strong/weak response element coupling<br />
<br> <br />
<br>Enhanced Dynamic Range (EDR)<br />
<br> <br />
<br>In a typical biphasic binding event in which strong and weak affinity binding interactions can take place between two molecules, saturation of the strong affinity site<br />
is followed by a second saturation event of the weak site. Based on this principle, we coupled strong and weak binding response elements of carbon monoxide sensing transcription factor CooA to two different signals, GFP and RFP respectively. In this way, we expect not only to detect the presence of carbon monoxide gas but also increase the dynamic range of our cell sensor using strong-weak promoter coupling.<br />
<br> <br />
<br>One of the important questions we are hoping to answer is how many fold affinity difference between CooA and its response elements (RE) would be required to so that when we couple these REs we obtain the widest possible dynamic range for the CO detection?<br />
<br> <br />
<br>How E-CO Sensor Works?<br />
<br> <br />
<br>When CO is introduced into the medium, transcription from both strong and weak CooA responsive promoters will be initiated. Since affinity of CO bound transcription factor is higher for the strong promoter, GFP signal will dominate the RFP signal due to the higher transcription rate of the former. Increase in CO concentration will completely saturate strong promoter and after a point saturation of the second, weaker promoter will begin. As the concentration of the signal from weak promoter (RFP) increases, detected fluorescent signal will start to change from green to yellow. <br />
<br> <br />
<br>Components <br />
<br><br />
<br> - pCooF+rbs+GFP+tt – This component is used to measure low levels of carbon monoxide in the environment. Construction of this device was performed by utilizing strong CO sensitive promoter which is pCooF promoter from Rhodospirillum rubrum. This device is only active when there is CooA transcriptional activator and Carbon monoxide gas in the environment. When there is CO in the environment, the device produces green fluorescent protein in response. <br />
<br><br />
<br> - pCooM+rbs+RFP+tt – This component is used to measure high levels of carbon monoxide in the environment. Construction of this device was performed by utilizing strong CO sensitive promoter which is pCooM promoter from Rhodospirillum rubrum. This device is only active when there is CooA transcriptional activator and Carbon monoxide gas in the environment. When there is CO in the environment, the device produces red fluorescent protein in response.<br />
<br><br />
<br> pTriEx +CooA – This component is used for transcriptional activation of pCooM and pCooF promoter. When CO is present in the environment, CO binds to heme group of CooA protein which opens the binding sites of CooA protein. The CooA gene is ligated into the pTriEx vector which expresses CooA protein in high amounts.<br />
<br><br />
<br> This component is used to detect CO presence. It expresses RFP in low concentration when there isn’t CO present. When there is CO, CO binds to CooA and expression increases substantially.<br />
<br><br />
<br>Final Construct – This construct has been done by ligation of pCooF and pCooM promoters which are coupled to GFP and RFP proteins. It is designed as CO sensor whose data gives an approximate data about CO amount in the environment<br />
<br />
-<br />
<br> <br />
<br>Execution<br />
<br> <br />
<br>Our research group were divided into four teams to design and characterize E-CO Sensor. Alpha Team is responsible for cloning and cell sensor experiments; CooA overexpression and purification will be performed by Bravo Team; Charlie Team will mainly contribute with their expertise in fluorescence spectroscopy and confocal laser scanning microscopy; Delta Team will be performing characterization experiments and will be joined by Bravo when protein expression/purification package is completed. <br />
<br><br />
<br>The project will start with the design and ordering of CooA (wild type/mutants) and its response element (wild type/mutants) sequences. CooA mutants were reported<br />
to have higher affinity for CO. They were included in our order to shorten CO response time if needed. Two promoters, PCOOF and PCOOM, were previously<br />
reported as strong and weak promoters of CooA. We will also design several PCOOF promoter mutants (point mutations). These mutants are expected to have changed affinity for CooA. Binding affinity of CooA and mutated promoters will be determined as a part of characterization work package which includes Isothermal Titration Calorimetry (ITC), Electrophoretic Mobility Shift Assay (EMSA) and Intrinsic Tryptophan Fluorescence (ITF). Following this, promoters with different CooA affinities will be coupled and constructs will be prepared for in-vivo cell sensor experiments.<br />
<br> <br />
<br>In cloning package various strong/weak promoter couples followed by GFP and RFP signals will be produced and co-transformed with CooA vector into E.coli. Cell sensor experiments will proceed in three stages; Fermentor, flask and anaerobic chamber (solid culture) experiments. In all these, cell sensors will be tested under various<br />
culturing conditions including IPTG induction concentration and time. Growth curves will be constructed and CO will be introduced at different growth points and at<br />
varying concentrations. Dissolved CO will be determined using a myoglobin assay which is based on the absorbance change of myoglobin upon binding to CO. Cell response (GFP/RFP signals) will be measured by confocal laser scanning microscopy and fluorescence spectroscopy.<br />
<br> <br />
<br>We will compare and correlate our findings from in-vitro binding experiments and in-vivo cell sensor studies to develop an optimized CO cell sensor with enhanced dynamic<br />
range.</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/Characterization
Team:METU Turkey/Results Discussion/Characterization
2010-10-28T00:24:59Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br> 1. Isothermal Titration Calorimetry (ITC) <br />
<br />
<br> Result: We have to cancel the ITC experiment since we did not handle enough DNA components ,that are promoters and response elements, and protein ,CooA . <br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/ITC"><strong>Details...</strong></a></div></html> <br />
<br />
<br />
<br> 2. Electrophoretic Mobility Shift Assay (EMSA) <br />
<br />
<br> Result: As indicated, slight retardation in PCOOF and PCOOM bands are observed. On the other hand, it is difficult to conclude an affinity difference between these promoters based on the intensity of retarded bands. <br />
<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/EMSA"><strong>Details...</strong></a></div></html><br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/b8/D10.jpg"></a></div></html><br />
<br />
<br />
<div><br />
<br> 3. Intrinsic Tryptophan Fluorescence (ITF) <br />
<br />
<html><br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/b5/D13.jpg"></a></div></html><br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/ITF"><strong>Details...</strong></a></div></html><br />
<br />
<br> pink:reduced - CO bounded CooA + buffer <br />
<br> yellow : reduced –CO bounded CooA + 28 nM pCooF ( 20. Min) <br />
<br> blue: reduced –CO bounded CooA +56 nM pCooF ( 40. Min) </br><br />
<br> green: NC: reduced –CO bounded CooA + 10 ul elution buffer ( 20.min) <br />
<br> purple: NC: reduced – CO bounded CooA+ 20 ul elution buffer (40. Min ) <br />
<br />
<br> As shown in the graph, there is an decrease in the intensity of the fluorescence; however when looked at negative control measurements, we saw the decrease in intensity because of the dilution and time effects. So we cannot say that the reduction is caused from pCooF – CooA interaction. Moreover, we suspect that heme group in the CooA quench fluorescence of the tryptophan and also heme group gives absorbance at 280- 400 nm so our protein might give the fluorescence at that range itself.</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Gallery
Team:METU Turkey/Gallery
2010-10-28T00:24:09Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planing">Planing</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
----<br />
<br />
<br />
<br> </br><br />
<br />
<br> </br><br />
<div align="center"><br />
<embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="600" height="400" flashvars="host=picasaweb.google.com&hl=en_US&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2Fcanozen2%2Falbumid%2F5478646406318920785%3Falt%3Drss%26kind%3Dphoto%26hl%3Den_US" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Gallery
Team:METU Turkey/Gallery
2010-10-28T00:23:15Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planing">Planing</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
----<br />
<br />
<br />
<br> </br><br />
<br />
<br> </br><br />
<br />
<br> </br><br />
<div align="center"><br />
<embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="600" height="400" flashvars="host=picasaweb.google.com&hl=en_US&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2Fcanozen2%2Falbumid%2F5478646406318920785%3Falt%3Drss%26kind%3Dphoto%26hl%3Den_US" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Gallery
Team:METU Turkey/Gallery
2010-10-28T00:22:12Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planing">Planing</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br></br><br />
<br />
<br></br><br />
<br />
<br></br><br />
<div align="center"><br />
<embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="600" height="400" flashvars="host=picasaweb.google.com&hl=en_US&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2Fcanozen2%2Falbumid%2F5478646406318920785%3Falt%3Drss%26kind%3Dphoto%26hl%3Den_US" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Gallery
Team:METU Turkey/Gallery
2010-10-28T00:20:16Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planing">Planing</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<div align="center"><br />
<embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="600" height="400" flashvars="host=picasaweb.google.com&hl=en_US&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2Fcanozen2%2Falbumid%2F5478646406318920785%3Falt%3Drss%26kind%3Dphoto%26hl%3Den_US" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/ITF
Team:METU Turkey/Results Discussion/ITF
2010-10-28T00:14:03Z
<p>Metugen: New page: <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Home</title> <meta nam...</p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
D12<br />
<br />
<br>Our protein, that is CooA transcription factor, has two tryptophan residues in its structure. DNA binding to protein can cause conformational change in the protein structure so tryptophan orientation changes in the protein. By carrying out intrinsic tryptophan fluorescence, we expected to observe fluorescence change in tryptophan residues with binding of CooA to pCooF. We used CooA in three different forms that are inactive or oxidized, reduced by DTT and reduced –CO bounded. On the other hand, we used only one DNA template that is pCooF. We carried out the experiment two different buffers. We prepared for oxidized protein and this buffer contained every component in reaction buffer except reducing agents such as DTT,sodium dithionite and also bovine serum albumin. Unlike oxidized protein, reduced CooA is needed reducing agents but because of giving fluorescence of tryptophan, BSA was not added to solution. </br><br />
<br />
<br>After prepared the buffers, we started to measure our sample via titrating CooAs with the pCooF. Measurements are taken in this ratio of protein: DNA that are 1:1; 1:2; 1:3; 1:4. On the other hand, we made negative control to ensure intensity decrease resulting from dilution or time effects. We excited CooA at 280 nm and we took emission scan at 300-400 nm. Our slit number was 4 nm that is 2 turn. Each reaction happened at room temperature for 20 minutes. We took 20 emission scans. We observed decrease in the intensity of the fluorescence; however when looked at negative control measurements, we saw the decrease in intensity because of the dilution and time effects. So we cannot say that that reduction is caused from pCooF – CooA interaction. Moreover, we suspect that heme group in the CooA quench fluorescence of the tryptophan and also heme group gives absorbance at 280- 400 nm so our protein might give the fluorescence at that range itself. </br><br />
<br />
D13<br />
<br>yellow : red/Co 28 nM pcoof 20 .min</br><br />
<br>pink:red/ CO + buffer </br><br />
<br>blue: red/ CO 56 nM pcoof 40. min </br><br />
<br>green: NC red/ co 10 ul elution buffer 20.min </br><br />
<br>purple: NC red/ CO 20 ul elution 40. min </br><br />
D14<br />
<br>white :oxizied.+ 56 nM pCoof + 40. min </br><br />
<br>blue : red / CO + 56 nM pCooF + 40 min </br></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/EMSA
Team:METU Turkey/Results Discussion/EMSA
2010-10-28T00:09:30Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br>In order to determine protein-DNA interaction, we performed electrophoretic mobility shift assay or gel retardation assay. We used the proteins in two forms. The proteins used were reduced CooA and reduced -CO bounded CooA and also pCooF and pCooM were used as DNA components. Before starting experiment, we added DTT to inactive or oxidized CooA to reduce Ferric ion to ferrous ion in the CooA then we sparged carbonmonoxide (CO) to protein solution during 5 min. The DNA binding reaction was carried out by reaction buffer which did not contain reducing agents such as DTT and sodium dithionite. We had seven reaction for each EMSA experiment. These reactions are given below.</br><br />
<br />
<br />
<br>Volume of each reaction was 40 ul. These samples included 20 ul 2X reaction buffer and 10 ul protein solutions and 10 ul DNA component solutions. After preparation the reaction mix, we incubated the samples at room temperature for DNA binding for 20 min. We run the samples at 100 V for 1.5 hours at 4C. Before running the 6% polyacrylamide gel added sodium dithionite that was sparged with Argon to provide anoxic condition, pre-run was done at 4C at 100 V for 45 min. After running for 1.5 hours, we stained the gel staining with Et-Br by shaking for 15 min to stain DNA. We analyzed the gel under UV and the result is obtained given below. </br><br />
<br />
D9<br />
<br />
<br>There is a little retardation. When reduced -CO bounded CooA binds to pCooF , DNA retardation is expected, however gel image said that the retardation happened when compared to other pCooF /pCooM - CooA binding.</br></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/EMSA
Team:METU Turkey/Results Discussion/EMSA
2010-10-28T00:07:52Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br>In order to determine protein-DNA interaction, we performed electrophoretic mobility shift assay or gel retardation assay. We used the proteins in two forms. The proteins used were reduced CooA and reduced -CO bounded CooA and also pCooF and pCooM were used as DNA components. Before starting experiment, we added DTT to inactive or oxidized CooA to reduce Ferric ion to ferrous ion in the CooA then we sparged carbonmonoxide (CO) to protein solution during 5 min. The DNA binding reaction was carried out by reaction buffer which did not contain reducing agents such as DTT and sodium dithionite. We had seven reaction for each EMSA experiment. These reactions are given below.<br />
<br />
<br />
<br>Volume of each reaction was 40 ul. These samples included 20 ul 2X reaction buffer and 10 ul protein solutions and 10 ul DNA component solutions. After preparation the reaction mix, we incubated the samples at room temperature for DNA binding for 20 min. We run the samples at 100 V for 1.5 hours at 4C. Before running the 6% polyacrylamide gel added sodium dithionite that was sparged with Argon to provide anoxic condition, pre-run was done at 4C at 100 V for 45 min. After running for 1.5 hours, we stained the gel staining with Et-Br by shaking for 15 min to stain DNA. We analyzed the gel under UV and the result is obtained given below. <br />
<br />
D9<br />
<br />
<br>There is a little retardation. When reduced -CO bounded CooA binds to pCooF , DNA retardation is expected, however gel image said that the retardation happened when compared to other pCooF /pCooM - CooA binding.</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/EMSA
Team:METU Turkey/Results Discussion/EMSA
2010-10-28T00:06:01Z
<p>Metugen: New page: <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Home</title> <meta nam...</p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/ITC
Team:METU Turkey/Results Discussion/ITC
2010-10-28T00:05:31Z
<p>Metugen: New page: <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Home</title> <meta nam...</p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br> Isothermal Titration Calorimetry (ITC):<br />
<br />
<br> We planned to observe thermodynamics of binding affinity of CooA to pCooM, pCooF and four different mutations of pCooF promoters. During our literature survey it is concluded that we require high amount of short DNA strands for an ITC experiment. For 1mM of 50 bp oligonucleotide which includes response element, in a 2.5 ml cell of calorimetry, we need 80ug of DNA template. We have two main options, first one is purchase them and other one is propagate our templates by ourselves. In first case, we called it Richie Rich Case; we would pay nearly 1250 USA dollars for 10 experiment of DNA, so unfortunately we had to eliminate that case. Our second case is propagation of DNA components with PCR by using our transformed plasmids and extracts the oligos from the gel. However, we have a problem with our yield after gel extraction because the recovery of the kits is decreases when oligonucleotide is shorter than 100 bp. We calculated amount of materials we need with different extraction kits. We designed two different sets of primers for promoters (~100 bp) and shorter sequence including response element (~50 bp). <br />
Generally 15ml transformed cells are incubated overnight and plasmids are purified. The mean amount of plasmids that we got is nearly 15ng/ul. Plasmids are used as template in PCR to produce promoters. <br />
<br />
<br> Promoters (~100bp) are in the figure below:<br />
<br> pCooF promoter <br />
D2 <br />
<br>pCooF mutant C4G <br />
D3 <br />
<br>pCooF mutantC9G<br />
D4 <br />
<br>pCooF mutant G2C<br />
D5<br />
<br>pCooF G7C <br />
D6 <br />
<br>pCooM promoter(long)<br />
D7<br />
<br />
<br>After gel extraction we measure the concentration of promoters (mean: 15ng/ul in 30ul). <br />
<br>Produced promoters are used as template in next step PCR and response elements are propagate with more specific primers. Although we see clear bands from agarose gel, after gel extraction we lose most of our sample (in best case 5 ng/ul in 50 ul ). Therefore, we decided to continue our experiments with promoter sequences.<br />
Response element parts (~57bp) are in the figure below<br />
D8<br />
<br>After repeat that steps many times we combine our products and vacuum them to concentrate. For example we get 66ng/ul in 100ul pCooF promoter.<br />
<br>We realize that we have to repeat that steps 100 times for promoters and 200 times for response element just for an ITC experiment. Moreover, we cannot purify enough protein for ITC. Therefore, we have to cancel ITC experiment because of the material insufficiencies.</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/Characterization
Team:METU Turkey/Results Discussion/Characterization
2010-10-28T00:00:20Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br> 1. Isothermal Titration Calorimetry (ITC) <br />
<br />
<br> Result: We have to cancel the ITC experiment since we did not handle enough DNA components ,that are promoters and response elements, and protein ,CooA . <br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/ITC"><strong>Details...</strong></a></div></html> <br />
<br />
<br />
<br> 2. Electrophoretic Mobility Shift Assay (EMSA) <br />
<br />
<br> Result: As indicated, slight retardation in PCOOF and PCOOM bands are observed. On the other hand, it is difficult to conclude an affinity difference between these promoters based on the intensity of retarded bands. <br />
<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/EMSA"><strong>Details...</strong></a></div></html><br />
<br />
<div><br />
<br> 3. Intrinsic Tryptophan Fluorescence (ITF) <br />
<br />
<br> pink:reduced - CO bounded CooA + buffer <br />
<br> yellow : reduced –CO bounded CooA + 28 nM pCooF ( 20. Min) <br />
<br> blue: reduced –CO bounded CooA +56 nM pCooF ( 40. Min) </br><br />
<br> green: NC: reduced –CO bounded CooA + 10 ul elution buffer ( 20.min) <br />
<br> purple: NC: reduced – CO bounded CooA+ 20 ul elution buffer (40. Min ) <br />
<br />
<br> As shown in the graph, there is an decrease in the intensity of the fluorescence; however when looked at negative control measurements, we saw the decrease in intensity because of the dilution and time effects. So we cannot say that the reduction is caused from pCooF – CooA interaction. Moreover, we suspect that heme group in the CooA quench fluorescence of the tryptophan and also heme group gives absorbance at 280- 400 nm so our protein might give the fluorescence at that range itself. <br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/ITF"><strong>Details...</strong></a></div></html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/Characterization
Team:METU Turkey/Results Discussion/Characterization
2010-10-27T23:58:25Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br> 1. Isothermal Titration Calorimetry (ITC)</br><br />
<br />
<br> Result: We have to cancel the ITC experiment since we did not handle enough DNA components ,that are promoters and response elements, and protein ,CooA . </br><br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/pKK_versus_pTriEx"><strong>Details...</strong></a></div></html> <br />
<br />
<br />
<br> 2. Electrophoretic Mobility Shift Assay (EMSA) </br><br />
<br />
<br> Result: As indicated, slight retardation in PCOOF and PCOOM bands are observed. On the other hand, it is difficult to conclude an affinity difference between these promoters based on the intensity of retarded bands.</br><br />
<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/pKK_versus_pTriEx"><strong>Details...</strong></a></div></html><br />
<br />
<div><br />
<br> 3. Intrinsic Tryptophan Fluorescence (ITF)</br><br />
<br />
<br> pink:reduced - CO bounded CooA + buffer </br><br />
<br> yellow : reduced –CO bounded CooA + 28 nM pCooF ( 20. Min)</br><br />
<br> blue: reduced –CO bounded CooA +56 nM pCooF ( 40. Min) </br><br />
<br> green: NC: reduced –CO bounded CooA + 10 ul elution buffer ( 20.min) </br><br />
<br> purple: NC: reduced – CO bounded CooA+ 20 ul elution buffer (40. Min )</br><br />
<br />
<br> As shown in the graph, there is an decrease in the intensity of the fluorescence; however when looked at negative control measurements, we saw the decrease in intensity because of the dilution and time effects. So we cannot say that the reduction is caused from pCooF – CooA interaction. Moreover, we suspect that heme group in the CooA quench fluorescence of the tryptophan and also heme group gives absorbance at 280- 400 nm so our protein might give the fluorescence at that range itself.</br></div><br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/pKK_versus_pTriEx"><strong>Details...</strong></a></div></html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/Characterization
Team:METU Turkey/Results Discussion/Characterization
2010-10-27T23:57:06Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br> 1. Isothermal Titration Calorimetry (ITC)</br><br />
<br />
<br> Result: We have to cancel the ITC experiment since we did not handle enough DNA components ,that are promoters and response elements, and protein ,CooA . </br><br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/pKK_versus_pTriEx"><strong>Details...</strong></a></div></html> <br />
<br />
<br />
<br> 2. Electrophoretic Mobility Shift Assay (EMSA) </br><br />
<br />
<br> Result: As indicated, slight retardation in PCOOF and PCOOM bands are observed. On the other hand, it is difficult to conclude an affinity difference between these promoters based on the intensity of retarded bands.</br><br />
<br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/pKK_versus_pTriEx"><strong>Details...</strong></a></div></html><br />
<br />
<br />
<br> 3. Intrinsic Tryptophan Fluorescence (ITF)</br><br />
<br />
<br> pink:reduced - CO bounded CooA + buffer </br><br />
<br> yellow : reduced –CO bounded CooA + 28 nM pCooF ( 20. Min)</br><br />
<br> blue: reduced –CO bounded CooA +56 nM pCooF ( 40. Min) </br><br />
<br> green: NC: reduced –CO bounded CooA + 10 ul elution buffer ( 20.min) </br><br />
<br> purple: NC: reduced – CO bounded CooA+ 20 ul elution buffer (40. Min )</br><br />
<br />
<br> As shown in the graph, there is an decrease in the intensity of the fluorescence; however when looked at negative control measurements, we saw the decrease in intensity because of the dilution and time effects. So we cannot say that the reduction is caused from pCooF – CooA interaction. Moreover, we suspect that heme group in the CooA quench fluorescence of the tryptophan and also heme group gives absorbance at 280- 400 nm so our protein might give the fluorescence at that range itself.</br><br />
<br />
<br> <html><div><a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion/pKK_versus_pTriEx"><strong>Details...</strong></a></div></html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/Characterization
Team:METU Turkey/Results Discussion/Characterization
2010-10-27T23:51:40Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br> 1. Isothermal Titration Calorimetry (ITC)</br><br />
<br />
<br> Result: We have to cancel the ITC experiment since we did not handle enough DNA components ,that are promoters and response elements, and protein ,CooA . </br><br />
<br />
<br> 2. Electrophoretic Mobility Shift Assay (EMSA) </br><br />
<br />
<br> Result: As indicated, slight retardation in PCOOF and PCOOM bands are observed. On the other hand, it is difficult to conclude an affinity difference between these promoters based on the intensity of retarded bands.</br><br />
<br />
<br> 3. Intrinsic Tryptophan Fluorescence (ITF)</br><br />
<br />
<br> pink:reduced - CO bounded CooA + buffer </br><br />
<br> yellow : reduced –CO bounded CooA + 28 nM pCooF ( 20. Min)</br><br />
<br> blue: reduced –CO bounded CooA +56 nM pCooF ( 40. Min) </br><br />
<br> green: NC: reduced –CO bounded CooA + 10 ul elution buffer ( 20.min) </br><br />
<br> purple: NC: reduced – CO bounded CooA+ 20 ul elution buffer (40. Min )</br><br />
<br />
<br> As shown in the graph, there is an decrease in the intensity of the fluorescence; however when looked at negative control measurements, we saw the decrease in intensity because of the dilution and time effects. So we cannot say that the reduction is caused from pCooF – CooA interaction. Moreover, we suspect that heme group in the CooA quench fluorescence of the tryptophan and also heme group gives absorbance at 280- 400 nm so our protein might give the fluorescence at that range itself.</br></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/Characterization
Team:METU Turkey/Results Discussion/Characterization
2010-10-27T23:50:27Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br> 1. Isothermal Titration Calorimetry (ITC)<br />
<br />
<br> Result: We have to cancel the ITC experiment since we did not handle enough DNA components ,that are promoters and response elements, and protein ,CooA . <br />
<br />
<br> 2. Electrophoretic Mobility Shift Assay (EMSA) <br />
<br />
<br> Result: As indicated, slight retardation in PCOOF and PCOOM bands are observed. On the other hand, it is difficult to conclude an affinity difference between these promoters based on the intensity of retarded bands.<br />
<br />
<br> 3. Intrinsic Tryptophan Fluorescence (ITF)<br />
<br />
<br> pink:reduced - CO bounded CooA + buffer <br />
<br> yellow : reduced –CO bounded CooA + 28 nM pCooF ( 20. Min)<br />
<br> blue: reduced –CO bounded CooA +56 nM pCooF ( 40. Min) <br />
<br> green: NC: reduced –CO bounded CooA + 10 ul elution buffer ( 20.min) <br />
<br> purple: NC: reduced – CO bounded CooA+ 20 ul elution buffer (40. Min )<br />
<br />
<br> As shown in the graph, there is an decrease in the intensity of the fluorescence; however when looked at negative control measurements, we saw the decrease in intensity because of the dilution and time effects. So we cannot say that the reduction is caused from pCooF – CooA interaction. Moreover, we suspect that heme group in the CooA quench fluorescence of the tryptophan and also heme group gives absorbance at 280- 400 nm so our protein might give the fluorescence at that range itself.</div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/Characterization
Team:METU Turkey/Results Discussion/Characterization
2010-10-27T21:37:50Z
<p>Metugen: New page: <html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Home</title> <meta nam...</p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Results_Discussion/Construction_of_Cell_Sensor_modules
Team:METU Turkey/Results Discussion/Construction of Cell Sensor modules
2010-10-27T21:34:05Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en" dir="ltr"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
<br />
<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #d0cdc8; }<br />
<br />
#left_column{<br />
width: 646px;<br />
float: left;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 552px;<br />
float: left;<br />
padding: 32px 38px 22px 30px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 0px 0px 12px 0px;<br />
color: #fff;<br />
text-decoration: none;<br />
}<br />
<br />
.text p{<br />
color: #bcc4c7;<br />
width: 552px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: right;<br />
clear:left;<br />
margin: 0px 0px 0px 20px;<br />
}<br />
<br />
.text a.continue{<br />
color: #65b8f9;<br />
font-size: 14px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
<br />
#right_column{<br />
width: 283px;<br />
float: left;<br />
padding: 18px 18px 0px 17px;<br />
background: #26292e;<br />
}<br />
<br />
.heading{<br />
width: 260px;<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
.heading h3{<br />
font-size: 17px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #ffffff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 965px;<br />
padding: 0px 0px 0px 0px;<br />
margin: 0px 0px 0px 0px;<br />
<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#f1f1f1;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 20px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
<br />
<br />
#footer ul li a{<br />
<br />
color: ;<br />
}<br />
#footer-box{<br />
border: none;<br />
background: none;<br />
}<br />
#footer #ffffff ul li{<br />
<br />
font-size: 13px;<br />
text-align: center;<br />
margin-right: auto;<br />
margin-left: auto;<br />
position: relative;<br />
} <br />
<br />
</style><br />
</head><br />
<body><br />
<div id="wrapper"> <br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="<br />
<br />
https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planing">Planing</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Dicussion</a> <br />
<br />
|<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusion">Conclusion</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a <br />
<br />
href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> <br />
<br />
|</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--><br />
<br />
<br />
<br />
<br />
<!-- ***** New entry ***** --> <br />
<div class="main_item"> <br />
<h2>1-Construction of Cell Sensor modules</h2><br />
<table><br />
<tr><br />
<td style="padding-right:20px;"><br />
<br />
</td><br />
<td><br />
<p style="font-size:110%; color:#576f91; font-family:georgia,serif;"><br>Design and ordering of DNA parts<br />
<br />
<br><br />
- Ordering of parts from GENEART: We have ordered 11 gene sequences from GENEART. We have synthesized pCooM, pCooF promoter and its 4 variants, CooA protein and 4 of its variants. Those genes are proven to be successful in cloning.</br><br><br />
- Design of parts: We have designed two different vectors , one containing pTriEx vector containing CooA and one containing our final construct. However, we couldn’t observe fluorescence with this system because of high expression capability of pTriEx. Because of this factor, we have designed another biobrick containing pLacI-RBS-RFP. We have cloned this with pCooM-RBS-RFP-TT and pSB1C3. We didn’t have enough time for cloning of the final vector with this biobrick.</br><br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/9/9f/Final_vector_psb1c3.JPG"></a></div><br />
<br />
<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/a/a3/PTriEx_-_CooA.JPG "></a></div><br />
<br />
<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/7/7f/FGMR_pSB1C3.JPG"></a></div><br />
<br />
<br />
.</p><br />
<br />
</td><br />
</tr><br />
</table> <br />
</div> <!-- close main item --><br />
<br />
<br />
<td><br />
<p style="font-size:110%; color:#576f91; font-family:georgia,serif;"><br />
'''Cloning'''<br />
<br>- Preparation of competent cell: 2 different methods and 1 kit were used for competent cell preparation. Fermentas Transformation kit wasn’t successful at all. Although two different TOP10 Glycerol stocks were used for this procedure, the preparation of competent cells couldn’t be accomplished. After working with Fermentas kit, TSS and Rubidium Chloride methods have been tried for competent cell preparation. Rubidium chloride method was chosen for competent cell preparation </br><br><br />
- Visualizing Small DNA fragments on agarose gel: For this purpose, two different methods have been utilized. Firstly, ethanol precipitation method was used to concentrate DNA samples prior to assembly of biobricks. Although this method was successful, owing to the fact that it has time constraints, Vacuum drying method was used for this purpose. By this procedure, we have successfully concentrated our DNA samples.</br><br />
<br>- Restriction Digestion: Two different enzyme types of Fermentas have been used for this purpose (Fast Digest-Conventional).Fast Digest enzymes have proven to be more useful because of time saving properties.</br><br />
<br>- Ligation: Ligation procedure was performed according to molar ratio of fragments. </br><br />
'''<br />
Validation'''<br />
<br>- Sequencing: 5 of parts have been sequenced and 1 one the parts was completely wrong sequence. PcooM-RBS-RFP–TT part doesn’t have the right sequence. For this reason, we have cloned this part again and sent to IGEM headquarters. However, we didn’t have enough time for sequencing of other parts.</br><br />
<br>- Agarose gel Electrophoresis: We have observed exact bands on agarose gel for each part.</br><br />
<br>- Fluorescence Spectrophotometer and Confocal Laser Scanning Microscopy data: Experiments done with pCooM-RBS-RFP-TT-pLac-RBS-CooA showed that RFP fluorescence is very high with CO applied samples. Those results show that our newly cloned biobrick works successfully.</br><br />
<br>- Agar plates: Our Agar plates with pCooM-RBS-RFP-TT-pLac-RBS-CooA showed that because of low level of constitutive binding of CooA to pCooM promoter, we have observed low level of RFP fluorescence on agar plates.<br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/f/ff/Agar_plate_sol.JPG"></a></div><br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/6/67/Agar_Plate_sa%C4%9F.JPG"></a></div><br />
<br />
</br><br />
<br><br />
'''<br />
Assembly of final construct'''<br />
- Construction: We have designed two different vectors, one containing pTriEx vector containing CooA and one containing our final construct. Our final construct shows to be ineffective when there is pTriEx expression vector. Owing to this, we have designed a new vector which has pLacI-RBS-CooA. However, we didn’t have enough time for complete construction of the final vector.</br><br />
<br />
<div align="center" style="margin:15px 0px 0px 0px"><img style="border: 0px solid ; width: 300px; height: 300px;" alt="w7" src="https://static.igem.org/mediawiki/2010/f/fc/Agarose_jel_foto_alpha_1.JPG"></a></div><br />
<br />
<br />
<br />
.</p><br />
<br />
</td><br />
</tr><br />
</table> <br />
</div> <!-- close main item --></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Team
Team:METU Turkey/Team
2010-10-27T21:29:46Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
#header{<br />
width: 886px;<br />
height: 35px;<br />
font-size: 14px;<br />
padding: 16px 35px 0px 22px;<br />
}<br />
<br />
#header p{<br />
float: left;<br />
color: #525961;<br />
}<br />
<br />
#header span{<br />
color: #bababa;<br />
}<br />
<br />
#header ul{<br />
float: right;<br />
}<br />
<br />
#header ul li{<br />
float: left;<br />
margin: 0px 12px 0px 0px;<br />
padding: 0px 0px 0px 12px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/9/9e/Header_navi_bg.gif) left bottom no-repeat;<br />
}<br />
<br />
#header ul li.no_bg{<br />
background: none;<br />
}<br />
<br />
#header ul li a{<br />
color:#fff;<br />
}<br />
<br />
#logo{<br />
display: inline-block;<br />
width: 264px;<br />
height: 100px;<br />
float: left;<br />
clear: both;<br />
margin: 0;<br />
background: url(https://static.igem.org/mediawiki/igem.org/4/4d/MTLogoE-co_sensor.jpg) no-repeat;<br />
text-indent: -9999px;<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #b6b7b9; }<br />
<br />
<br />
#teamImage{<br />
width:566px;<br />
height:423px;<br />
left: 200px;<br />
float: left;<br />
position:relative;<br />
margin: 20px 0px 20px 0px;<br />
background:url(https://igem.org/Image:MTteam_cell.png); <br />
}<br />
<br />
.left_column{<br />
clear:both;<br />
width: 475px;<br />
float: left;<br />
}<br />
.right_column{<br />
width: 475px;<br />
float: right;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 440px;<br />
float: left;<br />
padding: 0px 28px 0px 5px;<br />
margin: 0px 0px 20px 0px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 10px 0px 12px 10px;<br />
color: #fff;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 440px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: left;<br />
margin: 0px 10px 0px 5px;<br />
}<br />
<br />
.text a.continue{<br />
position: relative;<br />
color: #65b8f9;<br />
float: left;<br />
clear: left;<br />
font-size: 15px;<br />
margin: 30px 0px 0px 0px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
.heading{<br />
clear:both;<br />
<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
<br />
.heading h3{<br />
font-size: 20px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #fff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 950px;<br />
padding: 0px 0px 0px 0px;<br />
margin:0px 0px 0px 0px;<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#028AD3;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 15px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
</style><br />
</head><br />
<body><br />
<br />
<div id="wrapper"><br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
<br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> |</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
<br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--> <br />
<div id="metucontent"><br />
<!--<div id="teamImage"> <br />
</div>teamImage ends--><br />
<br />
<br />
<div class="heading"><br />
<h3>Students</h3><br />
</div> <!--heading ends--> <br />
<br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Cihan TAŞTAN</h3><br />
<p><img style="border: 0px solid ; width: 130px; height: 170px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/b8/CT.jpg" alt=""/>2010 is the last year for him as B.S degree at Molecular Biology and Genetics department. Moreover, he is studying at <br />
Computer Engineering as my minor department. His research will be on Scientist position at Cancer and Virology <br />
Relationship (Let's say Viral Oncology) by integrating novel technices of Bioinformatics and Synthetic Biology approaches. <br />
This is the second year for him at iGEM. </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Sibel ATAOL</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/ce/Sibelll.jpg" alt=""/>Sibel is senior student at Biology department, METU.This is the first year for her in IGEM team.Synthetic biology is the <br />
raising field of Biology what she believes.Studying in biotechnology, bioengineering with novel synthetic biology approaches <br />
is her desire for future.Indeed molecular biology is what she loves to work on so that she is in cloning team. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Funda GUZEY</h3><br />
<p><img style="border: 0px solid ; width: 110px; height: 180px;" alt="w7"src="https://static.igem.org/mediawiki/2010/9/95/FUNDA.jpg" alt=""/>She is a senior student of Biological Sciences at Middle East Technical University. This is her second year in iGEM competition. <br />
She gained experience in protein expression and purification in this summer. One of the her interests is Synthetic Biology.<br />
However, her main interest is Biomedical and Tissue Engineering. She feels lucky to have such a wonderful team and is glad to share <br />
a wonderful summer with her team. . </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<br />
<br />
<h3>Ebuzer KALYONCU</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/c5/Man.jpg" alt=""/>Ebuzer is a 4th year student of Molecular Biology and Genetics at Middle East Technical University in Turkey. He was experienced in protein <br />
expression and purification during this summer.He collected some wetlab experience and general knowledge about biotechnology equipments in <br />
Ozen LAB.His main interest is in the regulation of the development and function of the immune system.. </p><br />
</div><!--text ends--> <br />
</div><!--left_column ends--><br />
<div class="right_column"><br />
<div class="text alternative"><br />
<h3>Özkan İŞ</h3><br />
<p><img style="border: 0px solid ; width: 130px; height: 170px;" alt="w7"src="https://static.igem.org/mediawiki/2010/8/88/FOTO_yeni.JPG" alt=""/>Ozkan is especially interested in neuroscience. In near future, he wants to study in molecular neuroscience combined with <br />
synthetic biology approaches. He believes that by applying synthetic biology approaches to synapses, genetic mechanisms <br />
underlying the neurodegenerative diseases will be revealed. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Ceren ŞEREF</h3><br />
<p><img style="border: 0px solid ; width: 195px; height: 150px;" alt="w7" src="https://static.igem.org/mediawiki/2010/c/cd/Cerennn.jpg" alt=""/>Ceren is currently a junior year student of Biology department at Middle East Technical University. It is her first year in METU Syborg and also in iGEM. <br />
She wants to study Neuroscience, especially Neurodegenerative Diseases in the future. Furthermore, she is highly interested in Molecular Biology. <br />
She thinks that Synthetic Biology opens up a whole new page in Biology </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Serap MEMİK</h3><br />
<p><img style="border: 0px solid ; width: 160px; height: 150px;" alt="w7"src="https://static.igem.org/mediawiki/2010/2/27/DSCI0085.JPG" alt=""/>Serap is the third year student at the Middle East Technical University. She is highly interested in biotechnology and <br />
molecular biology. She thinks that synthetic biology has great potential and infinite opportunities to practice in human life.. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Rengin ERDEM</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/f/fa/Renginnn.png" alt=""/>Rengin is currently a Master’s student of Biotechnology at Middle East Technical University. She has got her Bachelor’s degree <br />
from Gazi University, her major being Biology. She always liked the idea of creating novel systems by utilizing the <br />
information derived from scientific studies. Therefore, she is quite excited to take part in a Synthetic Biology project. <br />
In addition to Synthetic Biology, she is also interested in Biomedical Sciences such as Developmental and Neurological <br />
Biology. Rengin is glad to have an enthusiastic and motivated group of colleagues to work with. </p><br />
</div><!--text ends--><br />
</div><!--right_column ends--><br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Bilgi GÜNGÖR</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/e/e9/Bilgi.png" alt=""/>Bilgi is first semester student in Master's program of Biotechnology at Middle East Technical University. She is graduated from <br />
Biology Department at METU and joined Metu Syborg iGEM Team during her senior year of her undergradute studies. She is interested in <br />
Molecular Cell Biology and her aim is to solve the mystery of the cell. . </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Selin AKKUZU</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/9/9d/Selinnn.png" alt=""/>When Selin participated in iGEM team, she was a senior student in Biology department at METU. She continues her higher education as<br />
a Master's student in Biotechnology at the same university. She is mainly interested in Protein Chemistry. She thinks <br />
that Synthetic Biology approaches includes everything in Biology. Therefore, Protein Chemistry and Modeling can be the backbone of <br />
Synthetic Biology. This project is just the beginning for her. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Esen SAYIN</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;" alt="w7"src="https://static.igem.org/mediawiki/2010/4/4c/Esennn.JPG" alt=""/>Esen completed the Molecular Biology and Genetics, BSc at Istanbul Technical University. Currently, she is master student in<br />
Biotechnology Program at Middle East Technical University and also teaching assistant at METU Biology Department. She enjoys to conduct<br />
experiments with fluorophores. She thinks that fluorophores like GFP and RFP have crucial roles at both synthetic biology and<br />
biotechnology. Her master thesis involves another type of fluorophore:quantum dots. In the future, she wants to conduct studies involve<br />
fluorescent molecules and even their development. </p><br />
</div><!--text ends--><br />
<br />
<div class="heading"><br />
<h3>Instructors</h3><br />
</div> <!--heading ends--> <br />
<br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Assistant Prof Can OZEN (Team Coordinator)</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/c5/Man.jpg" alt=""/> Dr. Ozen is the head of METU SYBORG (Synthetic Biology Research Group) and the coordinator of METU Turkey team in 2010. <br />
He is also the vice-chair of METU Biotechnology Department and the coordinator of Advanced Light Microscopy, Spectroscopy <br />
and Calorimetry units at the METU Central Laboratory. One of the primary research interests in Dr. Ozen's group is <br />
development and characterization of regulatory genetic elements.. </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Dr.Deniz YÜCEL</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;"src="https://static.igem.org/mediawiki/2010/0/0a/DYucelll_resim.jpg" alt=""/> Dr. Yucel received her MSc and PhD degrees in Department of Biotechnology from Middle East Technical University. <br />
She worked on enzyme/protein immobilization on polymeric materials and biosensors. She did her PhD on stem cell <br />
based nerve tissue engineering on guided constructs. During her PhD she worked on mesenchymal stem cell <br />
differentiation for one year at Massachusetts General Hospital and Tufts University. She is mainly interested in <br />
biomaterials (2D and 3D polymeric material designs), tissue engineering and stem cell plasticity. She is currently <br />
working as a Scientific Project Specialist at the Central Laboratory, Molecular Biology and Biotechnology R&D Center, <br />
Middle East Technical University. She contributes to the IGEM team with her instrumental skills and her experience <br />
in biochemistry and molecular biology.<br />
</p><br />
</div><!--text ends--><br />
</div><!--left_column ends--><br />
<div class="right_column"><br />
<div class="text alternative"><br />
<h3>Dr.Remziye YILMAZ</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;"src="https://static.igem.org/mediawiki/2010/a/a7/Remziye.jpg" alt=""/><br />
Remziye YILMAZ received her MSc and PhD degrees in Program of Biotechnology at the Food Engineering Department, University of Hacettepe. She then worked as founder in Biogenetic Laboratory of Ministry of Agriculture and Rural Affairs, before joining the Molecular Biology and Biotechnology R&D Center of the Middle East Technical University. She started at METU in 2005 with a permanent position at the Genome Analysis Unit.<br />
She is proficient in gene expression techniques and assay development including microarray profiling and qPCR, also experienced in high-throughput data analysis of microarray results and experienced in working with genetically modified organisms. She is currently working as a research scientist at multidisciplinary projects. She contributes to the IGEM team with her expertise on molecular biology</p><br />
</div><!--text ends--><br />
</div><!--right_column ends--><br />
</div> <!--content ends--><br />
</div> <!--wrapper ends--><br />
<br />
</body><br />
<br />
<br />
<div class="heading"><br />
<h3>Advisors</h3><br />
</div> <!--heading ends--> <br />
<br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Erhan ASTARCI</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/c5/Man.jpg" alt=""/>Erhan received his MSc degree in Department of Biotechnology, PhD degree in Department of Biochemistry from Middle East Technical University. He worked on heat resisting <br />
protein productio, expression and purification in master thesis. He is currently working on regulation of nuclear factor kappa b protein regulation in inflammatory based <br />
colon cancer cells in his Phd. work.He is teaching asistant in Biochemistry. He contributes to the IGEM team with his protein knowledge and molecular biolog . </p><br />
</div><!--text ends--><br />
<div class="right_column"><br />
<div class="text alternative"><br />
<h3>Hamdi KAMÇI</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;"src="https://static.igem.org/mediawiki/2010/6/6b/Hamdiii.jpg" alt=""/>Hamdi received his MSc and PhD degrees in Department of Biotechnology from Middle East Technical University. <br />
He worked on plant transgenics specially on lentil genetic ransformation in master thesis. He is currently constructing his vectors for functional gene transormation into lentil as a part of his Phd. work. He had a wok experience in a research company as general manager during his Msc. He contributes to the IGEM team with his recombinat DNA and gene cloning skills and experience .<br />
</p><br />
</div><!--text ends--><br />
</div><!--right_column ends--><br />
</div> <!--content ends--><br />
</div> <!--wrapper ends--><br />
<br />
</body><br />
<br />
<br />
<br />
<br />
</html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Team
Team:METU Turkey/Team
2010-10-27T21:29:07Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
#header{<br />
width: 886px;<br />
height: 35px;<br />
font-size: 14px;<br />
padding: 16px 35px 0px 22px;<br />
}<br />
<br />
#header p{<br />
float: left;<br />
color: #525961;<br />
}<br />
<br />
#header span{<br />
color: #bababa;<br />
}<br />
<br />
#header ul{<br />
float: right;<br />
}<br />
<br />
#header ul li{<br />
float: left;<br />
margin: 0px 12px 0px 0px;<br />
padding: 0px 0px 0px 12px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/9/9e/Header_navi_bg.gif) left bottom no-repeat;<br />
}<br />
<br />
#header ul li.no_bg{<br />
background: none;<br />
}<br />
<br />
#header ul li a{<br />
color:#fff;<br />
}<br />
<br />
#logo{<br />
display: inline-block;<br />
width: 264px;<br />
height: 100px;<br />
float: left;<br />
clear: both;<br />
margin: 0;<br />
background: url(https://static.igem.org/mediawiki/igem.org/4/4d/MTLogoE-co_sensor.jpg) no-repeat;<br />
text-indent: -9999px;<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #b6b7b9; }<br />
<br />
<br />
#teamImage{<br />
width:566px;<br />
height:423px;<br />
left: 200px;<br />
float: left;<br />
position:relative;<br />
margin: 20px 0px 20px 0px;<br />
background:url(https://igem.org/Image:MTteam_cell.png); <br />
}<br />
<br />
.left_column{<br />
clear:both;<br />
width: 475px;<br />
float: left;<br />
}<br />
.right_column{<br />
width: 475px;<br />
float: right;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 440px;<br />
float: left;<br />
padding: 0px 28px 0px 5px;<br />
margin: 0px 0px 20px 0px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 10px 0px 12px 10px;<br />
color: #fff;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 440px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: left;<br />
margin: 0px 10px 0px 5px;<br />
}<br />
<br />
.text a.continue{<br />
position: relative;<br />
color: #65b8f9;<br />
float: left;<br />
clear: left;<br />
font-size: 15px;<br />
margin: 30px 0px 0px 0px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
.heading{<br />
clear:both;<br />
<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
<br />
.heading h3{<br />
font-size: 20px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #fff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 950px;<br />
padding: 0px 0px 0px 0px;<br />
margin:0px 0px 0px 0px;<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#028AD3;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 15px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
</style><br />
</head><br />
<body><br />
<br />
<div id="wrapper"><br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
<br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> |</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
<br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--> <br />
<div id="metucontent"><br />
<!--<div id="teamImage"> <br />
</div>teamImage ends--><br />
<br />
<br />
<div class="heading"><br />
<h3>Students</h3><br />
</div> <!--heading ends--> <br />
<br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Cihan TAŞTAN</h3><br />
<p><img style="border: 0px solid ; width: 130px; height: 170px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/b8/CT.jpg" alt=""/>2010 is the last year for him as B.S degree at Molecular Biology and Genetics department. Moreover, he is studying at <br />
Computer Engineering as my minor department. His research will be on Scientist position at Cancer and Virology <br />
Relationship (Let's say Viral Oncology) by integrating novel technices of Bioinformatics and Synthetic Biology approaches. <br />
This is the second year for him at iGEM. </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Sibel ATAOL</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/ce/Sibelll.jpg" alt=""/>Sibel is senior student at Biology department, METU.This is the first year for her in IGEM team.Synthetic biology is the <br />
raising field of Biology what she believes.Studying in biotechnology, bioengineering with novel synthetic biology approaches <br />
is her desire for future.Indeed molecular biology is what she loves to work on so that she is in cloning team. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Funda GUZEY</h3><br />
<p><img style="border: 0px solid ; width: 110px; height: 180px;" alt="w7"src="https://static.igem.org/mediawiki/2010/9/95/FUNDA.jpg" alt=""/>She is a senior student of Biological Sciences at Middle East Technical University. This is her second year in iGEM competition. <br />
She gained experience in protein expression and purification in this summer. One of the her interests is Synthetic Biology.<br />
However, her main interest is Biomedical and Tissue Engineering. She feels lucky to have such a wonderful team and is glad to share <br />
a wonderful summer with her team. . </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<br />
<br />
<h3>Ebuzer KALYONCU</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/c5/Man.jpg" alt=""/>Ebuzer is a 4th year student of Molecular Biology and Genetics at Middle East Technical University in Turkey. He was experienced in protein <br />
expression and purification during this summer.He collected some wetlab experience and general knowledge about biotechnology equipments in <br />
Ozen LAB.His main interest is in the regulation of the development and function of the immune system.. </p><br />
</div><!--text ends--> <br />
</div><!--left_column ends--><br />
<div class="right_column"><br />
<div class="text alternative"><br />
<h3>Özkan İŞ</h3><br />
<p><img style="border: 0px solid ; width: 130px; height: 170px;" alt="w7"src="https://static.igem.org/mediawiki/2010/8/88/FOTO_yeni.JPG" alt=""/>Ozkan is especially interested in neuroscience. In near future, he wants to study in molecular neuroscience combined with <br />
synthetic biology approaches. He believes that by applying synthetic biology approaches to synapses, genetic mechanisms <br />
underlying the neurodegenerative diseases will be revealed. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Ceren ŞEREF</h3><br />
<p><img style="border: 0px solid ; width: 195px; height: 150px;" alt="w7" src="https://static.igem.org/mediawiki/2010/c/cd/Cerennn.jpg" alt=""/>Ceren is currently a junior year student of Biology department at Middle East Technical University. It is her first year in METU Syborg and also in iGEM. <br />
She wants to study Neuroscience, especially Neurodegenerative Diseases in the future. Furthermore, she is highly interested in Molecular Biology. <br />
She thinks that Synthetic Biology opens up a whole new page in Biology </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Serap MEMİK</h3><br />
<p><img style="border: 0px solid ; width: 160px; height: 150px;" alt="w7"src="https://static.igem.org/mediawiki/2010/2/27/DSCI0085.JPG" alt=""/>Serap is the third year student at the Middle East Technical University. She is highly interested in biotechnology and <br />
molecular biology. She thinks that synthetic biology has great potential and infinite opportunities to practice in human life.. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Rengin ERDEM</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/f/fa/Renginnn.png" alt=""/>Rengin is currently a Master’s student of Biotechnology at Middle East Technical University. She has got her Bachelor’s degree <br />
from Gazi University, her major being Biology. She always liked the idea of creating novel systems by utilizing the <br />
information derived from scientific studies. Therefore, she is quite excited to take part in a Synthetic Biology project. <br />
In addition to Synthetic Biology, she is also interested in Biomedical Sciences such as Developmental and Neurological <br />
Biology. Rengin is glad to have an enthusiastic and motivated group of colleagues to work with. </p><br />
</div><!--text ends--><br />
</div><!--right_column ends--><br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Bilgi GÜNGÖR</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/e/e9/Bilgi.png" alt=""/>Bilgi is first semester student in Master's program of Biotechnology at Middle East Technical University. She is graduated from <br />
Biology Department at METU and joined Metu Syborg iGEM Team during her senior year of her undergradute studies. She is interested in <br />
Molecular Cell Biology and her aim is to solve the mystery of the cell. . </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Selin AKKUZU</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/9/9d/Selinnn.png" alt=""/>When Selin participated in iGEM team, she was a senior student in Biology department at METU. She continues her higher education as<br />
a Master's student in Biotechnology at the same university. She is mainly interested in Protein Chemistry. She thinks <br />
that Synthetic Biology approaches includes everything in Biology. Therefore, Protein Chemistry and Modeling can be the backbone of <br />
Synthetic Biology. This project is just the beginning for her. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Esen SAYIN</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;" alt="w7"src="https://static.igem.org/mediawiki/2010/4/4c/Esennn.JPG" alt=""/>Esen completed the Molecular Biology and Genetics, BSc at Istanbul Technical University. Currently, she is master student in<br />
Biotechnology Program at Middle East Technical University and also teaching assistant at METU Biology Department. She enjoys to conduct<br />
experiments with fluorophores. She thinks that fluorophores like GFP and RFP have crucial roles at both synthetic biology and<br />
biotechnology. Her master thesis involves another type of fluorophore:quantum dots. In the future, she wants to conduct studies involve<br />
fluorescent molecules and even their development. </p><br />
</div><!--text ends--><br />
<br />
<div class="heading"><br />
<h3>Instructors</h3><br />
</div> <!--heading ends--> <br />
<br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Assistant Prof Can OZEN (Team Coordinator)</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/c5/Man.jpg" alt=""/> Dr. Ozen is the head of METU SYBORG (Synthetic Biology Research Group) and the coordinator of METU Turkey team in 2010. <br />
He is also the vice-chair of METU Biotechnology Department and the coordinator of Advanced Light Microscopy, Spectroscopy <br />
and Calorimetry units at the METU Central Laboratory. One of the primary research interests in Dr. Ozen's group is <br />
development and characterization of regulatory genetic elements.. </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Dr.Deniz YÜCEL</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;"src="https://static.igem.org/mediawiki/2010/0/0a/DYucelll_resim.jpg" alt=""/> Dr. Yucel received her MSc and PhD degrees in Department of Biotechnology from Middle East Technical University. <br />
She worked on enzyme/protein immobilization on polymeric materials and biosensors. She did her PhD on stem cell <br />
based nerve tissue engineering on guided constructs. During her PhD she worked on mesenchymal stem cell <br />
differentiation for one year at Massachusetts General Hospital and Tufts University. She is mainly interested in <br />
biomaterials (2D and 3D polymeric material designs), tissue engineering and stem cell plasticity. She is currently <br />
working as a Scientific Project Specialist at the Central Laboratory, Molecular Biology and Biotechnology R&D Center, <br />
Middle East Technical University. She contributes to the IGEM team with her instrumental skills and her experience <br />
in biochemistry and molecular biology.<br />
</p><br />
</div><!--text ends--><br />
</div><!--left_column ends--><br />
<div class="right_column"><br />
<div class="text alternative"><br />
<h3>Dr.Remziye YILMAZ</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;"src="https://static.igem.org/mediawiki/2010/a/a7/Remziye.jpg" alt=""/><br />
Remziye YILMAZ received her MSc and PhD degrees in Program of Biotechnology at the Food Engineering Department, University of Hacettepe. She then worked as founder in Biogenetic Laboratory of Ministry of Agriculture and Rural Affairs, before joining the Molecular Biology and Biotechnology R&D Center of the Middle East Technical University. She started at METU in 2005 with a permanent position at the Genome Analysis Unit.<br />
She is proficient in gene expression techniques and assay development including microarray profiling and qPCR, also experienced in high-throughput data analysis of microarray results and experienced in working with genetically modified organisms. She is currently working as a research scientist at multidisciplinary projects. She contributes to the IGEM team with her expertise on molecular biology</p><br />
</div><!--text ends--><br />
</div><!--right_column ends--><br />
</div> <!--content ends--><br />
</div> <!--wrapper ends--><br />
<br />
</body><br />
<br />
<br />
<div class="heading"><br />
<h3>Technical Assistants</h3><br />
</div> <!--heading ends--> <br />
<br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Erhan ASTARCI</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/c5/Man.jpg" alt=""/>Erhan received his MSc degree in Department of Biotechnology, PhD degree in Department of Biochemistry from Middle East Technical University. He worked on heat resisting <br />
protein productio, expression and purification in master thesis. He is currently working on regulation of nuclear factor kappa b protein regulation in inflammatory based <br />
colon cancer cells in his Phd. work.He is teaching asistant in Biochemistry. He contributes to the IGEM team with his protein knowledge and molecular biolog . </p><br />
</div><!--text ends--><br />
<div class="right_column"><br />
<div class="text alternative"><br />
<h3>Hamdi KAMÇI</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;"src="https://static.igem.org/mediawiki/2010/6/6b/Hamdiii.jpg" alt=""/>Hamdi received his MSc and PhD degrees in Department of Biotechnology from Middle East Technical University. <br />
He worked on plant transgenics specially on lentil genetic ransformation in master thesis. He is currently constructing his vectors for functional gene transormation into lentil as a part of his Phd. work. He had a wok experience in a research company as general manager during his Msc. He contributes to the IGEM team with his recombinat DNA and gene cloning skills and experience .<br />
</p><br />
</div><!--text ends--><br />
</div><!--right_column ends--><br />
</div> <!--content ends--><br />
</div> <!--wrapper ends--><br />
<br />
</body><br />
<br />
<br />
<br />
<br />
</html></div>
Metugen
http://2010.igem.org/Team:METU_Turkey/Team
Team:METU Turkey/Team
2010-10-27T21:27:53Z
<p>Metugen: </p>
<hr />
<div><html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<title>Home</title><br />
<meta name="description" content="" /><br />
<meta name="keywords" content="" /><br />
<style type="text/css"><br />
ul,ol,li,h1,h2,h3,h4,h5,h6,p{<br />
margin:0;<br />
padding:0;<br />
}<br />
ul{<br />
list-style:none;<br />
}<br />
a,a:link,a:visited,a:hover{<br />
color:#00f;<br />
text-decoration:none;<br />
}<br />
a:focus,a:hover{<br />
text-decoration:underline;<br />
}<br />
a img{<br />
border:0;<br />
}<br />
.clear{<br />
clear:both;<br />
}<br />
<br />
body{<br />
margin:0;<br />
padding:0;<br />
background:#f1f1f1 repeat-y;<br />
color:#000;<br />
font:62.5% Myriad Pro,Arial,sans-serif;<br />
}<br />
#header{<br />
width: 886px;<br />
height: 35px;<br />
font-size: 14px;<br />
padding: 16px 35px 0px 22px;<br />
}<br />
<br />
#header p{<br />
float: left;<br />
color: #525961;<br />
}<br />
<br />
#header span{<br />
color: #bababa;<br />
}<br />
<br />
#header ul{<br />
float: right;<br />
}<br />
<br />
#header ul li{<br />
float: left;<br />
margin: 0px 12px 0px 0px;<br />
padding: 0px 0px 0px 12px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/9/9e/Header_navi_bg.gif) left bottom no-repeat;<br />
}<br />
<br />
#header ul li.no_bg{<br />
background: none;<br />
}<br />
<br />
#header ul li a{<br />
color:#fff;<br />
}<br />
<br />
#logo{<br />
display: inline-block;<br />
width: 264px;<br />
height: 100px;<br />
float: left;<br />
clear: both;<br />
margin: 0;<br />
background: url(https://static.igem.org/mediawiki/igem.org/4/4d/MTLogoE-co_sensor.jpg) no-repeat;<br />
text-indent: -9999px;<br />
}<br />
<br />
#banner{<br />
float: left;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
#banner img{<br />
float: left;<br />
}<br />
<br />
#metucontent{<br />
width: 965px;<br />
<br />
}<br />
#content{background: #b6b7b9; }<br />
<br />
<br />
#teamImage{<br />
width:566px;<br />
height:423px;<br />
left: 200px;<br />
float: left;<br />
position:relative;<br />
margin: 20px 0px 20px 0px;<br />
background:url(https://igem.org/Image:MTteam_cell.png); <br />
}<br />
<br />
.left_column{<br />
clear:both;<br />
width: 475px;<br />
float: left;<br />
}<br />
.right_column{<br />
width: 475px;<br />
float: right;<br />
}<br />
<br />
.text{<br />
font-family: Helvetica, Arial;<br />
width: 440px;<br />
float: left;<br />
padding: 0px 28px 0px 5px;<br />
margin: 0px 0px 20px 0px;<br />
}<br />
<br />
.text h3{<br />
font-size: 18px;<br />
float: left;<br />
margin: 10px 0px 12px 10px;<br />
color: #fff;<br />
}<br />
<br />
.text p{<br />
color: #ffffff;<br />
width: 440px;<br />
float: left;<br />
clear: left;<br />
font-size: 12px;<br />
}<br />
<br />
.text p img{<br />
float: left;<br />
margin: 0px 10px 0px 5px;<br />
}<br />
<br />
.text a.continue{<br />
position: relative;<br />
color: #65b8f9;<br />
float: left;<br />
clear: left;<br />
font-size: 15px;<br />
margin: 30px 0px 0px 0px;<br />
}<br />
<br />
.alternative{<br />
background: #2a2d32;<br />
border-top: 1px solid #26292e;<br />
border-bottom: 1px solid #26292e;<br />
}<br />
.heading{<br />
clear:both;<br />
<br />
height: 20px;<br />
float: left;<br />
padding: 6px 14px 6px 14px;<br />
margin: 0px 0px 12px 0px;<br />
background: url(https://static.igem.org/mediawiki/igem.org/7/77/Navigation_btn_bg.gif) repeat-x;<br />
}<br />
<br />
<br />
.heading h3{<br />
font-size: 20px;<br />
color: #ffffff;<br />
float: left;<br />
font-weight: normal;<br />
}<br />
<br />
.heading img{<br />
float: right;<br />
margin: 3px 0px 0px 0px;<br />
}<br />
<br />
ul{<br />
float: left;<br />
margin: 0px 0px 39px 0px;<br />
}<br />
<br />
ul.sitemap li a{<br />
font-size: 14px;<br />
color: #fff;<br />
margin: 0px 0px 17px 11px;<br />
}<br />
<br />
ul.sitemap li span{<br />
color: #65b8f9;<br />
}<br />
<br />
.replace{<br />
position:relative;<br />
margin:0;<br />
padding:0;<br />
/* \*/<br />
overflow:hidden;<br />
/* */<br />
}<br />
.replace span{<br />
display:block;<br />
position:absolute;<br />
top:0;<br />
left:0;<br />
z-index:1;<br />
}<br />
<br />
#wrapper{<br />
width: 950px;<br />
padding: 0px 0px 0px 0px;<br />
margin:0px 0px 0px 0px;<br />
}<br />
<br />
<br />
<br />
/* CSS Document */<br />
<br />
#tab_nav {<br />
height: 40px;<br />
float: left;<br />
background: url(https://static.igem.org/mediawiki/igem.org/5/50/Navigation_bg.jpg) repeat-x;<br />
}<br />
<br />
#topnav li.active a{<br />
color:#028AD3;<br />
}<br />
ul#topnav {<br />
float: left;<br />
width: 964px;<br />
list-style: none;<br />
position: relative;<br />
margin-top:0px;<br />
}<br />
ul#topnav li {<br />
float: left;<br />
}<br />
ul#topnav li a {<br />
padding: 10px 15px;<br />
display: block;<br />
color: #fff;<br />
text-decoration: none;<br />
font-size:14px;<br />
}<br />
ul#topnav li a:hover {<br />
text-decoration: none;<br />
background: #016acb;<br />
height: 15px;<br />
<br />
}<br />
}<br />
ul#topnav li:hover { <br />
z-index:1000;<br />
}<br />
ul#topnav li span {<br />
float: left;<br />
z-index:1000;<br />
position: absolute;<br />
left: 0;<br />
top:35px;<br />
display: none;<br />
width:964px;<br />
color: #fff;<br />
-moz-border-radius-bottomright: 5px;<br />
-khtml-border-radius-bottomright: 5px;<br />
-webkit-border-bottom-right-radius: 5px;<br />
-moz-border-radius-bottomleft: 5px;<br />
-khtml-border-radius-bottomleft: 5px;<br />
-webkit-border-bottom-left-radius: 5px;<br />
background-color: #028AD3;<br />
padding-top: 8px;<br />
padding-right: 0;<br />
padding-bottom: 8px;<br />
padding-left: 0;<br />
}<br />
ul#topnav li:hover span { display: block;}<br />
ul#topnav li span a { display: inline; font-weight; normal; }<br />
ul#topnav li span a:hover {text-decoration: none;}<br />
#groupparts {<br />
width: 650px!important;<br />
}<br />
#contentSub {<br />
display:none;<br />
}<br />
<br />
#siteSub {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
display:none;<br />
}<br />
<br />
.firstHeading {<br />
display:none;<br />
}<br />
<br />
#search-controls {<br />
margin-top:30px;<br />
}<br />
<br />
<br />
#p-logo {<br />
height:1px;<br />
overflow:hidden;<br />
display: none;<br />
}<br />
#top-section {<br />
height: 10px;<br />
margin-top: -4px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
margin-bottom: 0;<br />
margin-bottom: 0px;<br />
padding: 0px 0px 0px 0px;<br />
border: none;<br />
position: relative;<br />
top:-65px;<br />
}<br />
<br />
</style><br />
</head><br />
<body><br />
<br />
<div id="wrapper"><br />
<p>&nbsp;</p><br />
<div id="banner"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/MTlastBanner.png" alt="" width="963" /><br />
<br />
</div> <!--banner ends--><br />
<br />
<br />
<br />
<div id="tab_nav"><br />
<ul id="topnav"><br />
<li class="active"><a href="https://2010.igem.org/Team:METU_Turkey">HOME</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Team">TEAM</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Project">PROJECT</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Project">Description</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Planning">Planning</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Results_Discussion">Results & Discussion</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Conclusions">Conclusions</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Future_Work">Future Work</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Safety">Safety</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/References">References</a> |<br />
<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Acknowledgements">Acknowledgements</a> |<br />
<br />
<br />
</span><br />
</li><br />
<li><a href="http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2010&group=METU_Turkey">PARTS</a></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Support_Actions">SUPPORT ACTIONS</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Collaboration">Collaboration</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Characterization_of_an_existing_part">Characterization of an Existing Part</a> |</span></li><br />
<br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Notebook">NOTEBOOK</a><br />
<span><br />
<a href="https://2010.igem.org/Team:METU_Turkey/Alpha">Alpha Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Bravo">Bravo Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Charlie">Charlie Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Delta">Delta Team</a> |<br />
<a href="https://2010.igem.org/Team:METU_Turkey/Procedures">Procedures</a><br />
</span></li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Gallery">GALLERY</a><br />
<br />
<br />
</li><br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Sponsors">SPONSORS</a><br />
<br />
</li> <br />
<li><a href="https://2010.igem.org/Team:METU_Turkey/Links">LINKS</a></li><br />
<br />
</ul><!--topnav ends--><br />
</div><!--tab_nav ends--> <br />
<div id="metucontent"><br />
<!--<div id="teamImage"> <br />
</div>teamImage ends--><br />
<br />
<br />
<div class="heading"><br />
<h3>Students</h3><br />
</div> <!--heading ends--> <br />
<br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Cihan TAŞTAN</h3><br />
<p><img style="border: 0px solid ; width: 130px; height: 170px;" alt="w7" src="https://static.igem.org/mediawiki/2010/b/b8/CT.jpg" alt=""/>2010 is the last year for him as B.S degree at Molecular Biology and Genetics department. Moreover, he is studying at <br />
Computer Engineering as my minor department. His research will be on Scientist position at Cancer and Virology <br />
Relationship (Let's say Viral Oncology) by integrating novel technices of Bioinformatics and Synthetic Biology approaches. <br />
This is the second year for him at iGEM. </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Sibel ATAOL</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/ce/Sibelll.jpg" alt=""/>Sibel is senior student at Biology department, METU.This is the first year for her in IGEM team.Synthetic biology is the <br />
raising field of Biology what she believes.Studying in biotechnology, bioengineering with novel synthetic biology approaches <br />
is her desire for future.Indeed molecular biology is what she loves to work on so that she is in cloning team. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Funda GUZEY</h3><br />
<p><img style="border: 0px solid ; width: 110px; height: 180px;" alt="w7"src="https://static.igem.org/mediawiki/2010/9/95/FUNDA.jpg" alt=""/>She is a senior student of Biological Sciences at Middle East Technical University. This is her second year in iGEM competition. <br />
She gained experience in protein expression and purification in this summer. One of the her interests is Synthetic Biology.<br />
However, her main interest is Biomedical and Tissue Engineering. She feels lucky to have such a wonderful team and is glad to share <br />
a wonderful summer with her team. . </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<br />
<br />
<h3>Ebuzer KALYONCU</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/c5/Man.jpg" alt=""/>Ebuzer is a 4th year student of Molecular Biology and Genetics at Middle East Technical University in Turkey. He was experienced in protein <br />
expression and purification during this summer.He collected some wetlab experience and general knowledge about biotechnology equipments in <br />
Ozen LAB.His main interest is in the regulation of the development and function of the immune system.. </p><br />
</div><!--text ends--> <br />
</div><!--left_column ends--><br />
<div class="right_column"><br />
<div class="text alternative"><br />
<h3>Özkan İŞ</h3><br />
<p><img style="border: 0px solid ; width: 130px; height: 170px;" alt="w7"src="https://static.igem.org/mediawiki/2010/8/88/FOTO_yeni.JPG" alt=""/>Ozkan is especially interested in neuroscience. In near future, he wants to study in molecular neuroscience combined with <br />
synthetic biology approaches. He believes that by applying synthetic biology approaches to synapses, genetic mechanisms <br />
underlying the neurodegenerative diseases will be revealed. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Ceren ŞEREF</h3><br />
<p><img style="border: 0px solid ; width: 195px; height: 150px;" alt="w7" src="https://static.igem.org/mediawiki/2010/c/cd/Cerennn.jpg" alt=""/>Ceren is currently a junior year student of Biology department at Middle East Technical University. It is her first year in METU Syborg and also in iGEM. <br />
She wants to study Neuroscience, especially Neurodegenerative Diseases in the future. Furthermore, she is highly interested in Molecular Biology. <br />
She thinks that Synthetic Biology opens up a whole new page in Biology </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Serap MEMİK</h3><br />
<p><img style="border: 0px solid ; width: 160px; height: 150px;" alt="w7"src="https://static.igem.org/mediawiki/2010/2/27/DSCI0085.JPG" alt=""/>Serap is the third year student at the Middle East Technical University. She is highly interested in biotechnology and <br />
molecular biology. She thinks that synthetic biology has great potential and infinite opportunities to practice in human life.. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Rengin ERDEM</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/f/fa/Renginnn.png" alt=""/>Rengin is currently a Master’s student of Biotechnology at Middle East Technical University. She has got her Bachelor’s degree <br />
from Gazi University, her major being Biology. She always liked the idea of creating novel systems by utilizing the <br />
information derived from scientific studies. Therefore, she is quite excited to take part in a Synthetic Biology project. <br />
In addition to Synthetic Biology, she is also interested in Biomedical Sciences such as Developmental and Neurological <br />
Biology. Rengin is glad to have an enthusiastic and motivated group of colleagues to work with. </p><br />
</div><!--text ends--><br />
</div><!--right_column ends--><br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Bilgi GÜNGÖR</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/e/e9/Bilgi.png" alt=""/>Bilgi is first semester student in Master's program of Biotechnology at Middle East Technical University. She is graduated from <br />
Biology Department at METU and joined Metu Syborg iGEM Team during her senior year of her undergradute studies. She is interested in <br />
Molecular Cell Biology and her aim is to solve the mystery of the cell. . </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Selin AKKUZU</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/9/9d/Selinnn.png" alt=""/>When Selin participated in iGEM team, she was a senior student in Biology department at METU. She continues her higher education as<br />
a Master's student in Biotechnology at the same university. She is mainly interested in Protein Chemistry. She thinks <br />
that Synthetic Biology approaches includes everything in Biology. Therefore, Protein Chemistry and Modeling can be the backbone of <br />
Synthetic Biology. This project is just the beginning for her. </p><br />
</div><!--text ends--><br />
<div class="text"><br />
<h3>Esen SAYIN</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;" alt="w7"src="https://static.igem.org/mediawiki/2010/4/4c/Esennn.JPG" alt=""/>Esen completed the Molecular Biology and Genetics, BSc at Istanbul Technical University. Currently, she is master student in<br />
Biotechnology Program at Middle East Technical University and also teaching assistant at METU Biology Department. She enjoys to conduct<br />
experiments with fluorophores. She thinks that fluorophores like GFP and RFP have crucial roles at both synthetic biology and<br />
biotechnology. Her master thesis involves another type of fluorophore:quantum dots. In the future, she wants to conduct studies involve<br />
fluorescent molecules and even their development. </p><br />
</div><!--text ends--><br />
<br />
<div class="heading"><br />
<h3>Advisors</h3><br />
</div> <!--heading ends--> <br />
<br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Assistant Prof Can OZEN (Team Coordinator)</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/c5/Man.jpg" alt=""/> Dr. Ozen is the head of METU SYBORG (Synthetic Biology Research Group) and the coordinator of METU Turkey team in 2010. <br />
He is also the vice-chair of METU Biotechnology Department and the coordinator of Advanced Light Microscopy, Spectroscopy <br />
and Calorimetry units at the METU Central Laboratory. One of the primary research interests in Dr. Ozen's group is <br />
development and characterization of regulatory genetic elements.. </p><br />
</div><!--text ends--><br />
<div class="text alternative"><br />
<h3>Dr.Deniz YÜCEL</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;"src="https://static.igem.org/mediawiki/2010/0/0a/DYucelll_resim.jpg" alt=""/> Dr. Yucel received her MSc and PhD degrees in Department of Biotechnology from Middle East Technical University. <br />
She worked on enzyme/protein immobilization on polymeric materials and biosensors. She did her PhD on stem cell <br />
based nerve tissue engineering on guided constructs. During her PhD she worked on mesenchymal stem cell <br />
differentiation for one year at Massachusetts General Hospital and Tufts University. She is mainly interested in <br />
biomaterials (2D and 3D polymeric material designs), tissue engineering and stem cell plasticity. She is currently <br />
working as a Scientific Project Specialist at the Central Laboratory, Molecular Biology and Biotechnology R&D Center, <br />
Middle East Technical University. She contributes to the IGEM team with her instrumental skills and her experience <br />
in biochemistry and molecular biology.<br />
</p><br />
</div><!--text ends--><br />
</div><!--left_column ends--><br />
<div class="right_column"><br />
<div class="text alternative"><br />
<h3>Dr.Remziye YILMAZ</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;"src="https://static.igem.org/mediawiki/2010/a/a7/Remziye.jpg" alt=""/><br />
Remziye YILMAZ received her MSc and PhD degrees in Program of Biotechnology at the Food Engineering Department, University of Hacettepe. She then worked as founder in Biogenetic Laboratory of Ministry of Agriculture and Rural Affairs, before joining the Molecular Biology and Biotechnology R&D Center of the Middle East Technical University. She started at METU in 2005 with a permanent position at the Genome Analysis Unit.<br />
She is proficient in gene expression techniques and assay development including microarray profiling and qPCR, also experienced in high-throughput data analysis of microarray results and experienced in working with genetically modified organisms. She is currently working as a research scientist at multidisciplinary projects. She contributes to the IGEM team with her expertise on molecular biology</p><br />
</div><!--text ends--><br />
</div><!--right_column ends--><br />
</div> <!--content ends--><br />
</div> <!--wrapper ends--><br />
<br />
</body><br />
<br />
<br />
<div class="heading"><br />
<h3>Technical Assistants</h3><br />
</div> <!--heading ends--> <br />
<br />
<br />
<div class="left_column"><br />
<br />
<div class="text"><br />
<h3>Erhan ASTARCI</h3><br />
<p><img src="https://static.igem.org/mediawiki/2010/c/c5/Man.jpg" alt=""/>Erhan received his MSc degree in Department of Biotechnology, PhD degree in Department of Biochemistry from Middle East Technical University. He worked on heat resisting <br />
protein productio, expression and purification in master thesis. He is currently working on regulation of nuclear factor kappa b protein regulation in inflammatory based <br />
colon cancer cells in his Phd. work.He is teaching asistant in Biochemistry. He contributes to the IGEM team with his protein knowledge and molecular biolog . </p><br />
</div><!--text ends--><br />
<div class="right_column"><br />
<div class="text alternative"><br />
<h3>Hamdi KAMÇI</h3><br />
<p><img style="border: 0px solid ; width: 133px; height: 190px;"src="https://static.igem.org/mediawiki/2010/6/6b/Hamdiii.jpg" alt=""/>Hamdi received his MSc and PhD degrees in Department of Biotechnology from Middle East Technical University. <br />
He worked on plant transgenics specially on lentil genetic ransformation in master thesis. He is currently constructing his vectors for functional gene transormation into lentil as a part of his Phd. work. He had a wok experience in a research company as general manager during his Msc. He contributes to the IGEM team with his recombinat DNA and gene cloning skills and experience .<br />
</p><br />
</div><!--text ends--><br />
</div><!--right_column ends--><br />
</div> <!--content ends--><br />
</div> <!--wrapper ends--><br />
<br />
</body><br />
<br />
<br />
<br />
<br />
</html></div>
Metugen