http://2010.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=250&target=Faha2010.igem.org - User contributions [en]2024-03-28T19:49:49ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:Freiburg_Bioware/css_homepageTeam:Freiburg Bioware/css homepage2011-01-05T16:41:37Z<p>Faha: </p>
<hr />
<div><html><br />
<style><br />
<br />
.separator{<br />
border-bottom: 1px solid #eee;<br />
}<br />
<br />
div.box_home {<br />
margin:15px;<br />
float:left;<br />
width:400px;<br />
height:240px;<br />
padding:10px;<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/e/eb/Freiburg10_Box_Home.png) no-repeat scroll center 0px;<br />
}<br />
div.box_home:hover {<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/e/eb/Freiburg10_Box_Home.png) no-repeat scroll center 0px;<br />
}<br />
div.box_home div.img {<br />
width:140px;<br />
}<br />
.box_home h2 {<br />
width:265px;<br />
}<br />
div.box_home_small {<br />
margin:15px;<br />
float:left;<br />
width:175px;<br />
height:240px;<br />
padding:10px;<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/f/f0/Freiburg10_Box_Small.png) no-repeat scroll center 0px;<br />
}<br />
div.box_home_small:hover {<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/f/f0/Freiburg10_Box_Small.png) no-repeat scroll center 0px;<br />
}<br />
<br />
div.box_home_small img {<br />
max-width: 50px;<br />
float:right;<br />
margin:0 10px 10px 0;<br />
}<br />
.box_home_small h2 {<br />
width:110px;<br />
}<br />
<br />
div.box_long {<br />
margin:15px;<br />
float:left;<br />
width:400px;<br />
height:95px;<br />
padding:10px;<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/7/72/Freiburg10_Box_Long.png) no-repeat scroll center 0px;<br />
}<br />
<br />
div.box_long img {<br />
max-width: 100px;<br />
max-height:100px;<br />
float:right;<br />
margin:0 10px 10px 0;<br />
}<br />
<br />
div.box_long h2 {<br />
width: 335px;<br />
}<br />
<br />
div.div_home {<br />
width: 590px;<br />
margin:0 15px 15px;<br />
float:left;<br />
}<br />
<br />
div.virus {<br />
height:260px;<br />
margin: 0 15px 15px;<br />
float:right;<br />
}<br />
<br />
<br />
/* labjournal css */<br />
<br />
.box_labjournal_195 a {<br />
margin: 5px 0px 5px 25px;<br />
float: left;<br />
width: 195px;<br />
height: 260px;<br />
background: transparent url(https://static.igem.org/mediawiki/2010/f/f0/Freiburg10_Box_Small.png) no-repeat scroll center 0px;<br />
}<br />
.box_labjournal_195 a:hover {<br />
background: transparent url(https://static.igem.org/mediawiki/2010/7/7c/Freiburg10_Box_klein.png) no-repeat scroll center 0px;<br />
text-decoration: none;<br />
}<br />
<br />
.image_labjournal {<br />
width: 195px;<br />
height: auto;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
.boxes_labjournal_day {<br />
font-family: verdana,arial,helvetica,geneva,sans-serif;<br />
font-size: 12px;<br />
text-align: left<br />
margin: 10px 0px 0px 5px;<br />
color: #333;<br />
}<br />
<br />
.boxes_labjournal_text {<br />
font-family: verdana,arial,helvetica,geneva,sans-serif;<br />
font-size: 12px;<br />
text-align: center;<br />
margin: 5px 0px 0px 0px;<br />
color: #333;<br />
}<br />
<br />
/*labjournal style ends here */<br />
<br />
#logo {<br />
width: 160px;<br />
height: 180px;<br />
margin: 15px 10px 0px 10px;<br />
float: left;<br />
align: left;<br />
vertical-align: bottom;<br />
}<br />
<br />
img.logoright {<br />
margin: 5px;<br />
float: right;<br />
}<br />
<br />
img.logorightII {<br />
margin: 50px 100px 30px 200px;<br />
float: right;<br />
}<br />
<br />
/* news ticker */<br />
.newsticker {<br />
list-style-type: none;<br />
list-style-image: none;<br />
border: none;<br />
background: transparent;<br />
padding: 0;<br />
margin: 0;<br />
top:-30px;<br />
}<br />
.news p {<br />
margin:0;<br />
position:relative;<br />
top:45px;<br />
font-size:1em;<br />
text-align:center;<br />
left:-10px;<br />
padding:0 5px;<br />
}<br />
<br />
.news {<br />
position:relative;<br />
top:-30px;<br />
}<br />
<br />
div.box_long_news a h2 {<br />
width: 275px;<br />
}<br />
<br />
/* go to the top */<br />
<br />
#to_top {<br />
position: fixed;<br />
bottom: 50px;<br />
right: 10px;<br />
height: 110px;<br />
width: 40px;<br />
background: transparent url("http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/c/cb/To_the_top_image.png") no-repeat scroll center center;<br />
/*border: 1px solid black;*/<br />
}<br />
<br />
</style><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/HeadTeam:Freiburg Bioware/Head2011-01-05T16:41:14Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/css}}<br />
<html><br />
<div id="banner-wrap"><div id="banner1"></div><div id="banner2"></div><div id="banner3"></div></div><div class="clearfix"></div><br />
<div><a href="#banner-wrap" id="to_top"></a></div><br />
<!-- please find the css for the "top" button under Team:Freiburg Bioware/css homepage --><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/HeadTeam:Freiburg Bioware/Head2011-01-05T16:38:36Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/css}}<br />
<html><br />
<div id="banner-wrap"><div id="banner1"></div><div id="banner2"></div><div id="banner3"></div></div><div class="clearfix"></div><br />
<div><a href="#banner-wrap" id="to_top"></a></div><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/css_homepageTeam:Freiburg Bioware/css homepage2011-01-05T16:38:23Z<p>Faha: </p>
<hr />
<div><html><br />
<style><br />
<br />
.separator{<br />
border-bottom: 1px solid #eee;<br />
}<br />
<br />
div.box_home {<br />
margin:15px;<br />
float:left;<br />
width:400px;<br />
height:240px;<br />
padding:10px;<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/e/eb/Freiburg10_Box_Home.png) no-repeat scroll center 0px;<br />
}<br />
div.box_home:hover {<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/e/eb/Freiburg10_Box_Home.png) no-repeat scroll center 0px;<br />
}<br />
div.box_home div.img {<br />
width:140px;<br />
}<br />
.box_home h2 {<br />
width:265px;<br />
}<br />
div.box_home_small {<br />
margin:15px;<br />
float:left;<br />
width:175px;<br />
height:240px;<br />
padding:10px;<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/f/f0/Freiburg10_Box_Small.png) no-repeat scroll center 0px;<br />
}<br />
div.box_home_small:hover {<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/f/f0/Freiburg10_Box_Small.png) no-repeat scroll center 0px;<br />
}<br />
<br />
div.box_home_small img {<br />
max-width: 50px;<br />
float:right;<br />
margin:0 10px 10px 0;<br />
}<br />
.box_home_small h2 {<br />
width:110px;<br />
}<br />
<br />
div.box_long {<br />
margin:15px;<br />
float:left;<br />
width:400px;<br />
height:95px;<br />
padding:10px;<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/7/72/Freiburg10_Box_Long.png) no-repeat scroll center 0px;<br />
}<br />
<br />
div.box_long img {<br />
max-width: 100px;<br />
max-height:100px;<br />
float:right;<br />
margin:0 10px 10px 0;<br />
}<br />
<br />
div.box_long h2 {<br />
width: 335px;<br />
}<br />
<br />
div.div_home {<br />
width: 590px;<br />
margin:0 15px 15px;<br />
float:left;<br />
}<br />
<br />
div.virus {<br />
height:260px;<br />
margin: 0 15px 15px;<br />
float:right;<br />
}<br />
<br />
<br />
/* labjournal css */<br />
<br />
.box_labjournal_195 a {<br />
margin: 5px 0px 5px 25px;<br />
float: left;<br />
width: 195px;<br />
height: 260px;<br />
background: transparent url(https://static.igem.org/mediawiki/2010/f/f0/Freiburg10_Box_Small.png) no-repeat scroll center 0px;<br />
}<br />
.box_labjournal_195 a:hover {<br />
background: transparent url(https://static.igem.org/mediawiki/2010/7/7c/Freiburg10_Box_klein.png) no-repeat scroll center 0px;<br />
text-decoration: none;<br />
}<br />
<br />
.image_labjournal {<br />
width: 195px;<br />
height: auto;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
.boxes_labjournal_day {<br />
font-family: verdana,arial,helvetica,geneva,sans-serif;<br />
font-size: 12px;<br />
text-align: left<br />
margin: 10px 0px 0px 5px;<br />
color: #333;<br />
}<br />
<br />
.boxes_labjournal_text {<br />
font-family: verdana,arial,helvetica,geneva,sans-serif;<br />
font-size: 12px;<br />
text-align: center;<br />
margin: 5px 0px 0px 0px;<br />
color: #333;<br />
}<br />
<br />
/*labjournal style ends here */<br />
<br />
#logo {<br />
width: 160px;<br />
height: 180px;<br />
margin: 15px 10px 0px 10px;<br />
float: left;<br />
align: left;<br />
vertical-align: bottom;<br />
}<br />
<br />
img.logoright {<br />
margin: 5px;<br />
float: right;<br />
}<br />
<br />
img.logorightII {<br />
margin: 50px 100px 30px 200px;<br />
float: right;<br />
}<br />
<br />
/* news ticker */<br />
.newsticker {<br />
list-style-type: none;<br />
list-style-image: none;<br />
border: none;<br />
background: transparent;<br />
padding: 0;<br />
margin: 0;<br />
top:-30px;<br />
}<br />
.news p {<br />
margin:0;<br />
position:relative;<br />
top:45px;<br />
font-size:1em;<br />
text-align:center;<br />
left:-10px;<br />
padding:0 5px;<br />
}<br />
<br />
.news {<br />
position:relative;<br />
top:-30px;<br />
}<br />
<br />
div.box_long_news a h2 {<br />
width: 275px;<br />
}<br />
<br />
/* go to the top */<br />
<br />
#to_top {<br />
position: fixed;<br />
bottom: 50px;<br />
right: 10px;<br />
height: 110px;<br />
width: 40px;<br />
background: transparent url("http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/c/cb/To_the_top_image.png") no-repeat scroll center center;<br />
border: 1px solid black;<br />
}<br />
<br />
</style><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/MayTeam:Freiburg Bioware/NoteBook/Labjournal/May2011-01-05T16:33:35Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/css}}<br />
{{:Team:Freiburg_Bioware/Head}}<br />
{{:Team:Freiburg_Bioware/menu_notebook}}<br />
{{:Team:Freiburg_Bioware/jquery}}<br />
<br />
<!-- Freiburg_bioware --><br />
[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook => Back to Notebook overview]<br><br><br />
<html><br />
<br />
<div class="box_right"><br />
<left><u1>NoteBook Navigator</u1></left><br />
<br><br />
<br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/March">March (labday 1)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/April">April (labday 2 - 5)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/May">May (labday 6 - 17)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June">June (labday 18 - 45)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/July">July (labday 46 - 75)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August">August part 1 (labday 76 - 92)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August2">August part 2 (labday 93 - 106)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September">September part 1 (labday 107 - 123)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September2">September part 2 (labday 124 - 135)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October">October part 1 (labday 136 - 149 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October2">October part 2 (labday 150 - 166 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/November">November (labday 167 - 170 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/Cellculture">Cellculture</a></li><br />
</ul><br />
</div><br />
</html><br />
===<p style="font-size:17px; background-color:#00dd77;">6. Labday 03.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Theoretical cloning</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Hanna, Bea, Patrick, Chris W. </b></p><br /><br />
Several theoretical cloning issues need to be adressed: The modularization and modification of the Stratagene plasmids and the prodrug activating enzymes. :<br><br />
<br /><br />
1. Cap-Gen: <br />
* delete the PstI-restriction site<br />
* insert an antibody fragment (targeting): sequence? in which part of VP1? (Patrick)<br />
* add prefix & suffix <br />
* disable binding of Heparan Sulphat Proteoglycan <br />
<br><br />
2. Rep-Gen:<br />
* delete EcoRI (2x) and PstI (2x) <br />
<br><br />
3. ITRs:<br />
* NotI and PstI (in sequence?) flank the ITRs: The question whether they can/have to be deleted arose.<br />
* where exactly does the sequence start and end? (Patrick)<br />
* we should check if three ITRs could be used to increase expression levels<br />
* we blasted the ITR (left) of the MCS vektor (Stratagene). we got a 92% "Coverage" with the AAV2 genom (to 100%). from the alignment (Stratagene ITR with ITR of the AAV2 genom) we got:<br><br />
[[Image:Freiburg10 ITR(left)-Stratagene vs. ITR AAV2.jpg|thumb|center|500px|]]<br />
<br />
<br />
<br />
You can see, that the ITR sequence begins 4 bp after the PstI restriction site. thereupon we did a secundary structure analyse (www.dinamelt.bioinfo.rpi.edu), with the following structure we got: <br><br />
[[Media:Freiburg10_AAV2ITR(left)nachBlast.pdf]] <br><br />
conclusion: the big loop of the secondary structure dosent change if we delete the PstI restriction site (cf. with other uploadet secondary structures), it should be considered that we can't add random bp that could affect the secundary structure. <br><br />
<b>To do: which bp, which sequence could/can be insertet? cf. the genome of AAV2</b> <br><br />
<br><br />
4. MCS:<br />
* replacement through the iGEM-MCS<br />
* where is the beginning and ending of the MCS in the Vector? ß-globin function and sequence (search for literature and patents, which are denoted in the AAV-Helper-Free-System Manual)<br />
* in this context it would be also important to find out where the beta-Globulin-Intron exactly starts or rather we can cut out the MCS.<br />
<br><br />
5. enzymes:<br />
* Thymidinkinase: find informations. TK30 (Bea), SR39 (Hanna)<br />
* Cytosindeaminase: find informations (Adrian)<br />
<br><br />
in addition we downloaded, added and anotated the sequence of the pHelper plasmid of Stratagene in Geneious (see "Constructs"). <br />
<br />
<br />
insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">7. Labday 07.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Protocolls</b></p>====<br />
<br />
<p><b>Investigators: Anissa, Kerstin </b></p><br><br />
<br />
* adaption and extension of the standart prorcolls (Cloning for Pro's)<br />
* we startet to create a protokoll-mask for the praktical-cloning (short version for labwork)<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">8. Labday 10.05.2010</p> ===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Stock solutions</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Chris W., Chris L., Bea, Achim, Patrick, Hanna, (Sven)</b></p><br><br />
The following stock solutions were prepared: <br><br />
1. Antibiotics:<br />
* Ampicillin: 2 g Ampicillin were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at -20°C.<br />
* Chloramphenicol: 0.5 g Chloramphenicol were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at the -20°C.<br />
* Kanamycin: 1 g Kanamycin was dissolved in 20 mL multipore-H2O, sterilized by filtration and filled into 2 mL tubes and stored at the -20°C.<br />
* Tetracyclin: 0.5 g Tetracyclin were dissolved in 20 mL ethanol (70%) and filled into 2 mL tubes. The tubes were wrapped with aluminium foil (light sensitive!) and stored at -20°C.<br />
2. ITPG solution (1 M):<br />
* ~ 4.766 g ITPG were dissolved in 20 mL multipore-H2O, sterilized by filtration, filled in 2 mL tubes and stored at -20°C.<br />
3. DYT (5 litres)<br />
* 80 g Bactotrypton, 50 g Bactoyeast, 25 g NaCl were weight out. <br />
* 2 L multipore-H2O were added <br />
* after mixing, multipore-H2O was added -> endvolume 5 litres <br />
* medium was filled into flask and was autoclaved<br />
4. Glycerol:<br />
* Glycerol was filled into a flask and was then autoclaved<br />
<br />
'''To do: register at Mr. Gene!!!'''<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">9. Labday 17.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>β-Globin</b></p>====<br />
<br />
<p><b>Investigators: Bea, Chris W., Patrick, Hanna (and instructors)</b></p><br><br />
<br><br />
We blasted the sequence of the β-globin and additional nucleotides „in the pre- and suffix“.<br />
We found only 70% coverage with the human β-globin-intron add. some parts of the exon 3.<br />
For this reason we think that the pAAV_MCS annotation of the β-Globin-intron of Stratagene is too generously.<br><br />
In addition the alignment of the human ß-globin showed that only parts of the intron 2 (5’) and exon 3 are integratet into the vector.<br />
We assume that the informations from Stratagene are not total correctly ( intron flanket by the splicedonors and the acceptor-sequence).<br />
We blasted the sequence between the CMV-promoter and the origin beginning of the ß-globin intron.<br />
We found a 98,8% coverage with a synthetic CMV-promoter construct ( 1 nucleotide difference).<br />
Literature: „Diverse plasmid DNA vectors by directed molecular evolution of cytomegalovirus promoters. (Wright A. et al.)“<br><br />
→The question arises if we can omit the ß-globin (because the exact function is unknown).<br />
For this we should contact various Companys (GeneArt, DNA2.0, Mr. Gene,…) to get more information.<br />
In addition we could test the expression with and without ß-globin.<br />
<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">10. Labortag 18.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>pCMV_mVenus_YFP</b></p>====<br />
<br />
<br />
<p><b>Investigator: Bea, Chris W., Patrick, Hanna, Anissa, Kerstin, Adrian (und Instructors)</b></p><br />
<br />
<br />
Theoretical cloning with Geneious of pCMV-MCS + pGA14_mVenus_YFP --> <b>pCMV_mVenus_YFP</b><br />
<ul><br />
<li>Enzyme set: RFC 25 (iGEM)<br />
<li> digest pGA14_mVenus_YFP (insert) with XbaI and PstI: mVenus_YFP_cut_XbaI+PstI <br />
<li> digest pCMV_MCS (vector) with XbaI and PstI: pCMV_MCS_cut_XbaI+PstI<br />
<li> ligate mVenus_YFP_cut_XbaI+PstI with pCMV_MCS_cut_XbaI+PstI <br />
<br><br />
[[Image:Freiburg10 pCMV MCS mVenus YFP.png|thumb|center|500px]]<br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">11. Labortag 19.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV-MCS + pGA14_mVenus_YFP pCMV_mVenus_YFP</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Bea, Chris W., Hanna, Patrick</b></p><br />
<br />
<b>Digestion</b><br />
<br><br />
<ul><br />
<li>plasmid: insert: pGA14_mVenus_YFP; number: P1 production date: ____ origin: ____ </li><br />
<li>plasmid: vector: pCMV_MCS; number: P2 production date: ____ origin: ____ </li><br />
<li>new vector name: pCMV_mVenus_YFP <br></li><br />
<li>buffer used:3 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme PstI(no.Lab:___)</li><br />
<li>DNA concentration (vector): 375 ng/µl ; DNA concentration (insert): 476 ng/µl</li><br />
<br />
{| border="1"<br />
| components || align="right" | V (pGA_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4||align="right"|2,7<br />
|-<br />
| BSA (10x) || align="right" |2||align="right"|2<br />
|-<br />
| Buffer 3 (10x)|| align="right" |2||align="right"|2<br />
|-<br />
|Enzyme: XbaI (no.Lab:___)|| align="right" |1,5||align="right"|1,5<br />
|-<br />
|Enzyme: PstI (no.Lab:___)|| align="right" |1||align="right"|1<br />
|-<br />
|H2O|| align="right" |9,5||align="right"|10,8<br />
|-<br />
|'''Total volume'''|| align="right" |<b>20</b>||align="right"|<b>20</b><br />
|}<br />
<br />
<li> Incubation: 1 h at 37°C</li><br />
</ul><br />
<br />
<b>1% Agarose gel and Gel extraction</b><br />
<ul><br />
<li>prepare 1% agarose gel, run gel for 45 minutes(119 V)</li><br />
<li>cut out insert and vector</li><br />
<li>perform gel extraction following standard protocol provided by Qiagen</li><br />
</ul><br />
<br />
<b>Ligation</b><br />
<br />
<ul><br />
<li>Measure DNA-concentration with Nanodrop </li><br />
<li>c(mVenus_YFP) = 16,8 ng/µL</li><br />
<li>c(pCMV_MCS) = 22,8 ng/µL</li><br />
<li>Calculation of volume needed for ligation: <br />
<li>c(mVenus_YFP) = 3,66 µL</li><br />
<li>c(pCMV_MCS) = 5,34 µL</li></li><br />
</ul><br />
<br />
<b>Transformation</b><br />
<ul><br />
<li>Transformation has been followed the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]] </li><br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">12. Labortag 20.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Picking clones</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Bea</b></p><br />
<ul><br/><br />
Clones were picked according to the standard protocol.<br />
*3 approaches from each plate</li><br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">13. Labortag 21.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>CMV-Promoter</b></p>====<br />
<br />
<p><b>Investigators: Volker, Hanna</b></p><br />
<br />
<br><br />
<b>Theoretical cloning:</b> <br />
* The CMV promoter (mainly the regulatory region) was further characterized: For this purpose U.S. patent no. 5,385,839 was used. [[Media:Freiburg10_Patent_US5385839A.pdf]]<br />
* Further on the CMV promoter sequence was blasted. The results delivered a 98% query coverage with the "Human herpesvirus 5 strain Toledo, complete genome" (accession no.: GU937742.1). Interestingly the maximal identity was just 99%. This can be explained due to a nucleotide deletion and a C-T transition (red circles), which were also marked in Geneious. <br />
[[Image:Freiburg10_CMV-Alignment.jpg|thumb|center|500px|]]<br />
<br><br />
[[Image:Freiburg10 CMV.jpg|thumb|center|800px|]]<br />
<br><br />
'''To do''': find "+1"-location (transcription start); which transcription factors bind to the regulatory region of the CMV promoter?<br />
<br><br />
<br><br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>LB medium''' was prepared</b></p>====<br />
Patrick and Chris W. <br/><br />
* 10 g Bacto-Tryptone, 5 g Bacto-Yeast, 10 g NaCl were mixed in 500 mL milipore-H2O. <br />
* Volume was adjusted to 1 L with milipore-H2O.<br />
* 100 mL flasks were each filled with 50 mL medium.<br />
* 0.75 g agar was added to each flask.<br />
* LB was sterilized by autoclaving and is now stored at room temperature.<br />
<br><br />
<br><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Plasmid Mini-Prep according to the standard protocol</b></p>====<br />
Adrian, Kira, Anna, Chris W., Patrick<br />
<br/><br />
Measure DNA-concentration with Nanodrop:<br/><br />
<br />
<br />
{| border="1"<br />
| || align="right" | P3 (pCMV_mVenus_YFP) ||align="right"| P4 (pCMV_mVenus_YFP) ||align="right"| P5 (pCMV_mVenus_YFP)<br />
|-<br />
| concentration (ng/µl)|| align="right" | 457||align="right"|470,8|| align="right" | 477,29<br />
|}<br />
<br/><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">14. Labortag 25.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV_mVenus_YFP + pAAV_MCS</b></p>====<br />
<br />
<p><b>Investigators: Kira, Anna, Volker, Jessica</b></p><br />
<br />
<br><br />
<br />
<li>plasmid: insert: pCMV_mVenus_YFP; number: P5 production date: 21.05.2010 origin: ____ <br />
<li>plasmid: vector: pAAV_MCS; number: P? production date: ____ origin: ____ <br />
<li>new vector name: pAAV_mVenus_YFP <br> <br />
<br />
<br><br />
'''1st try:<br />
<br />
<li>buffer used:3 ; Restriction-enzymes used: Enzyme NotI (no. Lab:46) <br />
<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl<br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4.2||align="right"|3.5<br />
|-<br />
| BSA (10x) || align="right" |3||align="right"|3<br />
|-<br />
| Buffer 3 (10x)|| align="right" |3||align="right"|3<br />
|-<br />
|Enzyme: NotI (no.Lab:46)|| align="right" |1||align="right"|1<br />
|-<br />
|H2O|| align="right" |15.3||align="right"|15.3<br />
|-<br />
|'''Total volume'''|| align="right" |<b>26.4</b>||align="right"|<b>25.8</b><br />
|}<br />
<br />
<li> Incubation: 1 1/2 h at 37°C<br />
<br><br />
'''note: too little water was added<br />
<br><br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was prepared, gel ran for 45 minutes(119 V)<br />
<br><br />
<br><br />
'''2nd try:'''<br />
<br />
<li>buffer used:4 ; Restriction-enzymes used: Enzyme NotI (no. Lab:159) <br />
<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl<br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4.2||align="right"|3.5<br />
|-<br />
| BSA (10x) || align="right" |3||align="right"|3<br />
|-<br />
| Buffer 4 (10x)|| align="right" |3||align="right"|3<br />
|-<br />
|Enzyme: NotI (no.Lab:159)|| align="right" |1,5||align="right"|1,5<br />
|-<br />
|H2O|| align="right" |18,3||align="right"|19<br />
|-<br />
|'''Total volume'''|| align="right" |<b>30</b>||align="right"|<b>30</b><br />
|}<br />
<br />
<li> Incubation: 1 1/2 h at 37°C<br />
<br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)<br />
<br><br />
<br />
<font color=#FF00FF>Results: unexpected sizes of fragments (see protocol), try again next day with an ethidium bromid gel</font><br />
<br><br />
<br><br />
<br><br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Production of chemical competent E.coli</b></p>====<br />
<br />
<p><b>Investigators: Patrick and Jessica</b></p><br />
<br><br />
competent E.coli XL-1-blue and competent E.coli BL21 produced according to the standard-protocoll [[Media:production of competent E.coli.pdf]]<br><br />
<br><br />
<br><br />
<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Design of MCS-Oligos</b></p>====<br />
<p><b>Investigators: Bea, Adrian, Hanna, Sven</b></p><br />
<br><br />
In order to replace the multiple cloning site of the pAAV_MCS vector from Stratagene by RFC25, two oligos were designed. After their hybridization the overhangs correspond to ClaI- and BglII restriction sites. A digestion with BglII and ClaI will be performed with pAAV-MCS and then will be ligated with the designed oligos.<br><br />
The oligos (see link) were ordered at Sigma-Aldrich. Estimated shipment: 31.05.2010 .<br><br />
<br />
<br />
[[File:Freiburg10 Oligos MCS RFC25 for pAAV.pdf]]<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">15. Labortag 26.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Repetition: Cloning of pAAV_MCS + pCMV_mVenus_YFP</b></p>====<br />
<br />
<p><b>Investigators: Bea, Hanna, Jessica</b></p><br />
<br />
<ul><br />
<li>Repeat cloning of pAAV-MCS + pCMV_mVenus_YFP --> <b>Goal: pAAV_mVenus_YFP</b><br><br />
<br />
Cloning did not work (see lab day 25.05.2010) either with NotI or with NotI-HF. Gel did not show any proper band at the expected size. <br><br />
There will be used EtBr instead of gelred in the agarose gel and the incubation time of digestion will be prolonged. Further details are followed. <br><br />
NOTE: There are three restriction sites of NotI in the pCMV-mVenus_YFP. If cloning with NotI, the polyA hGH signal will be deleted. therefore cloning with NotI is '''not''' possible .<br />
<br><br />
<br><br />
<li>Test digestion of pCMV-mVenusYFP with PstI and MluI <br><br />
</ul><br />
<b>Digestion</b><br />
<br><br />
<ul><br />
<li>experiment date: 26.05.2010 </li><br />
<li>plasmid: pCMV_mVenus_YFP; number: P5; production date: 21.05.2010/ pCMV-MSC; number: P2; production date: </li><br />
<li>buffer used: 3/4; Restriction-enzymes used: Enzyme PstI (no. Lab:48) and Enyzme MluI (no. Lab:40) / NotI HF (no. Lab:159) </li><br />
<li>DNA concentration plasmid: P5 477,3 ng/µl / P2 550ng/µl </li><br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4,2||align="right"|3,6<br />
|-<br />
| BSA (10x) || align="right" |2||align="right"|2<br />
|-<br />
| Buffer 3 (10x)|| align="right" |2||align="right"|2<br />
|-<br />
|Enzyme: PstI/NotI HF (no.Lab:48/159)|| align="right" |1||align="right"|2<br />
|-<br />
|Enzyme: MluI (no.Lab:40)|| align="right" |1||align="right"|-<br />
|-<br />
|H2O|| align="right" |9,8||align="right"|10,4<br />
|-<br />
|'''Total volume'''|| align="right" |<b>20</b>||align="right"|<b>20</b><br />
|}<br />
<br><br />
<li> Incubation: 1 h at 37°C<br />
<br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)<br />
<br><br />
Results: Test digestion of pCMV_MCS with NotI delivered plausibel results (expected fragment size: ~ 27 kbp and 17 kbp). <br />
Unfortunately the digestion of pCMV_mVenus_YFP with PstI and MluI resulted in one 2.9 kbp and one 1.2 kbp fragment, which didn't correspond to the expected fragment sizes of 19 kbp and 33 kbp - but to fragment sizes of pCMV_MCS without mVenus_YFP! <br />
<br><br />
<br><br />
<br><br />
</ul><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Ordering oligos</b></p>==== <br />
Bea<br><br />
Oligos have been ordered for modifying the ITRs. Deletion of PstI restriction site in ITR. <br><br />
<br />
<br><br />
'''right ITR of pAAV_MCS''' <br><br />
<br />
oligos ordered:<br><br />
<br />
fwd: 5´- gcgcagctgcctgcaCGGGCGCCTGATGCGG -3´ 77 °C, 31 bp <br><br />
rev: 5´- CCGCATCAGGCGCCCGTGCAGGCAGCTGCGC -3´ <br><br />
<br><br />
<br />
'''leftITR of pAAV_MCS'''<br><br />
<br />
oligos ordered:<br><br />
<br />
fwd: 5´- CCTTTTGCTCACATGTCGTGCAGGCAGCTGCGCG -3´ 74 °C, 34 bp <br><br />
rev: 5´- CGCGCAGCTGCCTGCACGACATGTGAGCAAAAGG -3´<br><br />
<br> <br />
For further details see link <br><br />
<br />
http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/4/44/Freiburg10_Oligos_ITR_mutagenesis_for_pAAV_delete_PstI.pdf<br />
</li><br />
<br><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Test-Trafo of chemical competent E.coli cells</b></p>====<br />
Hanna<br />
<br><br />
The competent E.coli XL-1-blue and competent E.coli BL21 which were prepared the day before were test-transformed with pUC18 - following the standard protocol. Cells were plated on agar plates containing ampicillin and stored over night at 37°C. <br />
Further on two control plates containing ampicillin or kanamycin were prepared. Non-transformed cells were plated on them and also stored over night at 37°C. <br />
<br><br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">16. Labortag 27.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cell counting</b></p>====<br />
<br />
<p><b>Investigator: Patrick, Adrian, Chris W. Christian L.</b></p><br />
<br />
* Meeting<br />
<br />
cell counting:<br />
<br><br />
* BL21 + PUC18 Trafo 54*4 = 216<br />
* XL1B + PUC18 Trafo 30*4 = 120<br />
digitalization of recipe-cards (Christian L.)<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">17. Labortag 31.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>pAAV_RC R585A and R588A transistions</b></p>====<br />
<br />
<br />
<br />
In order to alter the tropism of AAV2 several modifications have to be performed.<br />
First of all the binding to Heparan Sulfate Proteoglycan has to be disrupted. This can be done by R585A and R588A transistions:<br />
[[Image:Freiburg10 R585A R588A.jpg|thumb|center|700px|]]<br />
<br />
<br />
<center>[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June '''=> Go to Labjournal June (labday 18 - 45)''']</center><br><br />
<html><br />
</div><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/MayTeam:Freiburg Bioware/NoteBook/Labjournal/May2011-01-03T07:26:54Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/css}}<br />
{{:Team:Freiburg_Bioware/Head}}<br />
{{:Team:Freiburg_Bioware/menu_notebook}}<br />
{{:Team:Freiburg_Bioware/jquery}}<br />
<br />
<!-- Freiburg_bioware --><br />
[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook => Back to Notebook overview]<br><br><br />
<html><br />
<div><a href="#banner-wrap" id="to_top"></a></div><br />
<div class="box_right"><br />
<left><u1>NoteBook Navigator</u1></left><br />
<br><br />
<br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/March">March (labday 1)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/April">April (labday 2 - 5)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/May">May (labday 6 - 17)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June">June (labday 18 - 45)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/July">July (labday 46 - 75)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August">August part 1 (labday 76 - 92)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August2">August part 2 (labday 93 - 106)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September">September part 1 (labday 107 - 123)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September2">September part 2 (labday 124 - 135)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October">October part 1 (labday 136 - 149 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October2">October part 2 (labday 150 - 166 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/November">November (labday 167 - 170 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/Cellculture">Cellculture</a></li><br />
</ul><br />
</div><br />
</html><br />
===<p style="font-size:17px; background-color:#00dd77;">6. Labday 03.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Theoretical cloning</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Hanna, Bea, Patrick, Chris W. </b></p><br /><br />
Several theoretical cloning issues need to be adressed: The modularization and modification of the Stratagene plasmids and the prodrug activating enzymes. :<br><br />
<br /><br />
1. Cap-Gen: <br />
* delete the PstI-restriction site<br />
* insert an antibody fragment (targeting): sequence? in which part of VP1? (Patrick)<br />
* add prefix & suffix <br />
* disable binding of Heparan Sulphat Proteoglycan <br />
<br><br />
2. Rep-Gen:<br />
* delete EcoRI (2x) and PstI (2x) <br />
<br><br />
3. ITRs:<br />
* NotI and PstI (in sequence?) flank the ITRs: The question whether they can/have to be deleted arose.<br />
* where exactly does the sequence start and end? (Patrick)<br />
* we should check if three ITRs could be used to increase expression levels<br />
* we blasted the ITR (left) of the MCS vektor (Stratagene). we got a 92% "Coverage" with the AAV2 genom (to 100%). from the alignment (Stratagene ITR with ITR of the AAV2 genom) we got:<br><br />
[[Image:Freiburg10 ITR(left)-Stratagene vs. ITR AAV2.jpg|thumb|center|500px|]]<br />
<br />
<br />
<br />
You can see, that the ITR sequence begins 4 bp after the PstI restriction site. thereupon we did a secundary structure analyse (www.dinamelt.bioinfo.rpi.edu), with the following structure we got: <br><br />
[[Media:Freiburg10_AAV2ITR(left)nachBlast.pdf]] <br><br />
conclusion: the big loop of the secondary structure dosent change if we delete the PstI restriction site (cf. with other uploadet secondary structures), it should be considered that we can't add random bp that could affect the secundary structure. <br><br />
<b>To do: which bp, which sequence could/can be insertet? cf. the genome of AAV2</b> <br><br />
<br><br />
4. MCS:<br />
* replacement through the iGEM-MCS<br />
* where is the beginning and ending of the MCS in the Vector? ß-globin function and sequence (search for literature and patents, which are denoted in the AAV-Helper-Free-System Manual)<br />
* in this context it would be also important to find out where the beta-Globulin-Intron exactly starts or rather we can cut out the MCS.<br />
<br><br />
5. enzymes:<br />
* Thymidinkinase: find informations. TK30 (Bea), SR39 (Hanna)<br />
* Cytosindeaminase: find informations (Adrian)<br />
<br><br />
in addition we downloaded, added and anotated the sequence of the pHelper plasmid of Stratagene in Geneious (see "Constructs"). <br />
<br />
<br />
insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">7. Labday 07.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Protocolls</b></p>====<br />
<br />
<p><b>Investigators: Anissa, Kerstin </b></p><br><br />
<br />
* adaption and extension of the standart prorcolls (Cloning for Pro's)<br />
* we startet to create a protokoll-mask for the praktical-cloning (short version for labwork)<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">8. Labday 10.05.2010</p> ===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Stock solutions</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Chris W., Chris L., Bea, Achim, Patrick, Hanna, (Sven)</b></p><br><br />
The following stock solutions were prepared: <br><br />
1. Antibiotics:<br />
* Ampicillin: 2 g Ampicillin were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at -20°C.<br />
* Chloramphenicol: 0.5 g Chloramphenicol were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at the -20°C.<br />
* Kanamycin: 1 g Kanamycin was dissolved in 20 mL multipore-H2O, sterilized by filtration and filled into 2 mL tubes and stored at the -20°C.<br />
* Tetracyclin: 0.5 g Tetracyclin were dissolved in 20 mL ethanol (70%) and filled into 2 mL tubes. The tubes were wrapped with aluminium foil (light sensitive!) and stored at -20°C.<br />
2. ITPG solution (1 M):<br />
* ~ 4.766 g ITPG were dissolved in 20 mL multipore-H2O, sterilized by filtration, filled in 2 mL tubes and stored at -20°C.<br />
3. DYT (5 litres)<br />
* 80 g Bactotrypton, 50 g Bactoyeast, 25 g NaCl were weight out. <br />
* 2 L multipore-H2O were added <br />
* after mixing, multipore-H2O was added -> endvolume 5 litres <br />
* medium was filled into flask and was autoclaved<br />
4. Glycerol:<br />
* Glycerol was filled into a flask and was then autoclaved<br />
<br />
'''To do: register at Mr. Gene!!!'''<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">9. Labday 17.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>β-Globin</b></p>====<br />
<br />
<p><b>Investigators: Bea, Chris W., Patrick, Hanna (and instructors)</b></p><br><br />
<br><br />
We blasted the sequence of the β-globin and additional nucleotides „in the pre- and suffix“.<br />
We found only 70% coverage with the human β-globin-intron add. some parts of the exon 3.<br />
For this reason we think that the pAAV_MCS annotation of the β-Globin-intron of Stratagene is too generously.<br><br />
In addition the alignment of the human ß-globin showed that only parts of the intron 2 (5’) and exon 3 are integratet into the vector.<br />
We assume that the informations from Stratagene are not total correctly ( intron flanket by the splicedonors and the acceptor-sequence).<br />
We blasted the sequence between the CMV-promoter and the origin beginning of the ß-globin intron.<br />
We found a 98,8% coverage with a synthetic CMV-promoter construct ( 1 nucleotide difference).<br />
Literature: „Diverse plasmid DNA vectors by directed molecular evolution of cytomegalovirus promoters. (Wright A. et al.)“<br><br />
→The question arises if we can omit the ß-globin (because the exact function is unknown).<br />
For this we should contact various Companys (GeneArt, DNA2.0, Mr. Gene,…) to get more information.<br />
In addition we could test the expression with and without ß-globin.<br />
<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">10. Labortag 18.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>pCMV_mVenus_YFP</b></p>====<br />
<br />
<br />
<p><b>Investigator: Bea, Chris W., Patrick, Hanna, Anissa, Kerstin, Adrian (und Instructors)</b></p><br />
<br />
<br />
Theoretical cloning with Geneious of pCMV-MCS + pGA14_mVenus_YFP --> <b>pCMV_mVenus_YFP</b><br />
<ul><br />
<li>Enzyme set: RFC 25 (iGEM)<br />
<li> digest pGA14_mVenus_YFP (insert) with XbaI and PstI: mVenus_YFP_cut_XbaI+PstI <br />
<li> digest pCMV_MCS (vector) with XbaI and PstI: pCMV_MCS_cut_XbaI+PstI<br />
<li> ligate mVenus_YFP_cut_XbaI+PstI with pCMV_MCS_cut_XbaI+PstI <br />
<br><br />
[[Image:Freiburg10 pCMV MCS mVenus YFP.png|thumb|center|500px]]<br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">11. Labortag 19.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV-MCS + pGA14_mVenus_YFP pCMV_mVenus_YFP</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Bea, Chris W., Hanna, Patrick</b></p><br />
<br />
<b>Digestion</b><br />
<br><br />
<ul><br />
<li>plasmid: insert: pGA14_mVenus_YFP; number: P1 production date: ____ origin: ____ </li><br />
<li>plasmid: vector: pCMV_MCS; number: P2 production date: ____ origin: ____ </li><br />
<li>new vector name: pCMV_mVenus_YFP <br></li><br />
<li>buffer used:3 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme PstI(no.Lab:___)</li><br />
<li>DNA concentration (vector): 375 ng/µl ; DNA concentration (insert): 476 ng/µl</li><br />
<br />
{| border="1"<br />
| components || align="right" | V (pGA_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4||align="right"|2,7<br />
|-<br />
| BSA (10x) || align="right" |2||align="right"|2<br />
|-<br />
| Buffer 3 (10x)|| align="right" |2||align="right"|2<br />
|-<br />
|Enzyme: XbaI (no.Lab:___)|| align="right" |1,5||align="right"|1,5<br />
|-<br />
|Enzyme: PstI (no.Lab:___)|| align="right" |1||align="right"|1<br />
|-<br />
|H2O|| align="right" |9,5||align="right"|10,8<br />
|-<br />
|'''Total volume'''|| align="right" |<b>20</b>||align="right"|<b>20</b><br />
|}<br />
<br />
<li> Incubation: 1 h at 37°C</li><br />
</ul><br />
<br />
<b>1% Agarose gel and Gel extraction</b><br />
<ul><br />
<li>prepare 1% agarose gel, run gel for 45 minutes(119 V)</li><br />
<li>cut out insert and vector</li><br />
<li>perform gel extraction following standard protocol provided by Qiagen</li><br />
</ul><br />
<br />
<b>Ligation</b><br />
<br />
<ul><br />
<li>Measure DNA-concentration with Nanodrop </li><br />
<li>c(mVenus_YFP) = 16,8 ng/µL</li><br />
<li>c(pCMV_MCS) = 22,8 ng/µL</li><br />
<li>Calculation of volume needed for ligation: <br />
<li>c(mVenus_YFP) = 3,66 µL</li><br />
<li>c(pCMV_MCS) = 5,34 µL</li></li><br />
</ul><br />
<br />
<b>Transformation</b><br />
<ul><br />
<li>Transformation has been followed the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]] </li><br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">12. Labortag 20.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Picking clones</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Bea</b></p><br />
<ul><br/><br />
Clones were picked according to the standard protocol.<br />
*3 approaches from each plate</li><br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">13. Labortag 21.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>CMV-Promoter</b></p>====<br />
<br />
<p><b>Investigators: Volker, Hanna</b></p><br />
<br />
<br><br />
<b>Theoretical cloning:</b> <br />
* The CMV promoter (mainly the regulatory region) was further characterized: For this purpose U.S. patent no. 5,385,839 was used. [[Media:Freiburg10_Patent_US5385839A.pdf]]<br />
* Further on the CMV promoter sequence was blasted. The results delivered a 98% query coverage with the "Human herpesvirus 5 strain Toledo, complete genome" (accession no.: GU937742.1). Interestingly the maximal identity was just 99%. This can be explained due to a nucleotide deletion and a C-T transition (red circles), which were also marked in Geneious. <br />
[[Image:Freiburg10_CMV-Alignment.jpg|thumb|center|500px|]]<br />
<br><br />
[[Image:Freiburg10 CMV.jpg|thumb|center|800px|]]<br />
<br><br />
'''To do''': find "+1"-location (transcription start); which transcription factors bind to the regulatory region of the CMV promoter?<br />
<br><br />
<br><br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>LB medium''' was prepared</b></p>====<br />
Patrick and Chris W. <br/><br />
* 10 g Bacto-Tryptone, 5 g Bacto-Yeast, 10 g NaCl were mixed in 500 mL milipore-H2O. <br />
* Volume was adjusted to 1 L with milipore-H2O.<br />
* 100 mL flasks were each filled with 50 mL medium.<br />
* 0.75 g agar was added to each flask.<br />
* LB was sterilized by autoclaving and is now stored at room temperature.<br />
<br><br />
<br><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Plasmid Mini-Prep according to the standard protocol</b></p>====<br />
Adrian, Kira, Anna, Chris W., Patrick<br />
<br/><br />
Measure DNA-concentration with Nanodrop:<br/><br />
<br />
<br />
{| border="1"<br />
| || align="right" | P3 (pCMV_mVenus_YFP) ||align="right"| P4 (pCMV_mVenus_YFP) ||align="right"| P5 (pCMV_mVenus_YFP)<br />
|-<br />
| concentration (ng/µl)|| align="right" | 457||align="right"|470,8|| align="right" | 477,29<br />
|}<br />
<br/><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">14. Labortag 25.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV_mVenus_YFP + pAAV_MCS</b></p>====<br />
<br />
<p><b>Investigators: Kira, Anna, Volker, Jessica</b></p><br />
<br />
<br><br />
<br />
<li>plasmid: insert: pCMV_mVenus_YFP; number: P5 production date: 21.05.2010 origin: ____ <br />
<li>plasmid: vector: pAAV_MCS; number: P? production date: ____ origin: ____ <br />
<li>new vector name: pAAV_mVenus_YFP <br> <br />
<br />
<br><br />
'''1st try:<br />
<br />
<li>buffer used:3 ; Restriction-enzymes used: Enzyme NotI (no. Lab:46) <br />
<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl<br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4.2||align="right"|3.5<br />
|-<br />
| BSA (10x) || align="right" |3||align="right"|3<br />
|-<br />
| Buffer 3 (10x)|| align="right" |3||align="right"|3<br />
|-<br />
|Enzyme: NotI (no.Lab:46)|| align="right" |1||align="right"|1<br />
|-<br />
|H2O|| align="right" |15.3||align="right"|15.3<br />
|-<br />
|'''Total volume'''|| align="right" |<b>26.4</b>||align="right"|<b>25.8</b><br />
|}<br />
<br />
<li> Incubation: 1 1/2 h at 37°C<br />
<br><br />
'''note: too little water was added<br />
<br><br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was prepared, gel ran for 45 minutes(119 V)<br />
<br><br />
<br><br />
'''2nd try:'''<br />
<br />
<li>buffer used:4 ; Restriction-enzymes used: Enzyme NotI (no. Lab:159) <br />
<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl<br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4.2||align="right"|3.5<br />
|-<br />
| BSA (10x) || align="right" |3||align="right"|3<br />
|-<br />
| Buffer 4 (10x)|| align="right" |3||align="right"|3<br />
|-<br />
|Enzyme: NotI (no.Lab:159)|| align="right" |1,5||align="right"|1,5<br />
|-<br />
|H2O|| align="right" |18,3||align="right"|19<br />
|-<br />
|'''Total volume'''|| align="right" |<b>30</b>||align="right"|<b>30</b><br />
|}<br />
<br />
<li> Incubation: 1 1/2 h at 37°C<br />
<br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)<br />
<br><br />
<br />
<font color=#FF00FF>Results: unexpected sizes of fragments (see protocol), try again next day with an ethidium bromid gel</font><br />
<br><br />
<br><br />
<br><br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Production of chemical competent E.coli</b></p>====<br />
<br />
<p><b>Investigators: Patrick and Jessica</b></p><br />
<br><br />
competent E.coli XL-1-blue and competent E.coli BL21 produced according to the standard-protocoll [[Media:production of competent E.coli.pdf]]<br><br />
<br><br />
<br><br />
<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Design of MCS-Oligos</b></p>====<br />
<p><b>Investigators: Bea, Adrian, Hanna, Sven</b></p><br />
<br><br />
In order to replace the multiple cloning site of the pAAV_MCS vector from Stratagene by RFC25, two oligos were designed. After their hybridization the overhangs correspond to ClaI- and BglII restriction sites. A digestion with BglII and ClaI will be performed with pAAV-MCS and then will be ligated with the designed oligos.<br><br />
The oligos (see link) were ordered at Sigma-Aldrich. Estimated shipment: 31.05.2010 .<br><br />
<br />
<br />
[[File:Freiburg10 Oligos MCS RFC25 for pAAV.pdf]]<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">15. Labortag 26.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Repetition: Cloning of pAAV_MCS + pCMV_mVenus_YFP</b></p>====<br />
<br />
<p><b>Investigators: Bea, Hanna, Jessica</b></p><br />
<br />
<ul><br />
<li>Repeat cloning of pAAV-MCS + pCMV_mVenus_YFP --> <b>Goal: pAAV_mVenus_YFP</b><br><br />
<br />
Cloning did not work (see lab day 25.05.2010) either with NotI or with NotI-HF. Gel did not show any proper band at the expected size. <br><br />
There will be used EtBr instead of gelred in the agarose gel and the incubation time of digestion will be prolonged. Further details are followed. <br><br />
NOTE: There are three restriction sites of NotI in the pCMV-mVenus_YFP. If cloning with NotI, the polyA hGH signal will be deleted. therefore cloning with NotI is '''not''' possible .<br />
<br><br />
<br><br />
<li>Test digestion of pCMV-mVenusYFP with PstI and MluI <br><br />
</ul><br />
<b>Digestion</b><br />
<br><br />
<ul><br />
<li>experiment date: 26.05.2010 </li><br />
<li>plasmid: pCMV_mVenus_YFP; number: P5; production date: 21.05.2010/ pCMV-MSC; number: P2; production date: </li><br />
<li>buffer used: 3/4; Restriction-enzymes used: Enzyme PstI (no. Lab:48) and Enyzme MluI (no. Lab:40) / NotI HF (no. Lab:159) </li><br />
<li>DNA concentration plasmid: P5 477,3 ng/µl / P2 550ng/µl </li><br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4,2||align="right"|3,6<br />
|-<br />
| BSA (10x) || align="right" |2||align="right"|2<br />
|-<br />
| Buffer 3 (10x)|| align="right" |2||align="right"|2<br />
|-<br />
|Enzyme: PstI/NotI HF (no.Lab:48/159)|| align="right" |1||align="right"|2<br />
|-<br />
|Enzyme: MluI (no.Lab:40)|| align="right" |1||align="right"|-<br />
|-<br />
|H2O|| align="right" |9,8||align="right"|10,4<br />
|-<br />
|'''Total volume'''|| align="right" |<b>20</b>||align="right"|<b>20</b><br />
|}<br />
<br><br />
<li> Incubation: 1 h at 37°C<br />
<br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)<br />
<br><br />
Results: Test digestion of pCMV_MCS with NotI delivered plausibel results (expected fragment size: ~ 27 kbp and 17 kbp). <br />
Unfortunately the digestion of pCMV_mVenus_YFP with PstI and MluI resulted in one 2.9 kbp and one 1.2 kbp fragment, which didn't correspond to the expected fragment sizes of 19 kbp and 33 kbp - but to fragment sizes of pCMV_MCS without mVenus_YFP! <br />
<br><br />
<br><br />
<br><br />
</ul><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Ordering oligos</b></p>==== <br />
Bea<br><br />
Oligos have been ordered for modifying the ITRs. Deletion of PstI restriction site in ITR. <br><br />
<br />
<br><br />
'''right ITR of pAAV_MCS''' <br><br />
<br />
oligos ordered:<br><br />
<br />
fwd: 5´- gcgcagctgcctgcaCGGGCGCCTGATGCGG -3´ 77 °C, 31 bp <br><br />
rev: 5´- CCGCATCAGGCGCCCGTGCAGGCAGCTGCGC -3´ <br><br />
<br><br />
<br />
'''leftITR of pAAV_MCS'''<br><br />
<br />
oligos ordered:<br><br />
<br />
fwd: 5´- CCTTTTGCTCACATGTCGTGCAGGCAGCTGCGCG -3´ 74 °C, 34 bp <br><br />
rev: 5´- CGCGCAGCTGCCTGCACGACATGTGAGCAAAAGG -3´<br><br />
<br> <br />
For further details see link <br><br />
<br />
http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/4/44/Freiburg10_Oligos_ITR_mutagenesis_for_pAAV_delete_PstI.pdf<br />
</li><br />
<br><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Test-Trafo of chemical competent E.coli cells</b></p>====<br />
Hanna<br />
<br><br />
The competent E.coli XL-1-blue and competent E.coli BL21 which were prepared the day before were test-transformed with pUC18 - following the standard protocol. Cells were plated on agar plates containing ampicillin and stored over night at 37°C. <br />
Further on two control plates containing ampicillin or kanamycin were prepared. Non-transformed cells were plated on them and also stored over night at 37°C. <br />
<br><br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">16. Labortag 27.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cell counting</b></p>====<br />
<br />
<p><b>Investigator: Patrick, Adrian, Chris W. Christian L.</b></p><br />
<br />
* Meeting<br />
<br />
cell counting:<br />
<br><br />
* BL21 + PUC18 Trafo 54*4 = 216<br />
* XL1B + PUC18 Trafo 30*4 = 120<br />
digitalization of recipe-cards (Christian L.)<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">17. Labortag 31.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>pAAV_RC R585A and R588A transistions</b></p>====<br />
<br />
<br />
<br />
In order to alter the tropism of AAV2 several modifications have to be performed.<br />
First of all the binding to Heparan Sulfate Proteoglycan has to be disrupted. This can be done by R585A and R588A transistions:<br />
[[Image:Freiburg10 R585A R588A.jpg|thumb|center|700px|]]<br />
<br />
<br />
<center>[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June '''=> Go to Labjournal June (labday 18 - 45)''']</center><br><br />
<html><br />
</div><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/MayTeam:Freiburg Bioware/NoteBook/Labjournal/May2011-01-03T07:22:16Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/css}}<br />
{{:Team:Freiburg_Bioware/Head}}<br />
{{:Team:Freiburg_Bioware/menu_notebook}}<br />
{{:Team:Freiburg_Bioware/jquery}}<br />
<br />
<!-- Freiburg_bioware --><br />
[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook => Back to Notebook overview]<br><br><br />
<html><br />
<div><a href="#oben" id="to_top"></a></div><br />
<div class="box_right"><br />
<left id="oben"><u1>NoteBook Navigator</u1></left><br />
<br><br />
<br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/March">March (labday 1)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/April">April (labday 2 - 5)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/May">May (labday 6 - 17)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June">June (labday 18 - 45)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/July">July (labday 46 - 75)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August">August part 1 (labday 76 - 92)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August2">August part 2 (labday 93 - 106)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September">September part 1 (labday 107 - 123)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September2">September part 2 (labday 124 - 135)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October">October part 1 (labday 136 - 149 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October2">October part 2 (labday 150 - 166 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/November">November (labday 167 - 170 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/Cellculture">Cellculture</a></li><br />
</ul><br />
</div><br />
</html><br />
===<p style="font-size:17px; background-color:#00dd77;">6. Labday 03.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Theoretical cloning</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Hanna, Bea, Patrick, Chris W. </b></p><br /><br />
Several theoretical cloning issues need to be adressed: The modularization and modification of the Stratagene plasmids and the prodrug activating enzymes. :<br><br />
<br /><br />
1. Cap-Gen: <br />
* delete the PstI-restriction site<br />
* insert an antibody fragment (targeting): sequence? in which part of VP1? (Patrick)<br />
* add prefix & suffix <br />
* disable binding of Heparan Sulphat Proteoglycan <br />
<br><br />
2. Rep-Gen:<br />
* delete EcoRI (2x) and PstI (2x) <br />
<br><br />
3. ITRs:<br />
* NotI and PstI (in sequence?) flank the ITRs: The question whether they can/have to be deleted arose.<br />
* where exactly does the sequence start and end? (Patrick)<br />
* we should check if three ITRs could be used to increase expression levels<br />
* we blasted the ITR (left) of the MCS vektor (Stratagene). we got a 92% "Coverage" with the AAV2 genom (to 100%). from the alignment (Stratagene ITR with ITR of the AAV2 genom) we got:<br><br />
[[Image:Freiburg10 ITR(left)-Stratagene vs. ITR AAV2.jpg|thumb|center|500px|]]<br />
<br />
<br />
<br />
You can see, that the ITR sequence begins 4 bp after the PstI restriction site. thereupon we did a secundary structure analyse (www.dinamelt.bioinfo.rpi.edu), with the following structure we got: <br><br />
[[Media:Freiburg10_AAV2ITR(left)nachBlast.pdf]] <br><br />
conclusion: the big loop of the secondary structure dosent change if we delete the PstI restriction site (cf. with other uploadet secondary structures), it should be considered that we can't add random bp that could affect the secundary structure. <br><br />
<b>To do: which bp, which sequence could/can be insertet? cf. the genome of AAV2</b> <br><br />
<br><br />
4. MCS:<br />
* replacement through the iGEM-MCS<br />
* where is the beginning and ending of the MCS in the Vector? ß-globin function and sequence (search for literature and patents, which are denoted in the AAV-Helper-Free-System Manual)<br />
* in this context it would be also important to find out where the beta-Globulin-Intron exactly starts or rather we can cut out the MCS.<br />
<br><br />
5. enzymes:<br />
* Thymidinkinase: find informations. TK30 (Bea), SR39 (Hanna)<br />
* Cytosindeaminase: find informations (Adrian)<br />
<br><br />
in addition we downloaded, added and anotated the sequence of the pHelper plasmid of Stratagene in Geneious (see "Constructs"). <br />
<br />
<br />
insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">7. Labday 07.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Protocolls</b></p>====<br />
<br />
<p><b>Investigators: Anissa, Kerstin </b></p><br><br />
<br />
* adaption and extension of the standart prorcolls (Cloning for Pro's)<br />
* we startet to create a protokoll-mask for the praktical-cloning (short version for labwork)<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">8. Labday 10.05.2010</p> ===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Stock solutions</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Chris W., Chris L., Bea, Achim, Patrick, Hanna, (Sven)</b></p><br><br />
The following stock solutions were prepared: <br><br />
1. Antibiotics:<br />
* Ampicillin: 2 g Ampicillin were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at -20°C.<br />
* Chloramphenicol: 0.5 g Chloramphenicol were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at the -20°C.<br />
* Kanamycin: 1 g Kanamycin was dissolved in 20 mL multipore-H2O, sterilized by filtration and filled into 2 mL tubes and stored at the -20°C.<br />
* Tetracyclin: 0.5 g Tetracyclin were dissolved in 20 mL ethanol (70%) and filled into 2 mL tubes. The tubes were wrapped with aluminium foil (light sensitive!) and stored at -20°C.<br />
2. ITPG solution (1 M):<br />
* ~ 4.766 g ITPG were dissolved in 20 mL multipore-H2O, sterilized by filtration, filled in 2 mL tubes and stored at -20°C.<br />
3. DYT (5 litres)<br />
* 80 g Bactotrypton, 50 g Bactoyeast, 25 g NaCl were weight out. <br />
* 2 L multipore-H2O were added <br />
* after mixing, multipore-H2O was added -> endvolume 5 litres <br />
* medium was filled into flask and was autoclaved<br />
4. Glycerol:<br />
* Glycerol was filled into a flask and was then autoclaved<br />
<br />
'''To do: register at Mr. Gene!!!'''<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">9. Labday 17.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>β-Globin</b></p>====<br />
<br />
<p><b>Investigators: Bea, Chris W., Patrick, Hanna (and instructors)</b></p><br><br />
<br><br />
We blasted the sequence of the β-globin and additional nucleotides „in the pre- and suffix“.<br />
We found only 70% coverage with the human β-globin-intron add. some parts of the exon 3.<br />
For this reason we think that the pAAV_MCS annotation of the β-Globin-intron of Stratagene is too generously.<br><br />
In addition the alignment of the human ß-globin showed that only parts of the intron 2 (5’) and exon 3 are integratet into the vector.<br />
We assume that the informations from Stratagene are not total correctly ( intron flanket by the splicedonors and the acceptor-sequence).<br />
We blasted the sequence between the CMV-promoter and the origin beginning of the ß-globin intron.<br />
We found a 98,8% coverage with a synthetic CMV-promoter construct ( 1 nucleotide difference).<br />
Literature: „Diverse plasmid DNA vectors by directed molecular evolution of cytomegalovirus promoters. (Wright A. et al.)“<br><br />
→The question arises if we can omit the ß-globin (because the exact function is unknown).<br />
For this we should contact various Companys (GeneArt, DNA2.0, Mr. Gene,…) to get more information.<br />
In addition we could test the expression with and without ß-globin.<br />
<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">10. Labortag 18.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>pCMV_mVenus_YFP</b></p>====<br />
<br />
<br />
<p><b>Investigator: Bea, Chris W., Patrick, Hanna, Anissa, Kerstin, Adrian (und Instructors)</b></p><br />
<br />
<br />
Theoretical cloning with Geneious of pCMV-MCS + pGA14_mVenus_YFP --> <b>pCMV_mVenus_YFP</b><br />
<ul><br />
<li>Enzyme set: RFC 25 (iGEM)<br />
<li> digest pGA14_mVenus_YFP (insert) with XbaI and PstI: mVenus_YFP_cut_XbaI+PstI <br />
<li> digest pCMV_MCS (vector) with XbaI and PstI: pCMV_MCS_cut_XbaI+PstI<br />
<li> ligate mVenus_YFP_cut_XbaI+PstI with pCMV_MCS_cut_XbaI+PstI <br />
<br><br />
[[Image:Freiburg10 pCMV MCS mVenus YFP.png|thumb|center|500px]]<br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">11. Labortag 19.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV-MCS + pGA14_mVenus_YFP pCMV_mVenus_YFP</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Bea, Chris W., Hanna, Patrick</b></p><br />
<br />
<b>Digestion</b><br />
<br><br />
<ul><br />
<li>plasmid: insert: pGA14_mVenus_YFP; number: P1 production date: ____ origin: ____ </li><br />
<li>plasmid: vector: pCMV_MCS; number: P2 production date: ____ origin: ____ </li><br />
<li>new vector name: pCMV_mVenus_YFP <br></li><br />
<li>buffer used:3 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme PstI(no.Lab:___)</li><br />
<li>DNA concentration (vector): 375 ng/µl ; DNA concentration (insert): 476 ng/µl</li><br />
<br />
{| border="1"<br />
| components || align="right" | V (pGA_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4||align="right"|2,7<br />
|-<br />
| BSA (10x) || align="right" |2||align="right"|2<br />
|-<br />
| Buffer 3 (10x)|| align="right" |2||align="right"|2<br />
|-<br />
|Enzyme: XbaI (no.Lab:___)|| align="right" |1,5||align="right"|1,5<br />
|-<br />
|Enzyme: PstI (no.Lab:___)|| align="right" |1||align="right"|1<br />
|-<br />
|H2O|| align="right" |9,5||align="right"|10,8<br />
|-<br />
|'''Total volume'''|| align="right" |<b>20</b>||align="right"|<b>20</b><br />
|}<br />
<br />
<li> Incubation: 1 h at 37°C</li><br />
</ul><br />
<br />
<b>1% Agarose gel and Gel extraction</b><br />
<ul><br />
<li>prepare 1% agarose gel, run gel for 45 minutes(119 V)</li><br />
<li>cut out insert and vector</li><br />
<li>perform gel extraction following standard protocol provided by Qiagen</li><br />
</ul><br />
<br />
<b>Ligation</b><br />
<br />
<ul><br />
<li>Measure DNA-concentration with Nanodrop </li><br />
<li>c(mVenus_YFP) = 16,8 ng/µL</li><br />
<li>c(pCMV_MCS) = 22,8 ng/µL</li><br />
<li>Calculation of volume needed for ligation: <br />
<li>c(mVenus_YFP) = 3,66 µL</li><br />
<li>c(pCMV_MCS) = 5,34 µL</li></li><br />
</ul><br />
<br />
<b>Transformation</b><br />
<ul><br />
<li>Transformation has been followed the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]] </li><br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">12. Labortag 20.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Picking clones</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Bea</b></p><br />
<ul><br/><br />
Clones were picked according to the standard protocol.<br />
*3 approaches from each plate</li><br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">13. Labortag 21.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>CMV-Promoter</b></p>====<br />
<br />
<p><b>Investigators: Volker, Hanna</b></p><br />
<br />
<br><br />
<b>Theoretical cloning:</b> <br />
* The CMV promoter (mainly the regulatory region) was further characterized: For this purpose U.S. patent no. 5,385,839 was used. [[Media:Freiburg10_Patent_US5385839A.pdf]]<br />
* Further on the CMV promoter sequence was blasted. The results delivered a 98% query coverage with the "Human herpesvirus 5 strain Toledo, complete genome" (accession no.: GU937742.1). Interestingly the maximal identity was just 99%. This can be explained due to a nucleotide deletion and a C-T transition (red circles), which were also marked in Geneious. <br />
[[Image:Freiburg10_CMV-Alignment.jpg|thumb|center|500px|]]<br />
<br><br />
[[Image:Freiburg10 CMV.jpg|thumb|center|800px|]]<br />
<br><br />
'''To do''': find "+1"-location (transcription start); which transcription factors bind to the regulatory region of the CMV promoter?<br />
<br><br />
<br><br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>LB medium''' was prepared</b></p>====<br />
Patrick and Chris W. <br/><br />
* 10 g Bacto-Tryptone, 5 g Bacto-Yeast, 10 g NaCl were mixed in 500 mL milipore-H2O. <br />
* Volume was adjusted to 1 L with milipore-H2O.<br />
* 100 mL flasks were each filled with 50 mL medium.<br />
* 0.75 g agar was added to each flask.<br />
* LB was sterilized by autoclaving and is now stored at room temperature.<br />
<br><br />
<br><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Plasmid Mini-Prep according to the standard protocol</b></p>====<br />
Adrian, Kira, Anna, Chris W., Patrick<br />
<br/><br />
Measure DNA-concentration with Nanodrop:<br/><br />
<br />
<br />
{| border="1"<br />
| || align="right" | P3 (pCMV_mVenus_YFP) ||align="right"| P4 (pCMV_mVenus_YFP) ||align="right"| P5 (pCMV_mVenus_YFP)<br />
|-<br />
| concentration (ng/µl)|| align="right" | 457||align="right"|470,8|| align="right" | 477,29<br />
|}<br />
<br/><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">14. Labortag 25.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV_mVenus_YFP + pAAV_MCS</b></p>====<br />
<br />
<p><b>Investigators: Kira, Anna, Volker, Jessica</b></p><br />
<br />
<br><br />
<br />
<li>plasmid: insert: pCMV_mVenus_YFP; number: P5 production date: 21.05.2010 origin: ____ <br />
<li>plasmid: vector: pAAV_MCS; number: P? production date: ____ origin: ____ <br />
<li>new vector name: pAAV_mVenus_YFP <br> <br />
<br />
<br><br />
'''1st try:<br />
<br />
<li>buffer used:3 ; Restriction-enzymes used: Enzyme NotI (no. Lab:46) <br />
<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl<br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4.2||align="right"|3.5<br />
|-<br />
| BSA (10x) || align="right" |3||align="right"|3<br />
|-<br />
| Buffer 3 (10x)|| align="right" |3||align="right"|3<br />
|-<br />
|Enzyme: NotI (no.Lab:46)|| align="right" |1||align="right"|1<br />
|-<br />
|H2O|| align="right" |15.3||align="right"|15.3<br />
|-<br />
|'''Total volume'''|| align="right" |<b>26.4</b>||align="right"|<b>25.8</b><br />
|}<br />
<br />
<li> Incubation: 1 1/2 h at 37°C<br />
<br><br />
'''note: too little water was added<br />
<br><br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was prepared, gel ran for 45 minutes(119 V)<br />
<br><br />
<br><br />
'''2nd try:'''<br />
<br />
<li>buffer used:4 ; Restriction-enzymes used: Enzyme NotI (no. Lab:159) <br />
<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl<br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4.2||align="right"|3.5<br />
|-<br />
| BSA (10x) || align="right" |3||align="right"|3<br />
|-<br />
| Buffer 4 (10x)|| align="right" |3||align="right"|3<br />
|-<br />
|Enzyme: NotI (no.Lab:159)|| align="right" |1,5||align="right"|1,5<br />
|-<br />
|H2O|| align="right" |18,3||align="right"|19<br />
|-<br />
|'''Total volume'''|| align="right" |<b>30</b>||align="right"|<b>30</b><br />
|}<br />
<br />
<li> Incubation: 1 1/2 h at 37°C<br />
<br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)<br />
<br><br />
<br />
<font color=#FF00FF>Results: unexpected sizes of fragments (see protocol), try again next day with an ethidium bromid gel</font><br />
<br><br />
<br><br />
<br><br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Production of chemical competent E.coli</b></p>====<br />
<br />
<p><b>Investigators: Patrick and Jessica</b></p><br />
<br><br />
competent E.coli XL-1-blue and competent E.coli BL21 produced according to the standard-protocoll [[Media:production of competent E.coli.pdf]]<br><br />
<br><br />
<br><br />
<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Design of MCS-Oligos</b></p>====<br />
<p><b>Investigators: Bea, Adrian, Hanna, Sven</b></p><br />
<br><br />
In order to replace the multiple cloning site of the pAAV_MCS vector from Stratagene by RFC25, two oligos were designed. After their hybridization the overhangs correspond to ClaI- and BglII restriction sites. A digestion with BglII and ClaI will be performed with pAAV-MCS and then will be ligated with the designed oligos.<br><br />
The oligos (see link) were ordered at Sigma-Aldrich. Estimated shipment: 31.05.2010 .<br><br />
<br />
<br />
[[File:Freiburg10 Oligos MCS RFC25 for pAAV.pdf]]<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">15. Labortag 26.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Repetition: Cloning of pAAV_MCS + pCMV_mVenus_YFP</b></p>====<br />
<br />
<p><b>Investigators: Bea, Hanna, Jessica</b></p><br />
<br />
<ul><br />
<li>Repeat cloning of pAAV-MCS + pCMV_mVenus_YFP --> <b>Goal: pAAV_mVenus_YFP</b><br><br />
<br />
Cloning did not work (see lab day 25.05.2010) either with NotI or with NotI-HF. Gel did not show any proper band at the expected size. <br><br />
There will be used EtBr instead of gelred in the agarose gel and the incubation time of digestion will be prolonged. Further details are followed. <br><br />
NOTE: There are three restriction sites of NotI in the pCMV-mVenus_YFP. If cloning with NotI, the polyA hGH signal will be deleted. therefore cloning with NotI is '''not''' possible .<br />
<br><br />
<br><br />
<li>Test digestion of pCMV-mVenusYFP with PstI and MluI <br><br />
</ul><br />
<b>Digestion</b><br />
<br><br />
<ul><br />
<li>experiment date: 26.05.2010 </li><br />
<li>plasmid: pCMV_mVenus_YFP; number: P5; production date: 21.05.2010/ pCMV-MSC; number: P2; production date: </li><br />
<li>buffer used: 3/4; Restriction-enzymes used: Enzyme PstI (no. Lab:48) and Enyzme MluI (no. Lab:40) / NotI HF (no. Lab:159) </li><br />
<li>DNA concentration plasmid: P5 477,3 ng/µl / P2 550ng/µl </li><br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4,2||align="right"|3,6<br />
|-<br />
| BSA (10x) || align="right" |2||align="right"|2<br />
|-<br />
| Buffer 3 (10x)|| align="right" |2||align="right"|2<br />
|-<br />
|Enzyme: PstI/NotI HF (no.Lab:48/159)|| align="right" |1||align="right"|2<br />
|-<br />
|Enzyme: MluI (no.Lab:40)|| align="right" |1||align="right"|-<br />
|-<br />
|H2O|| align="right" |9,8||align="right"|10,4<br />
|-<br />
|'''Total volume'''|| align="right" |<b>20</b>||align="right"|<b>20</b><br />
|}<br />
<br><br />
<li> Incubation: 1 h at 37°C<br />
<br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)<br />
<br><br />
Results: Test digestion of pCMV_MCS with NotI delivered plausibel results (expected fragment size: ~ 27 kbp and 17 kbp). <br />
Unfortunately the digestion of pCMV_mVenus_YFP with PstI and MluI resulted in one 2.9 kbp and one 1.2 kbp fragment, which didn't correspond to the expected fragment sizes of 19 kbp and 33 kbp - but to fragment sizes of pCMV_MCS without mVenus_YFP! <br />
<br><br />
<br><br />
<br><br />
</ul><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Ordering oligos</b></p>==== <br />
Bea<br><br />
Oligos have been ordered for modifying the ITRs. Deletion of PstI restriction site in ITR. <br><br />
<br />
<br><br />
'''right ITR of pAAV_MCS''' <br><br />
<br />
oligos ordered:<br><br />
<br />
fwd: 5´- gcgcagctgcctgcaCGGGCGCCTGATGCGG -3´ 77 °C, 31 bp <br><br />
rev: 5´- CCGCATCAGGCGCCCGTGCAGGCAGCTGCGC -3´ <br><br />
<br><br />
<br />
'''leftITR of pAAV_MCS'''<br><br />
<br />
oligos ordered:<br><br />
<br />
fwd: 5´- CCTTTTGCTCACATGTCGTGCAGGCAGCTGCGCG -3´ 74 °C, 34 bp <br><br />
rev: 5´- CGCGCAGCTGCCTGCACGACATGTGAGCAAAAGG -3´<br><br />
<br> <br />
For further details see link <br><br />
<br />
http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/4/44/Freiburg10_Oligos_ITR_mutagenesis_for_pAAV_delete_PstI.pdf<br />
</li><br />
<br><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Test-Trafo of chemical competent E.coli cells</b></p>====<br />
Hanna<br />
<br><br />
The competent E.coli XL-1-blue and competent E.coli BL21 which were prepared the day before were test-transformed with pUC18 - following the standard protocol. Cells were plated on agar plates containing ampicillin and stored over night at 37°C. <br />
Further on two control plates containing ampicillin or kanamycin were prepared. Non-transformed cells were plated on them and also stored over night at 37°C. <br />
<br><br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">16. Labortag 27.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cell counting</b></p>====<br />
<br />
<p><b>Investigator: Patrick, Adrian, Chris W. Christian L.</b></p><br />
<br />
* Meeting<br />
<br />
cell counting:<br />
<br><br />
* BL21 + PUC18 Trafo 54*4 = 216<br />
* XL1B + PUC18 Trafo 30*4 = 120<br />
digitalization of recipe-cards (Christian L.)<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">17. Labortag 31.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>pAAV_RC R585A and R588A transistions</b></p>====<br />
<br />
<br />
<br />
In order to alter the tropism of AAV2 several modifications have to be performed.<br />
First of all the binding to Heparan Sulfate Proteoglycan has to be disrupted. This can be done by R585A and R588A transistions:<br />
[[Image:Freiburg10 R585A R588A.jpg|thumb|center|700px|]]<br />
<br />
<br />
<center>[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June '''=> Go to Labjournal June (labday 18 - 45)''']</center><br><br />
<html><br />
</div><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/MayTeam:Freiburg Bioware/NoteBook/Labjournal/May2011-01-03T07:18:10Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/css}}<br />
{{:Team:Freiburg_Bioware/Head}}<br />
{{:Team:Freiburg_Bioware/menu_notebook}}<br />
{{:Team:Freiburg_Bioware/jquery}}<br />
<br />
<!-- Freiburg_bioware --><br />
[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook => Back to Notebook overview]<br><br><br />
<html><br />
<div id="to_top"><a href="#banner"></a></div><br />
<div class="box_right"><br />
<left><u1>NoteBook Navigator</u1></left><br />
<br><br />
<br />
<ul><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/March">March (labday 1)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/April">April (labday 2 - 5)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/May">May (labday 6 - 17)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June">June (labday 18 - 45)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/July">July (labday 46 - 75)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August">August part 1 (labday 76 - 92)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August2">August part 2 (labday 93 - 106)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September">September part 1 (labday 107 - 123)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September2">September part 2 (labday 124 - 135)</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October">October part 1 (labday 136 - 149 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October2">October part 2 (labday 150 - 166 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/November">November (labday 167 - 170 )</a></li><br />
<li><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/Cellculture">Cellculture</a></li><br />
</ul><br />
</div><br />
</html><br />
===<p style="font-size:17px; background-color:#00dd77;">6. Labday 03.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Theoretical cloning</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Hanna, Bea, Patrick, Chris W. </b></p><br /><br />
Several theoretical cloning issues need to be adressed: The modularization and modification of the Stratagene plasmids and the prodrug activating enzymes. :<br><br />
<br /><br />
1. Cap-Gen: <br />
* delete the PstI-restriction site<br />
* insert an antibody fragment (targeting): sequence? in which part of VP1? (Patrick)<br />
* add prefix & suffix <br />
* disable binding of Heparan Sulphat Proteoglycan <br />
<br><br />
2. Rep-Gen:<br />
* delete EcoRI (2x) and PstI (2x) <br />
<br><br />
3. ITRs:<br />
* NotI and PstI (in sequence?) flank the ITRs: The question whether they can/have to be deleted arose.<br />
* where exactly does the sequence start and end? (Patrick)<br />
* we should check if three ITRs could be used to increase expression levels<br />
* we blasted the ITR (left) of the MCS vektor (Stratagene). we got a 92% "Coverage" with the AAV2 genom (to 100%). from the alignment (Stratagene ITR with ITR of the AAV2 genom) we got:<br><br />
[[Image:Freiburg10 ITR(left)-Stratagene vs. ITR AAV2.jpg|thumb|center|500px|]]<br />
<br />
<br />
<br />
You can see, that the ITR sequence begins 4 bp after the PstI restriction site. thereupon we did a secundary structure analyse (www.dinamelt.bioinfo.rpi.edu), with the following structure we got: <br><br />
[[Media:Freiburg10_AAV2ITR(left)nachBlast.pdf]] <br><br />
conclusion: the big loop of the secondary structure dosent change if we delete the PstI restriction site (cf. with other uploadet secondary structures), it should be considered that we can't add random bp that could affect the secundary structure. <br><br />
<b>To do: which bp, which sequence could/can be insertet? cf. the genome of AAV2</b> <br><br />
<br><br />
4. MCS:<br />
* replacement through the iGEM-MCS<br />
* where is the beginning and ending of the MCS in the Vector? ß-globin function and sequence (search for literature and patents, which are denoted in the AAV-Helper-Free-System Manual)<br />
* in this context it would be also important to find out where the beta-Globulin-Intron exactly starts or rather we can cut out the MCS.<br />
<br><br />
5. enzymes:<br />
* Thymidinkinase: find informations. TK30 (Bea), SR39 (Hanna)<br />
* Cytosindeaminase: find informations (Adrian)<br />
<br><br />
in addition we downloaded, added and anotated the sequence of the pHelper plasmid of Stratagene in Geneious (see "Constructs"). <br />
<br />
<br />
insert the antibody fragment (targeting): sequence? in which part of VP1? (Patrick)<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">7. Labday 07.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Protocolls</b></p>====<br />
<br />
<p><b>Investigators: Anissa, Kerstin </b></p><br><br />
<br />
* adaption and extension of the standart prorcolls (Cloning for Pro's)<br />
* we startet to create a protokoll-mask for the praktical-cloning (short version for labwork)<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">8. Labday 10.05.2010</p> ===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Stock solutions</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Chris W., Chris L., Bea, Achim, Patrick, Hanna, (Sven)</b></p><br><br />
The following stock solutions were prepared: <br><br />
1. Antibiotics:<br />
* Ampicillin: 2 g Ampicillin were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at -20°C.<br />
* Chloramphenicol: 0.5 g Chloramphenicol were dissolved in 20 mL ethanol (70%), filled into 2 mL tubes and stored at the -20°C.<br />
* Kanamycin: 1 g Kanamycin was dissolved in 20 mL multipore-H2O, sterilized by filtration and filled into 2 mL tubes and stored at the -20°C.<br />
* Tetracyclin: 0.5 g Tetracyclin were dissolved in 20 mL ethanol (70%) and filled into 2 mL tubes. The tubes were wrapped with aluminium foil (light sensitive!) and stored at -20°C.<br />
2. ITPG solution (1 M):<br />
* ~ 4.766 g ITPG were dissolved in 20 mL multipore-H2O, sterilized by filtration, filled in 2 mL tubes and stored at -20°C.<br />
3. DYT (5 litres)<br />
* 80 g Bactotrypton, 50 g Bactoyeast, 25 g NaCl were weight out. <br />
* 2 L multipore-H2O were added <br />
* after mixing, multipore-H2O was added -> endvolume 5 litres <br />
* medium was filled into flask and was autoclaved<br />
4. Glycerol:<br />
* Glycerol was filled into a flask and was then autoclaved<br />
<br />
'''To do: register at Mr. Gene!!!'''<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">9. Labday 17.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>β-Globin</b></p>====<br />
<br />
<p><b>Investigators: Bea, Chris W., Patrick, Hanna (and instructors)</b></p><br><br />
<br><br />
We blasted the sequence of the β-globin and additional nucleotides „in the pre- and suffix“.<br />
We found only 70% coverage with the human β-globin-intron add. some parts of the exon 3.<br />
For this reason we think that the pAAV_MCS annotation of the β-Globin-intron of Stratagene is too generously.<br><br />
In addition the alignment of the human ß-globin showed that only parts of the intron 2 (5’) and exon 3 are integratet into the vector.<br />
We assume that the informations from Stratagene are not total correctly ( intron flanket by the splicedonors and the acceptor-sequence).<br />
We blasted the sequence between the CMV-promoter and the origin beginning of the ß-globin intron.<br />
We found a 98,8% coverage with a synthetic CMV-promoter construct ( 1 nucleotide difference).<br />
Literature: „Diverse plasmid DNA vectors by directed molecular evolution of cytomegalovirus promoters. (Wright A. et al.)“<br><br />
→The question arises if we can omit the ß-globin (because the exact function is unknown).<br />
For this we should contact various Companys (GeneArt, DNA2.0, Mr. Gene,…) to get more information.<br />
In addition we could test the expression with and without ß-globin.<br />
<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">10. Labortag 18.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>pCMV_mVenus_YFP</b></p>====<br />
<br />
<br />
<p><b>Investigator: Bea, Chris W., Patrick, Hanna, Anissa, Kerstin, Adrian (und Instructors)</b></p><br />
<br />
<br />
Theoretical cloning with Geneious of pCMV-MCS + pGA14_mVenus_YFP --> <b>pCMV_mVenus_YFP</b><br />
<ul><br />
<li>Enzyme set: RFC 25 (iGEM)<br />
<li> digest pGA14_mVenus_YFP (insert) with XbaI and PstI: mVenus_YFP_cut_XbaI+PstI <br />
<li> digest pCMV_MCS (vector) with XbaI and PstI: pCMV_MCS_cut_XbaI+PstI<br />
<li> ligate mVenus_YFP_cut_XbaI+PstI with pCMV_MCS_cut_XbaI+PstI <br />
<br><br />
[[Image:Freiburg10 pCMV MCS mVenus YFP.png|thumb|center|500px]]<br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">11. Labortag 19.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV-MCS + pGA14_mVenus_YFP pCMV_mVenus_YFP</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Bea, Chris W., Hanna, Patrick</b></p><br />
<br />
<b>Digestion</b><br />
<br><br />
<ul><br />
<li>plasmid: insert: pGA14_mVenus_YFP; number: P1 production date: ____ origin: ____ </li><br />
<li>plasmid: vector: pCMV_MCS; number: P2 production date: ____ origin: ____ </li><br />
<li>new vector name: pCMV_mVenus_YFP <br></li><br />
<li>buffer used:3 ; Restriction-enzymes used: Enzyme XbaI (no. Lab:___) ; Enzyme PstI(no.Lab:___)</li><br />
<li>DNA concentration (vector): 375 ng/µl ; DNA concentration (insert): 476 ng/µl</li><br />
<br />
{| border="1"<br />
| components || align="right" | V (pGA_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4||align="right"|2,7<br />
|-<br />
| BSA (10x) || align="right" |2||align="right"|2<br />
|-<br />
| Buffer 3 (10x)|| align="right" |2||align="right"|2<br />
|-<br />
|Enzyme: XbaI (no.Lab:___)|| align="right" |1,5||align="right"|1,5<br />
|-<br />
|Enzyme: PstI (no.Lab:___)|| align="right" |1||align="right"|1<br />
|-<br />
|H2O|| align="right" |9,5||align="right"|10,8<br />
|-<br />
|'''Total volume'''|| align="right" |<b>20</b>||align="right"|<b>20</b><br />
|}<br />
<br />
<li> Incubation: 1 h at 37°C</li><br />
</ul><br />
<br />
<b>1% Agarose gel and Gel extraction</b><br />
<ul><br />
<li>prepare 1% agarose gel, run gel for 45 minutes(119 V)</li><br />
<li>cut out insert and vector</li><br />
<li>perform gel extraction following standard protocol provided by Qiagen</li><br />
</ul><br />
<br />
<b>Ligation</b><br />
<br />
<ul><br />
<li>Measure DNA-concentration with Nanodrop </li><br />
<li>c(mVenus_YFP) = 16,8 ng/µL</li><br />
<li>c(pCMV_MCS) = 22,8 ng/µL</li><br />
<li>Calculation of volume needed for ligation: <br />
<li>c(mVenus_YFP) = 3,66 µL</li><br />
<li>c(pCMV_MCS) = 5,34 µL</li></li><br />
</ul><br />
<br />
<b>Transformation</b><br />
<ul><br />
<li>Transformation has been followed the standard protocol [[Media:Freiburg10_Cloning Protocol.pdf]] </li><br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">12. Labortag 20.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Picking clones</b></p>====<br />
<br />
<p><b>Investigators: Adrian, Bea</b></p><br />
<ul><br/><br />
Clones were picked according to the standard protocol.<br />
*3 approaches from each plate</li><br />
</ul><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">13. Labortag 21.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>CMV-Promoter</b></p>====<br />
<br />
<p><b>Investigators: Volker, Hanna</b></p><br />
<br />
<br><br />
<b>Theoretical cloning:</b> <br />
* The CMV promoter (mainly the regulatory region) was further characterized: For this purpose U.S. patent no. 5,385,839 was used. [[Media:Freiburg10_Patent_US5385839A.pdf]]<br />
* Further on the CMV promoter sequence was blasted. The results delivered a 98% query coverage with the "Human herpesvirus 5 strain Toledo, complete genome" (accession no.: GU937742.1). Interestingly the maximal identity was just 99%. This can be explained due to a nucleotide deletion and a C-T transition (red circles), which were also marked in Geneious. <br />
[[Image:Freiburg10_CMV-Alignment.jpg|thumb|center|500px|]]<br />
<br><br />
[[Image:Freiburg10 CMV.jpg|thumb|center|800px|]]<br />
<br><br />
'''To do''': find "+1"-location (transcription start); which transcription factors bind to the regulatory region of the CMV promoter?<br />
<br><br />
<br><br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>LB medium''' was prepared</b></p>====<br />
Patrick and Chris W. <br/><br />
* 10 g Bacto-Tryptone, 5 g Bacto-Yeast, 10 g NaCl were mixed in 500 mL milipore-H2O. <br />
* Volume was adjusted to 1 L with milipore-H2O.<br />
* 100 mL flasks were each filled with 50 mL medium.<br />
* 0.75 g agar was added to each flask.<br />
* LB was sterilized by autoclaving and is now stored at room temperature.<br />
<br><br />
<br><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Plasmid Mini-Prep according to the standard protocol</b></p>====<br />
Adrian, Kira, Anna, Chris W., Patrick<br />
<br/><br />
Measure DNA-concentration with Nanodrop:<br/><br />
<br />
<br />
{| border="1"<br />
| || align="right" | P3 (pCMV_mVenus_YFP) ||align="right"| P4 (pCMV_mVenus_YFP) ||align="right"| P5 (pCMV_mVenus_YFP)<br />
|-<br />
| concentration (ng/µl)|| align="right" | 457||align="right"|470,8|| align="right" | 477,29<br />
|}<br />
<br/><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">14. Labortag 25.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cloning of pCMV_mVenus_YFP + pAAV_MCS</b></p>====<br />
<br />
<p><b>Investigators: Kira, Anna, Volker, Jessica</b></p><br />
<br />
<br><br />
<br />
<li>plasmid: insert: pCMV_mVenus_YFP; number: P5 production date: 21.05.2010 origin: ____ <br />
<li>plasmid: vector: pAAV_MCS; number: P? production date: ____ origin: ____ <br />
<li>new vector name: pAAV_mVenus_YFP <br> <br />
<br />
<br><br />
'''1st try:<br />
<br />
<li>buffer used:3 ; Restriction-enzymes used: Enzyme NotI (no. Lab:46) <br />
<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl<br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4.2||align="right"|3.5<br />
|-<br />
| BSA (10x) || align="right" |3||align="right"|3<br />
|-<br />
| Buffer 3 (10x)|| align="right" |3||align="right"|3<br />
|-<br />
|Enzyme: NotI (no.Lab:46)|| align="right" |1||align="right"|1<br />
|-<br />
|H2O|| align="right" |15.3||align="right"|15.3<br />
|-<br />
|'''Total volume'''|| align="right" |<b>26.4</b>||align="right"|<b>25.8</b><br />
|}<br />
<br />
<li> Incubation: 1 1/2 h at 37°C<br />
<br><br />
'''note: too little water was added<br />
<br><br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was prepared, gel ran for 45 minutes(119 V)<br />
<br><br />
<br><br />
'''2nd try:'''<br />
<br />
<li>buffer used:4 ; Restriction-enzymes used: Enzyme NotI (no. Lab:159) <br />
<li>DNA concentration (vector): 360 ng/µl ; DNA concentration (insert): 477 ng/µl<br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pAAV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4.2||align="right"|3.5<br />
|-<br />
| BSA (10x) || align="right" |3||align="right"|3<br />
|-<br />
| Buffer 4 (10x)|| align="right" |3||align="right"|3<br />
|-<br />
|Enzyme: NotI (no.Lab:159)|| align="right" |1,5||align="right"|1,5<br />
|-<br />
|H2O|| align="right" |18,3||align="right"|19<br />
|-<br />
|'''Total volume'''|| align="right" |<b>30</b>||align="right"|<b>30</b><br />
|}<br />
<br />
<li> Incubation: 1 1/2 h at 37°C<br />
<br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)<br />
<br><br />
<br />
<font color=#FF00FF>Results: unexpected sizes of fragments (see protocol), try again next day with an ethidium bromid gel</font><br />
<br><br />
<br><br />
<br><br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Production of chemical competent E.coli</b></p>====<br />
<br />
<p><b>Investigators: Patrick and Jessica</b></p><br />
<br><br />
competent E.coli XL-1-blue and competent E.coli BL21 produced according to the standard-protocoll [[Media:production of competent E.coli.pdf]]<br><br />
<br><br />
<br><br />
<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Design of MCS-Oligos</b></p>====<br />
<p><b>Investigators: Bea, Adrian, Hanna, Sven</b></p><br />
<br><br />
In order to replace the multiple cloning site of the pAAV_MCS vector from Stratagene by RFC25, two oligos were designed. After their hybridization the overhangs correspond to ClaI- and BglII restriction sites. A digestion with BglII and ClaI will be performed with pAAV-MCS and then will be ligated with the designed oligos.<br><br />
The oligos (see link) were ordered at Sigma-Aldrich. Estimated shipment: 31.05.2010 .<br><br />
<br />
<br />
[[File:Freiburg10 Oligos MCS RFC25 for pAAV.pdf]]<br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">15. Labortag 26.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Repetition: Cloning of pAAV_MCS + pCMV_mVenus_YFP</b></p>====<br />
<br />
<p><b>Investigators: Bea, Hanna, Jessica</b></p><br />
<br />
<ul><br />
<li>Repeat cloning of pAAV-MCS + pCMV_mVenus_YFP --> <b>Goal: pAAV_mVenus_YFP</b><br><br />
<br />
Cloning did not work (see lab day 25.05.2010) either with NotI or with NotI-HF. Gel did not show any proper band at the expected size. <br><br />
There will be used EtBr instead of gelred in the agarose gel and the incubation time of digestion will be prolonged. Further details are followed. <br><br />
NOTE: There are three restriction sites of NotI in the pCMV-mVenus_YFP. If cloning with NotI, the polyA hGH signal will be deleted. therefore cloning with NotI is '''not''' possible .<br />
<br><br />
<br><br />
<li>Test digestion of pCMV-mVenusYFP with PstI and MluI <br><br />
</ul><br />
<b>Digestion</b><br />
<br><br />
<ul><br />
<li>experiment date: 26.05.2010 </li><br />
<li>plasmid: pCMV_mVenus_YFP; number: P5; production date: 21.05.2010/ pCMV-MSC; number: P2; production date: </li><br />
<li>buffer used: 3/4; Restriction-enzymes used: Enzyme PstI (no. Lab:48) and Enyzme MluI (no. Lab:40) / NotI HF (no. Lab:159) </li><br />
<li>DNA concentration plasmid: P5 477,3 ng/µl / P2 550ng/µl </li><br />
<br />
{| border="1"<br />
| components || align="right" | V (pCMV_mVenus_YFP)/ µl ||align="right"| V(pCMV_MCS) / µl<br />
|-<br />
| DNA || align="right" | 4,2||align="right"|3,6<br />
|-<br />
| BSA (10x) || align="right" |2||align="right"|2<br />
|-<br />
| Buffer 3 (10x)|| align="right" |2||align="right"|2<br />
|-<br />
|Enzyme: PstI/NotI HF (no.Lab:48/159)|| align="right" |1||align="right"|2<br />
|-<br />
|Enzyme: MluI (no.Lab:40)|| align="right" |1||align="right"|-<br />
|-<br />
|H2O|| align="right" |9,8||align="right"|10,4<br />
|-<br />
|'''Total volume'''|| align="right" |<b>20</b>||align="right"|<b>20</b><br />
|}<br />
<br><br />
<li> Incubation: 1 h at 37°C<br />
<br />
<br><br />
1% Agarose gel<br />
<br><br />
<li>1% agarose gel was repared, gel ran for 45 minutes(119 V)<br />
<br><br />
Results: Test digestion of pCMV_MCS with NotI delivered plausibel results (expected fragment size: ~ 27 kbp and 17 kbp). <br />
Unfortunately the digestion of pCMV_mVenus_YFP with PstI and MluI resulted in one 2.9 kbp and one 1.2 kbp fragment, which didn't correspond to the expected fragment sizes of 19 kbp and 33 kbp - but to fragment sizes of pCMV_MCS without mVenus_YFP! <br />
<br><br />
<br><br />
<br><br />
</ul><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Ordering oligos</b></p>==== <br />
Bea<br><br />
Oligos have been ordered for modifying the ITRs. Deletion of PstI restriction site in ITR. <br><br />
<br />
<br><br />
'''right ITR of pAAV_MCS''' <br><br />
<br />
oligos ordered:<br><br />
<br />
fwd: 5´- gcgcagctgcctgcaCGGGCGCCTGATGCGG -3´ 77 °C, 31 bp <br><br />
rev: 5´- CCGCATCAGGCGCCCGTGCAGGCAGCTGCGC -3´ <br><br />
<br><br />
<br />
'''leftITR of pAAV_MCS'''<br><br />
<br />
oligos ordered:<br><br />
<br />
fwd: 5´- CCTTTTGCTCACATGTCGTGCAGGCAGCTGCGCG -3´ 74 °C, 34 bp <br><br />
rev: 5´- CGCGCAGCTGCCTGCACGACATGTGAGCAAAAGG -3´<br><br />
<br> <br />
For further details see link <br><br />
<br />
http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/4/44/Freiburg10_Oligos_ITR_mutagenesis_for_pAAV_delete_PstI.pdf<br />
</li><br />
<br><br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Test-Trafo of chemical competent E.coli cells</b></p>====<br />
Hanna<br />
<br><br />
The competent E.coli XL-1-blue and competent E.coli BL21 which were prepared the day before were test-transformed with pUC18 - following the standard protocol. Cells were plated on agar plates containing ampicillin and stored over night at 37°C. <br />
Further on two control plates containing ampicillin or kanamycin were prepared. Non-transformed cells were plated on them and also stored over night at 37°C. <br />
<br><br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">16. Labortag 27.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>Cell counting</b></p>====<br />
<br />
<p><b>Investigator: Patrick, Adrian, Chris W. Christian L.</b></p><br />
<br />
* Meeting<br />
<br />
cell counting:<br />
<br><br />
* BL21 + PUC18 Trafo 54*4 = 216<br />
* XL1B + PUC18 Trafo 30*4 = 120<br />
digitalization of recipe-cards (Christian L.)<br />
<br><br />
<br />
===<p style="font-size:17px; background-color:#00dd77;">17. Labortag 31.05.2010</p>===<br />
<br />
====<p style="font-size:15px; background-color:#66bbFF;"><b>pAAV_RC R585A and R588A transistions</b></p>====<br />
<br />
<br />
<br />
In order to alter the tropism of AAV2 several modifications have to be performed.<br />
First of all the binding to Heparan Sulfate Proteoglycan has to be disrupted. This can be done by R585A and R588A transistions:<br />
[[Image:Freiburg10 R585A R588A.jpg|thumb|center|700px|]]<br />
<br />
<br />
<center>[https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June '''=> Go to Labjournal June (labday 18 - 45)''']</center><br><br />
<html><br />
</div><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/css_homepageTeam:Freiburg Bioware/css homepage2011-01-03T07:15:12Z<p>Faha: </p>
<hr />
<div><html><br />
<style><br />
<br />
.separator{<br />
border-bottom: 1px solid #eee;<br />
}<br />
<br />
div.box_home {<br />
margin:15px;<br />
float:left;<br />
width:400px;<br />
height:240px;<br />
padding:10px;<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/e/eb/Freiburg10_Box_Home.png) no-repeat scroll center 0px;<br />
}<br />
div.box_home:hover {<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/e/eb/Freiburg10_Box_Home.png) no-repeat scroll center 0px;<br />
}<br />
div.box_home div.img {<br />
width:140px;<br />
}<br />
.box_home h2 {<br />
width:265px;<br />
}<br />
div.box_home_small {<br />
margin:15px;<br />
float:left;<br />
width:175px;<br />
height:240px;<br />
padding:10px;<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/f/f0/Freiburg10_Box_Small.png) no-repeat scroll center 0px;<br />
}<br />
div.box_home_small:hover {<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/f/f0/Freiburg10_Box_Small.png) no-repeat scroll center 0px;<br />
}<br />
<br />
div.box_home_small img {<br />
max-width: 50px;<br />
float:right;<br />
margin:0 10px 10px 0;<br />
}<br />
.box_home_small h2 {<br />
width:110px;<br />
}<br />
<br />
div.box_long {<br />
margin:15px;<br />
float:left;<br />
width:400px;<br />
height:95px;<br />
padding:10px;<br />
background: transparent <br />
url(https://static.igem.org/mediawiki/2010/7/72/Freiburg10_Box_Long.png) no-repeat scroll center 0px;<br />
}<br />
<br />
div.box_long img {<br />
max-width: 100px;<br />
max-height:100px;<br />
float:right;<br />
margin:0 10px 10px 0;<br />
}<br />
<br />
div.box_long h2 {<br />
width: 335px;<br />
}<br />
<br />
div.div_home {<br />
width: 590px;<br />
margin:0 15px 15px;<br />
float:left;<br />
}<br />
<br />
div.virus {<br />
height:260px;<br />
margin: 0 15px 15px;<br />
float:right;<br />
}<br />
<br />
<br />
/* labjournal css */<br />
<br />
.box_labjournal_195 a {<br />
margin: 5px 0px 5px 25px;<br />
float: left;<br />
width: 195px;<br />
height: 260px;<br />
background: transparent url(https://static.igem.org/mediawiki/2010/f/f0/Freiburg10_Box_Small.png) no-repeat scroll center 0px;<br />
}<br />
.box_labjournal_195 a:hover {<br />
background: transparent url(https://static.igem.org/mediawiki/2010/7/7c/Freiburg10_Box_klein.png) no-repeat scroll center 0px;<br />
text-decoration: none;<br />
}<br />
<br />
.image_labjournal {<br />
width: 195px;<br />
height: auto;<br />
margin: 0px 0px 0px 0px;<br />
}<br />
<br />
.boxes_labjournal_day {<br />
font-family: verdana,arial,helvetica,geneva,sans-serif;<br />
font-size: 12px;<br />
text-align: left<br />
margin: 10px 0px 0px 5px;<br />
color: #333;<br />
}<br />
<br />
.boxes_labjournal_text {<br />
font-family: verdana,arial,helvetica,geneva,sans-serif;<br />
font-size: 12px;<br />
text-align: center;<br />
margin: 5px 0px 0px 0px;<br />
color: #333;<br />
}<br />
<br />
/*labjournal style ends here */<br />
<br />
#logo {<br />
width: 160px;<br />
height: 180px;<br />
margin: 15px 10px 0px 10px;<br />
float: left;<br />
align: left;<br />
vertical-align: bottom;<br />
}<br />
<br />
img.logoright {<br />
margin: 5px;<br />
float: right;<br />
}<br />
<br />
img.logorightII {<br />
margin: 50px 100px 30px 200px;<br />
float: right;<br />
}<br />
<br />
/* news ticker */<br />
.newsticker {<br />
list-style-type: none;<br />
list-style-image: none;<br />
border: none;<br />
background: transparent;<br />
padding: 0;<br />
margin: 0;<br />
top:-30px;<br />
}<br />
.news p {<br />
margin:0;<br />
position:relative;<br />
top:45px;<br />
font-size:1em;<br />
text-align:center;<br />
left:-10px;<br />
padding:0 5px;<br />
}<br />
<br />
.news {<br />
position:relative;<br />
top:-30px;<br />
}<br />
<br />
div.box_long_news a h2 {<br />
width: 275px;<br />
}<br />
<br />
/* go to the top */<br />
#to_top {<br />
position: fixed;<br />
bottom: 50px;<br />
right: 10px;<br />
height: 25px;<br />
width: 50px;<br />
background: transparent url("http://www.molbiotech.uni-freiburg.de/iGEM/wiki2010/images/7/78/To_top.png") no-repeat scroll center center;<br />
border: 1px solid black;<br />
}<br />
<br />
</style><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Results/KillingTeam:Freiburg Bioware/Project/Results/Killing2010-10-28T03:53:28Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<p><br />
Finally we successfully combined different modifactions of the therapeutic viral vector for optimizing it for tumore therapy application. These modifications include the knock down of the natural tropism for HSPG receptor, the tumor targeting using the affibody ZEGFR1907 fused to the N-terminus of the viral coat protein VP2 and an encapsidated vectorgenome that was bricked down and reassembled containing the prodrug converting Guanosine Monophosphate Kinase Thymidine Kinase fusion protein (mGMK-TK).<br />
<br />
</p><br />
<br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Results/KillingTeam:Freiburg Bioware/Project/Results/Killing2010-10-28T03:49:33Z<p>Faha: New page: {{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}} <html> </html> {{:Team:Freiburg_Bioware/Footer}}</p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<br />
<br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Team/Cuckoo_ClockTeam:Freiburg Bioware/Team/Cuckoo Clock2010-10-28T03:32:38Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<html><br />
<div class="nh"></div><br />
<!---Cuckoo Clock Competition ---><br />
<div style="width:965px; height:420px; "><br />
<div style="float:left; width:550px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
iGEM focuses on science, but also encompasses community outreach, communication, representation and last but not least, fun in the lab. All this is often communicated best with visual impressions. Several team wikis feature great photos, but some of them are hard to find. Therefore, we thought it would be best to bundle them and highlight the best ones to maximize impact. This is why we started an iGEM photo-contest: The Cuckoo Clock Competition. As the name implies, the first prize is an original Cuckoo Clock typical for the gorgeous Black Forest surrounding Freiburg. All teams are cordially invited to participate! <b>Please send your pictures</b> of choice representing your team, project, spirit or fun in the lab along with a short description to our e-mail address: &nbsp;&nbsp;&nbsp;<a href="mailto:igem.freiburg.2010@googlemail.com">igem.freiburg.2010@googlemail.com</a><br /><br />
Your pictures will be uploaded to the <a href=https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Cuckoo_Clock>competition webpage</a> as soon as we get them. In addition, we will send you a participation badge for your team wiki. A judging committee consisting of members from three different iGEM teams will vote for the winner picture. <br />
The team with the best picture will receive our amazing Cuckoo Clock in Boston at the socializing event on Sunday. So put your stressful projects aside for a few minutes and take the fun part!<br /><br />
Looking forward to meeting you in Boston. <br /><br /><br />
Cheers,<br /><br />
The iGEM team Freiburg 2010<br />
</div><br />
<div style="float:right; width:400px; height:auto; "><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Cuckoo_Clock" target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/30/Freiburg10_CCC.png" width="360px" /></a></div></div><br />
<div class="clearfix"></div><br />
<br />
<div class="box box_full"><br />
<center><h2>KIT-Kyoto</h2></center><br />
<div style="width:885px; height:350px;"><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
This picture shows "Kimwipes table tennis".<br> It is Scientific sports which only needs things existing in a laboratory. Therefore we can play it easily. This is the best diversion for scientists to take a rest, however, you must be careful about instruments on the table.<br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5530179561083828801%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCNSe4YGY6JjWDQ%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Tokyo_Metropolitan</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Six soldiers who guard our safety and peace in the labolatory<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/4/40/Freiburg10_CCC_Tokyo_Metropolitan.jpg" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Stockholm</h2></center><br />
<div style="width:885px; height:390px; "><br />
<div style="float:left; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Material: E-flask with unidentified liquid, one Flute (Pearl), big book, camera (Nikon), projector (Sony) and one Homo sapiens.<br><br><br />
Methods: Pictures were taken at evenly spaced angles and processed. A 5-fold increase in awesomeness was improved using Adobe Photoshop.<br><br><br />
Results: We have illustrated the free spirit of research at Stockholm University<br><br />
</div><br />
<br><br><br><br />
<div style=" width:880px; height:auto; "><center><img src="https://static.igem.org/mediawiki/2010/d/dc/Freiburg10_CCC_Stockholm.jpg" width="700" margin: 10px 10px 10px 10px/></center></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Davidson-MissouriW</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Standing tall for life, liberty and the pursuit of synthetic biology,<br><br />
We give our pipettes, our test tubes,<br><br />
Our huddled masses of bacteria yearning to breathe free,<br><br />
The wretched refuse of our teeming Petri dishes.<br><br />
We lift our lamps beside the golden door to the future.<br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/f/fc/Freiburg10_CCC_Davidson.jpeg<br />
" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Panama</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Picture 1 (Ernesto): Surprised in the Lab, a little bit of eyes.<br><br><br />
<br />
Picture 2 (Natasha & Ernesto): Team Panama is a great family but Natasha and Ernesto are the blood brothers of Team Panama... working in synthetic biology and in Hair cut!!!<br><br><br />
<br />
Picture 3 (Ernesto & Natasha): After a tedious DNA miniprep and a frustrating electrophoresis, the micropipete gun appears!!!<br><br><br />
<br />
Picture 4 (Carol & Nicole): I told you that I want to perform the DNA extraction!<br><br><br />
<br />
Picture 5 (This is it?) This is it?<br><br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532357684737013729%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJLGhvmglOeFmwE%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>LMU-Munich</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
The "ByeByeBiobricks"-Party: <br><br />
Find the pipette tips!<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/0/08/Freiburg10_CCC-LMU.jpg" width="340" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>UPO-Sevilla</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Don’t allow electrophoresis gel hogs the limelight!<br />
Transillumination camera is able to catch your best smile.<br />
Those pictures were taken in the middle of August, when we would love some vacations.<br />
Ps: Our Wet Lab Leader told us the transillumination camera secret.<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/3/38/Freiburg10_CCC_UPO-Sevilla.jpg" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Nevada</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Our long term goals are to develop plant biosensors that reliably measure changes in the local environment. In the process of developing biosensors, the 2010 Nevada iGEM Team need to develop fundamental promoters, reporters, and plasmids for plants. Therefore, the 2010 Nevada iGEM Team has three goals for this year’s competition. First, we are going to test the validity of utilizing Nicotiana tabacum (NT cells) as a model for the expression of higher plant genes for future iGEM competitions. NT cells are a faster, cheaper, and safer model than traditional plant transformation. These cells can therefore be utilized as a quick proof-of-concept test model before moving synthetic constructs into plants of interest. We also aim to produce an iGEM-compatible plant-specific plasmid, several stress-inducible plant promoters, reporter genes containing Kozak sequences (ribosome binding sites) and terminators that conform to BioBrick standards. Lastly, we hope to measure the induction of these stress promoters in real-time by performing a fluorometry assay in which stress will be applied to NT cells and fluorescent output by a reporter (GFP) will be measured to detail induction in real time. This method has a distinct advantage over microarrays since microarrays are only one ‘snapshot’ in time.<br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532529262339888081%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJWvnuGD6LDQnQE%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Korea_U_Seoul</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
First one which has 3 people.<br />
Tzu Chi university, where the workshop was held, is a Buddhist school.<br />
We had a vegetarian food there.<br />
We had a photo session at the end of the workshop,<br />
and there we took this one in memory of Buddhism.<br />
Can you feel the Buddha spirit?<br><br><br />
Second is all of our members who went to the workshop.<br />
We don't just gather to take a pictures.<br />
We follow concepts and orders.<br />
Do we look like real scientists?<br><br><br />
We took last one in lab.<br />
We are almost done with every thing and getting ready for Jamboree!<br />
We had to take a rest and there was not enough room for us to sit down...<br />
We sat on a chair one on one... and stacked ourselves...<br />
We are happy it's almost done, though! =)<br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532698106241505681%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJDTtNP2-6TufA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>TU Delft</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Photo 1: Nadine as Nerd @ Night of the Nerds - we wen't to an event called Night of the Nerds as a team, of course we couldn't just go normally, we had to look like a Nerd and this was the result.<br><br />
Photo 2: Eva's interpretation of the statue of Liberty: The statue of Sequencing, with a golden pipet, a crown of golden tubes and a banner of GATC<br><br />
Photo 3: Pieter accidentally added X-gal to his cultures which made them turn blue! (He was supposed to add IPTG to induce them... doh!)<br><br />
Photo 4: We take our project very seriously, which is why we didn't mind that Nadine (on of our team members) showed up with SuitSupply as our sponsor<br><br />
Photo 5: Hugo caught in the Lab! (doing what?)<br><br />
Photo 6: iJAM - Our team loves to play music which is why we occasionally did an iJAM, playing our favorite songs we were able to come much closer as a team<br><br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532702604232485921%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCLKPyb6Nnf6NEA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<br />
<center><h2>Bielefeld</h2></center><br />
<div style="width:885px; height:350px;"><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Photo1: Bielefeld_BioBricks:<br /><br />
Sometimes it was not fun to find the right construct within the bunch of BioBricks.<br /><br />
Photo2: Bielefeld_Musketiere:<br><br />
Our motto: "All for one, one for all" / Our weapons: the pipettes.<br><br />
</div><br />
<br />
<div style="float:left; width:440px; height:auto;"><br />
<embed type="application/x-shockwave-flash" src="http://picasaweb.google.de/s/c/bin/slideshow.swf" width="440" height="294" flashvars="host=picasaweb.google.de&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.de%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532800850368683217%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCPGc1sb4uNL2bQ%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed><br />
</div><br />
</div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Team/Cuckoo_ClockTeam:Freiburg Bioware/Team/Cuckoo Clock2010-10-28T03:29:55Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<html><br />
<div class="nh"></div><br />
<!---Cuckoo Clock Competition ---><br />
<div style="width:965px; height:420px; "><br />
<div style="float:left; width:550px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
iGEM focuses on science, but also encompasses community outreach, communication, representation and last but not least, fun in the lab. All this is often communicated best with visual impressions. Several team wikis feature great photos, but some of them are hard to find. Therefore, we thought it would be best to bundle them and highlight the best ones to maximize impact. This is why we started an iGEM photo-contest: The Cuckoo Clock Competition. As the name implies, the first prize is an original Cuckoo Clock typical for the gorgeous Black Forest surrounding Freiburg. All teams are cordially invited to participate! <b>Please send your pictures</b> of choice representing your team, project, spirit or fun in the lab along with a short description to our e-mail address: &nbsp;&nbsp;&nbsp;<a href="mailto:igem.freiburg.2010@googlemail.com">igem.freiburg.2010@googlemail.com</a><br /><br />
Your pictures will be uploaded to the <a href=https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Cuckoo_Clock>competition webpage</a> as soon as we get them. In addition, we will send you a participation badge for your team wiki. A judging committee consisting of members from three different iGEM teams will vote for the winner picture. <br />
The team with the best picture will receive our amazing Cuckoo Clock in Boston at the socializing event on Sunday. So put your stressful projects aside for a few minutes and take the fun part!<br /><br />
Looking forward to meeting you in Boston. <br /><br /><br />
Cheers,<br /><br />
The iGEM team Freiburg 2010<br />
</div><br />
<div style="float:right; width:400px; height:auto; "><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Cuckoo_Clock" target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/30/Freiburg10_CCC.png" width="360px" /></a></div></div><br />
<div class="clearfix"></div><br />
<br />
<div class="box box_full"><br />
<center><h2>KIT-Kyoto</h2></center><br />
<div style="width:885px; height:350px;"><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
This picture shows "Kimwipes table tennis".<br> It is Scientific sports which only needs things existing in a laboratory. Therefore we can play it easily. This is the best diversion for scientists to take a rest, however, you must be careful about instruments on the table.<br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5530179561083828801%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCNSe4YGY6JjWDQ%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Tokyo_Metropolitan</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Six soldiers who guard our safety and peace in the labolatory<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/4/40/Freiburg10_CCC_Tokyo_Metropolitan.jpg" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Stockholm</h2></center><br />
<div style="width:885px; height:390px; "><br />
<div style="float:left; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Material: E-flask with unidentified liquid, one Flute (Pearl), big book, camera (Nikon), projector (Sony) and one Homo sapiens.<br><br><br />
Methods: Pictures were taken at evenly spaced angles and processed. A 5-fold increase in awesomeness was improved using Adobe Photoshop.<br><br><br />
Results: We have illustrated the free spirit of research at Stockholm University<br><br />
</div><br />
<br><br><br><br />
<div style=" width:880px; height:auto; "><center><img src="https://static.igem.org/mediawiki/2010/d/dc/Freiburg10_CCC_Stockholm.jpg" width="700" margin: 10px 10px 10px 10px/></center></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Davidson-MissouriW</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Standing tall for life, liberty and the pursuit of synthetic biology,<br><br />
We give our pipettes, our test tubes,<br><br />
Our huddled masses of bacteria yearning to breathe free,<br><br />
The wretched refuse of our teeming Petri dishes.<br><br />
We lift our lamps beside the golden door to the future.<br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/f/fc/Freiburg10_CCC_Davidson.jpeg<br />
" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Panama</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Picture 1 (Ernesto): Surprised in the Lab, a little bit of eyes.<br><br><br />
<br />
Picture 2 (Natasha & Ernesto): Team Panama is a great family but Natasha and Ernesto are the blood brothers of Team Panama... working in synthetic biology and in Hair cut!!!<br><br><br />
<br />
Picture 3 (Ernesto & Natasha): After a tedious DNA miniprep and a frustrating electrophoresis, the micropipete gun appears!!!<br><br><br />
<br />
Picture 4 (Carol & Nicole): I told you that I want to perform the DNA extraction!<br><br><br />
<br />
Picture 5 (This is it?) This is it?<br><br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532357684737013729%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJLGhvmglOeFmwE%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>LMU-Munich</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
The "ByeByeBiobricks"-Party: <br><br />
Find the pipette tips!<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/0/08/Freiburg10_CCC-LMU.jpg" width="340" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>UPO-Sevilla</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Don’t allow electrophoresis gel hogs the limelight!<br />
Transillumination camera is able to catch your best smile.<br />
Those pictures were taken in the middle of August, when we would love some vacations.<br />
Ps: Our Wet Lab Leader told us the transillumination camera secret.<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/3/38/Freiburg10_CCC_UPO-Sevilla.jpg" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Nevada</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Our long term goals are to develop plant biosensors that reliably measure changes in the local environment. In the process of developing biosensors, the 2010 Nevada iGEM Team need to develop fundamental promoters, reporters, and plasmids for plants. Therefore, the 2010 Nevada iGEM Team has three goals for this year’s competition. First, we are going to test the validity of utilizing Nicotiana tabacum (NT cells) as a model for the expression of higher plant genes for future iGEM competitions. NT cells are a faster, cheaper, and safer model than traditional plant transformation. These cells can therefore be utilized as a quick proof-of-concept test model before moving synthetic constructs into plants of interest. We also aim to produce an iGEM-compatible plant-specific plasmid, several stress-inducible plant promoters, reporter genes containing Kozak sequences (ribosome binding sites) and terminators that conform to BioBrick standards. Lastly, we hope to measure the induction of these stress promoters in real-time by performing a fluorometry assay in which stress will be applied to NT cells and fluorescent output by a reporter (GFP) will be measured to detail induction in real time. This method has a distinct advantage over microarrays since microarrays are only one ‘snapshot’ in time.<br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532529262339888081%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJWvnuGD6LDQnQE%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Korea_U_Seoul</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
First one which has 3 people.<br />
Tzu Chi university, where the workshop was held, is a Buddhist school.<br />
We had a vegetarian food there.<br />
We had a photo session at the end of the workshop,<br />
and there we took this one in memory of Buddhism.<br />
Can you feel the Buddha spirit?<br><br><br />
Second is all of our members who went to the workshop.<br />
We don't just gather to take a pictures.<br />
We follow concepts and orders.<br />
Do we look like real scientists?<br><br><br />
We took last one in lab.<br />
We are almost done with every thing and getting ready for Jamboree!<br />
We had to take a rest and there was not enough room for us to sit down...<br />
We sat on a chair one on one... and stacked ourselves...<br />
We are happy it's almost done, though! =)<br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532698106241505681%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJDTtNP2-6TufA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>TU Delft</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Photo 1: Nadine as Nerd @ Night of the Nerds - we wen't to an event called Night of the Nerds as a team, of course we couldn't just go normally, we had to look like a Nerd and this was the result.<br><br />
Photo 2: Eva's interpretation of the statue of Liberty: The statue of Sequencing, with a golden pipet, a crown of golden tubes and a banner of GATC<br><br />
Photo 3: Pieter accidentally added X-gal to his cultures which made them turn blue! (He was supposed to add IPTG to induce them... doh!)<br><br />
Photo 4: We take our project very seriously, which is why we didn't mind that Nadine (on of our team members) showed up with SuitSupply as our sponsor<br><br />
Photo 5: Hugo caught in the Lab! (doing what?)<br><br />
Photo 6: iJAM - Our team loves to play music which is why we occasionally did an iJAM, playing our favorite songs we were able to come much closer as a team<br><br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532702604232485921%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCLKPyb6Nnf6NEA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<br />
<center><h2>Bielefeld</h2></center><br />
<div style="width:885px; height:350px;"><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Photo1: Bielefeld_BioBricks:<br /><br />
Sometimes it was not fun to find the right construct within the bunch of BioBricks.<br /><br />
Photo2: Bielefeld_Musketiere:<br><br />
Our motto: "All for one, one for all" / Our weapons: the pipettes.<br><br />
</div><br />
<br />
<div style="float:left; width:440px; height:auto;"><br />
<embed type="application/x-shockwave-flash" src="http://picasaweb.google.de/s/c/bin/slideshow.swf" width="400" height="267" flashvars="host=picasaweb.google.de&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.de%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532800850368683217%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCPGc1sb4uNL2bQ%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed><br />
</div><br />
</div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Team/Cuckoo_ClockTeam:Freiburg Bioware/Team/Cuckoo Clock2010-10-28T03:27:31Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<html><br />
<div class="nh"></div><br />
<!---Cuckoo Clock Competition ---><br />
<div style="width:965px; height:420px; "><br />
<div style="float:left; width:550px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
iGEM focuses on science, but also encompasses community outreach, communication, representation and last but not least, fun in the lab. All this is often communicated best with visual impressions. Several team wikis feature great photos, but some of them are hard to find. Therefore, we thought it would be best to bundle them and highlight the best ones to maximize impact. This is why we started an iGEM photo-contest: The Cuckoo Clock Competition. As the name implies, the first prize is an original Cuckoo Clock typical for the gorgeous Black Forest surrounding Freiburg. All teams are cordially invited to participate! <b>Please send your pictures</b> of choice representing your team, project, spirit or fun in the lab along with a short description to our e-mail address: &nbsp;&nbsp;&nbsp;<a href="mailto:igem.freiburg.2010@googlemail.com">igem.freiburg.2010@googlemail.com</a><br /><br />
Your pictures will be uploaded to the <a href=https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Cuckoo_Clock>competition webpage</a> as soon as we get them. In addition, we will send you a participation badge for your team wiki. A judging committee consisting of members from three different iGEM teams will vote for the winner picture. <br />
The team with the best picture will receive our amazing Cuckoo Clock in Boston at the socializing event on Sunday. So put your stressful projects aside for a few minutes and take the fun part!<br /><br />
Looking forward to meeting you in Boston. <br /><br /><br />
Cheers,<br /><br />
The iGEM team Freiburg 2010<br />
</div><br />
<div style="float:right; width:400px; height:auto; "><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Cuckoo_Clock" target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/30/Freiburg10_CCC.png" width="360px" /></a></div></div><br />
<div class="clearfix"></div><br />
<br />
<div class="box box_full"><br />
<center><h2>KIT-Kyoto</h2></center><br />
<div style="width:885px; height:350px;"><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
This picture shows "Kimwipes table tennis".<br> It is Scientific sports which only needs things existing in a laboratory. Therefore we can play it easily. This is the best diversion for scientists to take a rest, however, you must be careful about instruments on the table.<br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5530179561083828801%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCNSe4YGY6JjWDQ%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Tokyo_Metropolitan</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Six soldiers who guard our safety and peace in the labolatory<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/4/40/Freiburg10_CCC_Tokyo_Metropolitan.jpg" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Stockholm</h2></center><br />
<div style="width:885px; height:390px; "><br />
<div style="float:left; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Material: E-flask with unidentified liquid, one Flute (Pearl), big book, camera (Nikon), projector (Sony) and one Homo sapiens.<br><br><br />
Methods: Pictures were taken at evenly spaced angles and processed. A 5-fold increase in awesomeness was improved using Adobe Photoshop.<br><br><br />
Results: We have illustrated the free spirit of research at Stockholm University<br><br />
</div><br />
<br><br><br><br />
<div style=" width:880px; height:auto; "><center><img src="https://static.igem.org/mediawiki/2010/d/dc/Freiburg10_CCC_Stockholm.jpg" width="700" margin: 10px 10px 10px 10px/></center></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Davidson-MissouriW</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Standing tall for life, liberty and the pursuit of synthetic biology,<br><br />
We give our pipettes, our test tubes,<br><br />
Our huddled masses of bacteria yearning to breathe free,<br><br />
The wretched refuse of our teeming Petri dishes.<br><br />
We lift our lamps beside the golden door to the future.<br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/f/fc/Freiburg10_CCC_Davidson.jpeg<br />
" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Panama</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Picture 1 (Ernesto): Surprised in the Lab, a little bit of eyes.<br><br><br />
<br />
Picture 2 (Natasha & Ernesto): Team Panama is a great family but Natasha and Ernesto are the blood brothers of Team Panama... working in synthetic biology and in Hair cut!!!<br><br><br />
<br />
Picture 3 (Ernesto & Natasha): After a tedious DNA miniprep and a frustrating electrophoresis, the micropipete gun appears!!!<br><br><br />
<br />
Picture 4 (Carol & Nicole): I told you that I want to perform the DNA extraction!<br><br><br />
<br />
Picture 5 (This is it?) This is it?<br><br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532357684737013729%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJLGhvmglOeFmwE%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>LMU-Munich</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
The "ByeByeBiobricks"-Party: <br><br />
Find the pipette tips!<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/0/08/Freiburg10_CCC-LMU.jpg" width="340" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>UPO-Sevilla</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Don’t allow electrophoresis gel hogs the limelight!<br />
Transillumination camera is able to catch your best smile.<br />
Those pictures were taken in the middle of August, when we would love some vacations.<br />
Ps: Our Wet Lab Leader told us the transillumination camera secret.<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/3/38/Freiburg10_CCC_UPO-Sevilla.jpg" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Nevada</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Our long term goals are to develop plant biosensors that reliably measure changes in the local environment. In the process of developing biosensors, the 2010 Nevada iGEM Team need to develop fundamental promoters, reporters, and plasmids for plants. Therefore, the 2010 Nevada iGEM Team has three goals for this year’s competition. First, we are going to test the validity of utilizing Nicotiana tabacum (NT cells) as a model for the expression of higher plant genes for future iGEM competitions. NT cells are a faster, cheaper, and safer model than traditional plant transformation. These cells can therefore be utilized as a quick proof-of-concept test model before moving synthetic constructs into plants of interest. We also aim to produce an iGEM-compatible plant-specific plasmid, several stress-inducible plant promoters, reporter genes containing Kozak sequences (ribosome binding sites) and terminators that conform to BioBrick standards. Lastly, we hope to measure the induction of these stress promoters in real-time by performing a fluorometry assay in which stress will be applied to NT cells and fluorescent output by a reporter (GFP) will be measured to detail induction in real time. This method has a distinct advantage over microarrays since microarrays are only one ‘snapshot’ in time.<br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532529262339888081%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJWvnuGD6LDQnQE%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Korea_U_Seoul</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
First one which has 3 people.<br />
Tzu Chi university, where the workshop was held, is a Buddhist school.<br />
We had a vegetarian food there.<br />
We had a photo session at the end of the workshop,<br />
and there we took this one in memory of Buddhism.<br />
Can you feel the Buddha spirit?<br><br><br />
Second is all of our members who went to the workshop.<br />
We don't just gather to take a pictures.<br />
We follow concepts and orders.<br />
Do we look like real scientists?<br><br><br />
We took last one in lab.<br />
We are almost done with every thing and getting ready for Jamboree!<br />
We had to take a rest and there was not enough room for us to sit down...<br />
We sat on a chair one on one... and stacked ourselves...<br />
We are happy it's almost done, though! =)<br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532698106241505681%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJDTtNP2-6TufA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>TU Delft</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Photo 1: Nadine as Nerd @ Night of the Nerds - we wen't to an event called Night of the Nerds as a team, of course we couldn't just go normally, we had to look like a Nerd and this was the result.<br><br />
Photo 2: Eva's interpretation of the statue of Liberty: The statue of Sequencing, with a golden pipet, a crown of golden tubes and a banner of GATC<br><br />
Photo 3: Pieter accidentally added X-gal to his cultures which made them turn blue! (He was supposed to add IPTG to induce them... doh!)<br><br />
Photo 4: We take our project very seriously, which is why we didn't mind that Nadine (on of our team members) showed up with SuitSupply as our sponsor<br><br />
Photo 5: Hugo caught in the Lab! (doing what?)<br><br />
Photo 6: iJAM - Our team loves to play music which is why we occasionally did an iJAM, playing our favorite songs we were able to come much closer as a team<br><br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532702604232485921%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCLKPyb6Nnf6NEA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<br />
<center><h2>Bielefeld</h2></center><br />
<div style="width:885px; height:350px;"><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Photo1: Bielefeld_BioBricks:<br /><br />
Sometimes it was not fun to find the right construct within the bunch of BioBricks.<br /><br />
Photo2: Bielefeld_Musketiere:<br><br />
Our motto: "All for one, one for all" / Our weapons: the pipettes.<br><br />
</div><br />
<br />
<div style="float:left; width:440px; height:auto;"><br />
<embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532702604232485921%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCLKPyb6Nnf6NEA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed><br />
<!--<br />
<embed type="application/x-shockwave-flash" src="http://picasaweb.google.de/s/c/bin/slideshow.swf" width="440" height="320" lashvars="host=picasaweb.google.de&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.de%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532800850368683217%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCMrkoLfk-d_RQA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed><br />
--><br />
</div><br />
</div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Team/Cuckoo_ClockTeam:Freiburg Bioware/Team/Cuckoo Clock2010-10-28T03:26:33Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<html><br />
<div class="nh"></div><br />
<!---Cuckoo Clock Competition ---><br />
<div style="width:965px; height:420px; "><br />
<div style="float:left; width:550px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
iGEM focuses on science, but also encompasses community outreach, communication, representation and last but not least, fun in the lab. All this is often communicated best with visual impressions. Several team wikis feature great photos, but some of them are hard to find. Therefore, we thought it would be best to bundle them and highlight the best ones to maximize impact. This is why we started an iGEM photo-contest: The Cuckoo Clock Competition. As the name implies, the first prize is an original Cuckoo Clock typical for the gorgeous Black Forest surrounding Freiburg. All teams are cordially invited to participate! <b>Please send your pictures</b> of choice representing your team, project, spirit or fun in the lab along with a short description to our e-mail address: &nbsp;&nbsp;&nbsp;<a href="mailto:igem.freiburg.2010@googlemail.com">igem.freiburg.2010@googlemail.com</a><br /><br />
Your pictures will be uploaded to the <a href=https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Cuckoo_Clock>competition webpage</a> as soon as we get them. In addition, we will send you a participation badge for your team wiki. A judging committee consisting of members from three different iGEM teams will vote for the winner picture. <br />
The team with the best picture will receive our amazing Cuckoo Clock in Boston at the socializing event on Sunday. So put your stressful projects aside for a few minutes and take the fun part!<br /><br />
Looking forward to meeting you in Boston. <br /><br /><br />
Cheers,<br /><br />
The iGEM team Freiburg 2010<br />
</div><br />
<div style="float:right; width:400px; height:auto; "><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Cuckoo_Clock" target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/30/Freiburg10_CCC.png" width="360px" /></a></div></div><br />
<div class="clearfix"></div><br />
<br />
<div class="box box_full"><br />
<center><h2>KIT-Kyoto</h2></center><br />
<div style="width:885px; height:350px;"><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
This picture shows "Kimwipes table tennis".<br> It is Scientific sports which only needs things existing in a laboratory. Therefore we can play it easily. This is the best diversion for scientists to take a rest, however, you must be careful about instruments on the table.<br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5530179561083828801%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCNSe4YGY6JjWDQ%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Tokyo_Metropolitan</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Six soldiers who guard our safety and peace in the labolatory<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/4/40/Freiburg10_CCC_Tokyo_Metropolitan.jpg" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Stockholm</h2></center><br />
<div style="width:885px; height:390px; "><br />
<div style="float:left; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Material: E-flask with unidentified liquid, one Flute (Pearl), big book, camera (Nikon), projector (Sony) and one Homo sapiens.<br><br><br />
Methods: Pictures were taken at evenly spaced angles and processed. A 5-fold increase in awesomeness was improved using Adobe Photoshop.<br><br><br />
Results: We have illustrated the free spirit of research at Stockholm University<br><br />
</div><br />
<br><br><br><br />
<div style=" width:880px; height:auto; "><center><img src="https://static.igem.org/mediawiki/2010/d/dc/Freiburg10_CCC_Stockholm.jpg" width="700" margin: 10px 10px 10px 10px/></center></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Davidson-MissouriW</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Standing tall for life, liberty and the pursuit of synthetic biology,<br><br />
We give our pipettes, our test tubes,<br><br />
Our huddled masses of bacteria yearning to breathe free,<br><br />
The wretched refuse of our teeming Petri dishes.<br><br />
We lift our lamps beside the golden door to the future.<br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/f/fc/Freiburg10_CCC_Davidson.jpeg<br />
" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Panama</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Picture 1 (Ernesto): Surprised in the Lab, a little bit of eyes.<br><br><br />
<br />
Picture 2 (Natasha & Ernesto): Team Panama is a great family but Natasha and Ernesto are the blood brothers of Team Panama... working in synthetic biology and in Hair cut!!!<br><br><br />
<br />
Picture 3 (Ernesto & Natasha): After a tedious DNA miniprep and a frustrating electrophoresis, the micropipete gun appears!!!<br><br><br />
<br />
Picture 4 (Carol & Nicole): I told you that I want to perform the DNA extraction!<br><br><br />
<br />
Picture 5 (This is it?) This is it?<br><br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532357684737013729%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJLGhvmglOeFmwE%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>LMU-Munich</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
The "ByeByeBiobricks"-Party: <br><br />
Find the pipette tips!<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/0/08/Freiburg10_CCC-LMU.jpg" width="340" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>UPO-Sevilla</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Don’t allow electrophoresis gel hogs the limelight!<br />
Transillumination camera is able to catch your best smile.<br />
Those pictures were taken in the middle of August, when we would love some vacations.<br />
Ps: Our Wet Lab Leader told us the transillumination camera secret.<br />
</div><br />
<div style="float:left; width:440px; height:auto; "><img src="https://static.igem.org/mediawiki/2010/3/38/Freiburg10_CCC_UPO-Sevilla.jpg" width="440" margin: 10px 10px 10px 10px/></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Nevada</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Our long term goals are to develop plant biosensors that reliably measure changes in the local environment. In the process of developing biosensors, the 2010 Nevada iGEM Team need to develop fundamental promoters, reporters, and plasmids for plants. Therefore, the 2010 Nevada iGEM Team has three goals for this year’s competition. First, we are going to test the validity of utilizing Nicotiana tabacum (NT cells) as a model for the expression of higher plant genes for future iGEM competitions. NT cells are a faster, cheaper, and safer model than traditional plant transformation. These cells can therefore be utilized as a quick proof-of-concept test model before moving synthetic constructs into plants of interest. We also aim to produce an iGEM-compatible plant-specific plasmid, several stress-inducible plant promoters, reporter genes containing Kozak sequences (ribosome binding sites) and terminators that conform to BioBrick standards. Lastly, we hope to measure the induction of these stress promoters in real-time by performing a fluorometry assay in which stress will be applied to NT cells and fluorescent output by a reporter (GFP) will be measured to detail induction in real time. This method has a distinct advantage over microarrays since microarrays are only one ‘snapshot’ in time.<br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532529262339888081%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJWvnuGD6LDQnQE%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>Korea_U_Seoul</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
First one which has 3 people.<br />
Tzu Chi university, where the workshop was held, is a Buddhist school.<br />
We had a vegetarian food there.<br />
We had a photo session at the end of the workshop,<br />
and there we took this one in memory of Buddhism.<br />
Can you feel the Buddha spirit?<br><br><br />
Second is all of our members who went to the workshop.<br />
We don't just gather to take a pictures.<br />
We follow concepts and orders.<br />
Do we look like real scientists?<br><br><br />
We took last one in lab.<br />
We are almost done with every thing and getting ready for Jamboree!<br />
We had to take a rest and there was not enough room for us to sit down...<br />
We sat on a chair one on one... and stacked ourselves...<br />
We are happy it's almost done, though! =)<br><br />
</div><br />
<div style="float:left; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532698106241505681%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJDTtNP2-6TufA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<center><h2>TU Delft</h2></center><br />
<div style="width:885px; height:350px; "><br />
<div style="float:left; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Photo 1: Nadine as Nerd @ Night of the Nerds - we wen't to an event called Night of the Nerds as a team, of course we couldn't just go normally, we had to look like a Nerd and this was the result.<br><br />
Photo 2: Eva's interpretation of the statue of Liberty: The statue of Sequencing, with a golden pipet, a crown of golden tubes and a banner of GATC<br><br />
Photo 3: Pieter accidentally added X-gal to his cultures which made them turn blue! (He was supposed to add IPTG to induce them... doh!)<br><br />
Photo 4: We take our project very seriously, which is why we didn't mind that Nadine (on of our team members) showed up with SuitSupply as our sponsor<br><br />
Photo 5: Hugo caught in the Lab! (doing what?)<br><br />
Photo 6: iJAM - Our team loves to play music which is why we occasionally did an iJAM, playing our favorite songs we were able to come much closer as a team<br><br />
</div><br />
<div style="float:right; width:440px; height:auto; "><embed type="application/x-shockwave-flash" src="http://picasaweb.google.com/s/c/bin/slideshow.swf" width="440" height="320" flashvars="host=picasaweb.google.com&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532702604232485921%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCLKPyb6Nnf6NEA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed></div></div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
<div class="box box_full"><br />
<br />
<center><h2>Bielefeld</h2></center><br />
<div style="width:885px; height:350px;"><br />
<div style="float:right; width:430px; height:auto; margin: 0px 5px 0px 5px; text-align:justify;"><br />
Photo1: Bielefeld_BioBricks:<br /><br />
Sometimes it was not fun to find the right construct within the bunch of BioBricks.<br /><br />
Photo2: Bielefeld_Musketiere:<br><br />
Our motto: "All for one, one for all" / Our weapons: the pipettes.<br><br />
</div><br />
<br />
<div style="float:left; width:440px; height:auto;"><br />
<embed type="application/x-shockwave-flash" src="http://picasaweb.google.de/s/c/bin/slideshow.swf" width="440" height="320" lashvars="host=picasaweb.google.de&hl=de&feat=flashalbum&RGB=0x000000&feed=http%3A%2F%2Fpicasaweb.google.de%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5532800850368683217%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCMrkoLfk-d_RQA%26hl%3Dde" pluginspage="http://www.macromedia.com/go/getflashplayer"></embed><br />
</div><br />
</div><br />
<div class="clearfix"></div><br />
</div><br />
<br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/NoteBook/LabjournalTeam:Freiburg Bioware/NoteBook/Labjournal2010-10-28T03:17:07Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}<br />
{{:Team:Freiburg_Bioware/menu_notebook}}<br />
{{:Team:Freiburg_Bioware/jquery}}<br />
<br />
<html><br />
<br />
<div style="height: 850px; width: 964px; margin: 15px 15px 15px 15px;"><br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/March"><br />
<h2 style="margin-left: 5px;">March</h2><br />
<p class="boxes_labjournal_day">Labday 1</p><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/Freiburg_10_labjournal_march_v1.JPG" class="image_labjournal" title="Our project starts with first sequence analysis."/><br />
<p class="boxes_labjournal_text">...watching gene sequences...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/April"><br />
<h2 style="margin-left: 5px;">April</h2><br />
<p class="boxes_labjournal_day">Labday 2- 5</p><br />
<img src="https://static.igem.org/mediawiki/2010/f/fc/Freiburg_10_labjournal_april_v1.JPG" class="image_labjournal" title="Scanning for iGEM restriction sites: <br />
Vector plasmid; Thymidine kinase ;Cytosindeaminase" /><br />
<p class="boxes_labjournal_text">...ordering AAV-2 Helper-free System...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/May"><br />
<h2 style="margin-left: 5px;">May</h2><br />
<p class="boxes_labjournal_day">Labday 6- 17</p><br />
<img src="https://static.igem.org/mediawiki/2010/0/0f/Freiburg_10_labjournal_may_v1.JPG" class="image_labjournal" title="We took a closer look to the theoretical DNA- and amino acid sequence of the ITRs, questioned the role of the β-globin intron, had a closer look to the CMV promoter and performed our first cloning attempt." /><br />
<p class="boxes_labjournal_text">...theoretical cloning...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/June"><br />
<h2 style="margin-left: 5px;">June</h2><br />
<p class="boxes_labjournal_day">Labday 18- 45</p><br />
<img src="https://static.igem.org/mediawiki/2010/3/37/Freiburg_10_labjournal_june_v1.jpg" class="image_labjournal" title="<br />
We conducted our first site-directed mutagenesis. First cell culture steps: Splitting and seeding of AAV 293 and HT1080 cells; Calcium phosphate transfection; Transduction with virus particles containing YFP encoding sequence; Microscopy: Fluorescent transduced HT1080 cells. We planned to determine infectious virus titer via quantitative real-time PCR. For this purpose primers were designed, transduced HT1080 cells were harvested and prepared. Theoretical studies of the AAV structure: Impressions" /><br />
<p class="boxes_labjournal_text">...first transduced cells...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/July"><br />
<h2 style="margin-left: 5px;">July</h2><br />
<p class="boxes_labjournal_day">Labday 46- 75</p><br />
<img src="https://static.igem.org/mediawiki/2010/8/8d/Freiburg_10_labjournal_july_v1.JPG" class="image_labjournal" title="We developed a plan for modifying the surface exposed loops of the virus capsid.<br />
For this purpose not only 5 iGEM restriction sites, but also the so called ViralBrick restriction sites located in the Rep/Cap sequence needed to be deleted: BamHI, SalI. BioBrick production of the inverted terminal repeats (ITRs) turned out to be difficult. Therefore the alternative “ITR fancy method” was developed. We successfully produced AAV2 left and right ITR fused to the RFC10 prefix. Further on we received first quantitative transduction results via flow cytometry. mGMK_TK30 was successfully cloned into the vector plasmid." /><br />
<p class="boxes_labjournal_text">...organizing the lab...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August"><br />
<h2 style="margin-left: 5px;">August I</h2><br />
<p class="boxes_labjournal_day">Labday 76- 92</p><br />
<img src="https://static.igem.org/mediawiki/2010/8/8b/Freiburg_10_labjournal_august1_v1.JPG" class="image_labjournal" /><br />
<p class="boxes_labjournal_text">...cloning parts...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/August2"><br />
<h2 style="margin-left: 5px;">August II</h2><br />
<p class="boxes_labjournal_day">Labday 93- 106</p><br />
<img src="https://static.igem.org/mediawiki/2010/e/ec/Freiburg_10_labjournal_august2_v1.png" class="image_labjournal" /><br />
<p class="boxes_labjournal_text">...assembled vector plasmid is working...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September"><br />
<h2 style="margin-left: 5px;">September I</h2><br />
<p class="boxes_labjournal_day">Labday 107- 123</p><br />
<img src="https://static.igem.org/mediawiki/2010/2/25/Freiburg_10_labjournal_september1_v1.JPG" class="image_labjournal" /><br />
<p class="boxes_labjournal_text">...simply producing BioBricks...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/September2"><br />
<h2 style="margin-left: 5px;">September II</h2><br />
<p class="boxes_labjournal_day">Labday 124- 135</p><br />
<img src="https://static.igem.org/mediawiki/2010/1/18/Freiburg_10_labjournal_october2_v1.JPG" class="image_labjournal" /><br />
<p class="boxes_labjournal_text">...21x mutated RepCap is working...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October"><br />
<h2 style="margin-left: 5px;">October I</h2><br />
<p class="boxes_labjournal_day">Labday 136- 149</p><br />
<img src="https://static.igem.org/mediawiki/2010/e/e0/Freiburg_10_labjournal_october_v1.JPG" class="image_labjournal" /><br />
<p class="boxes_labjournal_text">...testing BioBricks by virus production...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/October2"><br />
<h2 style="margin-left: 5px;">October II</h2><br />
<p class="boxes_labjournal_day">Labday 150- 166</p><br />
<img src="https://static.igem.org/mediawiki/2010/2/22/Freiburg10_Oktober.png" class="image_labjournal" /><br />
<p class="boxes_labjournal_text">...Capsid modification works...</p><br />
</a><br />
</div><br />
<br />
<div class="box_labjournal_195"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal/November"><br />
<h2 style="margin-left: 5px;">November</h2><br />
<p class="boxes_labjournal_day">Labday 166- 170</p><br />
<img src="https://static.igem.org/mediawiki/2010/9/93/Freiburg10_November.png" class="image_labjournal" /><br />
<p class="boxes_labjournal_text">...Jamboree!!!...</p><br />
</a><br />
</div><br />
<br />
</div><br />
<br />
</html><br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_KitTeam:Freiburg Bioware/Project/Virus Construction Kit2010-10-28T03:13:56Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h2>Virus Construction Kit - The Manual</h2><br />
<p style="text-align: justify;"><br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf"><br />
<img class="right" style="margin: 15px 15px 15px 15px; width: 150px; height: auto;" src="https://static.igem.org/mediawiki/2010/b/b2/Freiburg10_Manual-Logo.png" /></a><br />
We created a universal and modular toolkit for the production of therapeutic AAV vectors. Using our provided Bio- and ViralBricks, scientists can easily and with little cloning effort create their own viral vectors, individually tailored to target different tumor cell lines and to express a suitable gene of interest. <br><br />
Because our kit is designed to save time and effort in applied therapeutic studies, we created a comprehensive manual, containing background information about AAV biology, different strategies for targeting, purification and 'arming' of the virus particles, as well as practical instructions and protocols for virus production. Using our manual makes it unnecessary to search through hundreds of research papers before being able to actually start your research!<br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf">-> iGEM Wiki version: Virus Construction Kit - The Manual </a><br />
<br /><br />
<a href="http://www.molbiotech.uni-freiburg.de/iGEM/Manual_-_Virus_Construction_Kit.pdf">-> Newest version: Virus Construction Kit - The Manual (External link to molbiotech.uni-freiburg.de)</a><br />
</p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_KitTeam:Freiburg Bioware/Project/Virus Construction Kit2010-10-28T03:13:06Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h2>Virus Construction Kit - The Manual</h2><br />
<p style="text-align: justify;"><br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf"><br />
<img class="right" style="margin: 15px 15px 15px 15px; width: 150px; height: auto;" src="https://static.igem.org/mediawiki/2010/b/b2/Freiburg10_Manual-Logo.png" /></a><br />
We created a universal and modular toolkit for the production of therapeutic AAV vectors. Using our provided Bio- and ViralBricks, scientists can easily and with little cloning effort create their own viral vectors, individually tailored to target different tumor cell lines and to express a suitable gene of interest. <br><br />
Because our kit is designed to save time and effort in applied therapeutic studies, we created a comprehensive manual, containing background information about AAV biology, different strategies for targeting, purification and 'arming' of the virus particles, as well as practical instructions and protocols for virus production. Using our manual makes it unnecessary to search through hundreds of research papers before being able to actually start your research!<br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf">-> iGEM Wiki version: Virus Construction Kit - The Manual </a><br />
<br /><br />
<a href="www.molbiotech.uni-freiburg.de/iGEM/Manual_-_Virus_Construction_Kit.pdf">-> Newest version: Virus Construction Kit - The Manual (External link to molbiotech.uni-freiburg.de)</a><br />
</p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_KitTeam:Freiburg Bioware/Project/Virus Construction Kit2010-10-28T03:12:31Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h2>Virus Construction Kit - The Manual</h2><br />
<p style="text-align: justify;"><br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf"><br />
<img class="right" style="margin: 15px 15px 15px 15px; width: 150px; height: auto;" src="https://static.igem.org/mediawiki/2010/b/b2/Freiburg10_Manual-Logo.png" /></a><br />
We created a universal and modular toolkit for the production of therapeutic AAV vectors. Using our provided Bio- and ViralBricks, scientists can easily and with little cloning effort create their own viral vectors, individually tailored to target different tumor cell lines and to express a suitable gene of interest. <br><br />
Because our kit is designed to save time and effort in applied therapeutic studies, we created a comprehensive manual, containing background information about AAV biology, different strategies for targeting, purification and 'arming' of the virus particles, as well as practical instructions and protocols for virus production. Using our manual makes it unnecessary to search through hundreds of research papers before being able to actually start your research!<br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf">-> Wiki version Virus: Construction Kit - The Manual </a><br />
<br /><br />
<a href="www.molbiotech.uni-freiburg.de/iGEM/Manual_-_Virus_Construction_Kit.pdf">-> Newest version: Virus Construction Kit - The Manual (External link to molbiotech.uni-freiburg.de)</a><br />
</p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_KitTeam:Freiburg Bioware/Project/Virus Construction Kit2010-10-28T03:11:48Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h2>Virus Construction Kit - The Manual</h2><br />
<p style="text-align: justify;"><br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf"><br />
<img class="right" style="margin: 15px 15px 15px 15px; width: 150px; height: auto;" src="https://static.igem.org/mediawiki/2010/b/b2/Freiburg10_Manual-Logo.png" /></a><br />
We created a universal and modular toolkit for the production of therapeutic AAV vectors. Using our provided Bio- and ViralBricks, scientists can easily and with little cloning effort create their own viral vectors, individually tailored to target different tumor cell lines and to express a suitable gene of interest. <br><br />
Because our kit is designed to save time and effort in applied therapeutic studies, we created a comprehensive manual, containing background information about AAV biology, different strategies for targeting, purification and 'arming' of the virus particles, as well as practical instructions and protocols for virus production. Using our manual makes it unnecessary to search through hundreds of research papers before being able to actually start your research!<br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf">-> Download Virus Construction Kit - The Manual </a><br />
<br /><br />
<a href="www.molbiotech.uni-freiburg.de/iGEM/Manual_-_Virus_Construction_Kit.pdf">-> Newest version: Virus Construction Kit - The Manual (External link to molbiotech.uni-freiburg.de)</a><br />
</p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_KitTeam:Freiburg Bioware/Project/Virus Construction Kit2010-10-28T03:11:07Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h2>Virus Construction Kit - The Manual</h2><br />
<p style="text-align: justify;"><br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf"><br />
<img class="right" style="margin: 15px 15px 15px 15px; width: 150px; height: auto;" src="https://static.igem.org/mediawiki/2010/b/b2/Freiburg10_Manual-Logo.png" /></a><br />
We created a universal and modular toolkit for the production of therapeutic AAV vectors. Using our provided Bio- and ViralBricks, scientists can easily and with little cloning effort create their own viral vectors, individually tailored to target different tumor cell lines and to express a suitable gene of interest. <br><br />
Because our kit is designed to save time and effort in applied therapeutic studies, we created a comprehensive manual, containing background information about AAV biology, different strategies for targeting, purification and 'arming' of the virus particles, as well as practical instructions and protocols for virus production. Using our manual makes it unnecessary to search through hundreds of research papers before being able to actually start your research!<br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf">-> Download Virus Construction Kit - The Manual </a><br />
<br /><br />
<a href="www.molbiotech.uni-freiburg.de/iGEM/Manual_-_Virus_Construction_Kit.pdf">-> Newest download: Virus Construction Kit - The Manual (External link to molbiotech.uni-freiburg.de)</a><br />
</p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_KitTeam:Freiburg Bioware/Project/Virus Construction Kit2010-10-28T03:10:06Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h2>Virus Construction Kit - The Manual</h2><br />
<p style="text-align: justify;"><br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf"><br />
<img class="right" style="margin: 15px 15px 15px 15px; width: 150px; height: auto;" src="https://static.igem.org/mediawiki/2010/b/b2/Freiburg10_Manual-Logo.png" /></a><br />
We created a universal and modular toolkit for the production of therapeutic AAV vectors. Using our provided Bio- and ViralBricks, scientists can easily and with little cloning effort create their own viral vectors, individually tailored to target different tumor cell lines and to express a suitable gene of interest. <br><br />
Because our kit is designed to save time and effort in applied therapeutic studies, we created a comprehensive manual, containing background information about AAV biology, different strategies for targeting, purification and 'arming' of the virus particles, as well as practical instructions and protocols for virus production. Using our manual makes it unnecessary to search through hundreds of research papers before being able to actually start your research!<br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf">Download Virus Construction Kit - The Manual </a><br />
<a href="www.molbiotech.uni-freiburg.de/iGEM/Manual_-_Virus_Construction_Kit.pdf">Newest Download Virus Construction Kit - The Manual (External link to molbiotech.uni-freiburg.de)</a><br />
</p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_KitTeam:Freiburg Bioware/Project/Virus Construction Kit2010-10-28T03:01:28Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h2>Virus Construction Kit - The Manual</h2><br />
<p style="text-align: justify;"><br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf"><br />
<img class="right" style="margin: 15px 15px 15px 15px; width: 150px; height: auto;" src="https://static.igem.org/mediawiki/2010/b/b2/Freiburg10_Manual-Logo.png" /></a><br />
We created a universal and modular toolkit for the production of therapeutic AAV vectors. Using our provided Bio- and ViralBricks, scientists can easily and with little cloning effort create their own viral vectors, individually tailored to target different tumor cell lines and to express a suitable gene of interest. <br><br />
Because our kit is designed to save time and effort in applied therapeutic studies, we created a comprehensive manual, containing background information about AAV biology, different strategies for targeting, purification and 'arming' of the virus particles, as well as practical instructions and protocols for virus production. Using our manual makes it unnecessary to search through hundreds of research papers before being able to actually start your research!<br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf">Download Virus Construction Kit - The Manual </a><br />
</p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_KitTeam:Freiburg Bioware/Project/Virus Construction Kit2010-10-28T02:59:25Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h2>Virus Construction Kit - The Manual</h2><br />
<p style="text-align: justify;"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><br />
<img class="right" style="margin: 15px 15px 15px 15px; width: 200px; height: auto;" src="https://static.igem.org/mediawiki/2010/b/b2/Freiburg10_Manual-Logo.png" /></a><br />
We created a universal and modular toolkit for the production of therapeutic AAV vectors. Using our provided Bio- and ViralBricks, scientists can easily and with little cloning effort create their own viral vectors, individually tailored to target different tumor cell lines and to express a suitable gene of interest. <br><br />
Because our kit is designed to save time and effort in applied therapeutic studies, we created a comprehensive manual, containing background information about AAV biology, different strategies for targeting, purification and 'arming' of the virus particles, as well as practical instructions and protocols for virus production. Using our manual makes it unnecessary to search through hundreds of research papers before being able to actually start your research!<br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf">Download Virus Construction Kit - The Manual </a><br />
</p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_KitTeam:Freiburg Bioware/Project/Virus Construction Kit2010-10-28T02:57:49Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h2>Virus Construction Kit - The Manual</h2><br />
<p style="text-align: justify;"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/b/b2/Freiburg10_Manual-Logo.png" /></a><br />
We created a universal and modular toolkit for the production of therapeutic AAV vectors. Using our provided Bio- and ViralBricks, scientists can easily and with little cloning effort create their own viral vectors, individually tailored to target different tumor cell lines and to express a suitable gene of interest. <br><br />
Because our kit is designed to save time and effort in applied therapeutic studies, we created a comprehensive manual, containing background information about AAV biology, different strategies for targeting, purification and 'arming' of the virus particles, as well as practical instructions and protocols for virus production. Using our manual makes it unnecessary to search through hundreds of research papers before being able to actually start your research!<br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf">Download Virus Construction Kit - The Manual </a><br />
</p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_KitTeam:Freiburg Bioware/Project/Virus Construction Kit2010-10-28T02:52:06Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h2>Virus Construction Kit - The Manual</h2><br />
<p style="text-align: justify;"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/f/fb/Freiburg10_Manual_Logo_small.png" /></a><br />
We created a universal and modular toolkit for the production of therapeutic AAV vectors. Using our provided Bio- and ViralBricks, scientists can easily and with little cloning effort create their own viral vectors, individually tailored to target different tumor cell lines and to express a suitable gene of interest. <br><br />
Because our kit is designed to save time and effort in applied therapeutic studies, we created a comprehensive manual, containing background information about AAV biology, different strategies for targeting, purification and 'arming' of the virus particles, as well as practical instructions and protocols for virus production. Using our manual makes it unnecessary to search through hundreds of research papers before being able to actually start your research!<br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/12/Manual_-_Virus_Construction_Kit.pdf">Download Virus Construction Kit - The Manual </a><br />
</p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Software/headTeam:Freiburg Software/head2010-10-28T00:15:04Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/css}}<br />
{{:Team:Freiburg_Software/css_head}}<br />
<br />
<html><br />
<br />
<!-- Banner --><br />
<br />
<div id="banner"></div><br />
<br />
<!-- Menu --><br />
<!-- Menu top --><br />
<div id="menu_top"><br />
<div class="menu_button_top" id="home"><a href="https://2010.igem.org/Team:Freiburg_Software">Home</a></div><br />
<div class="menu_button_top" id="notebook"><a href="https://2010.igem.org/Team:Freiburg_Software/Notebook">Notebook</a></div><br />
<div class="menu_button_top" id="meetings"><a href="https://2010.igem.org/Team:Freiburg_Software/Meetings">Meetings</a></div><br />
</div><br />
<br />
<!-- Menu left --><br />
<div id="menu_left"><br />
<div class="menu_button_left" id="team"><a href="https://2010.igem.org/Team:Freiburg_Software/Team">Team</a></div><br />
<div class="menu_button_left_sub" id="subTeam2010"><a href="https://2010.igem.org/Team:Freiburg_Software/Team/2010">2010</a></div><br />
<div class="menu_button_left_sub" id="subTeamPic"><a href="https://2010.igem.org/Team:Freiburg_Software/Team/Photos">Photos</a></div><br />
<div class="menu_button_left_sub" id="subTeamCol"><a href="https://2010.igem.org/Team:Freiburg_Software/Team/Collaboration">Collaboration</a></div><br />
<br />
<div class="menu_button_left" id="project"><a href="https://2010.igem.org/Team:Freiburg_Software/Project">Project</a></div><br />
<div class="menu_button_left_sub" id="subProjectProspect"><a href="https://2010.igem.org/Team:Freiburg_Software/Project/Prospect">Prospect</a></div><br />
<div class="menu_button_left_sub" id="subProjectHistory"><a href="https://2010.igem.org/Team:Freiburg_Software/Project/History">History</a></div><br />
<br />
<div class="menu_button_left" id="user"><a href="https://2010.igem.org/Team:Freiburg_Software/User">User</a></div><br />
<div class="menu_button_left_sub" id="subUserGuide"><a href="https://2010.igem.org/Team:Freiburg_Software/User/Guide">User Guide</a></div><br />
<div class="menu_button_left_sub" id="subUserRobot"><a href="https://2010.igem.org/Team:Freiburg_Software/User/Robots">The Robots</a></div><br />
<br />
<div class="menu_button_left" id="developer"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer">Developer</a></div><br />
<div class="menu_button_left_sub" id="subDeveloperGuide"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer/Guide">Guide</a></div><br />
<div class="menu_button_left_sub" id="subDeveloperTech"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer/Technologies">Technologies</a></div><br />
<div class="menu_button_left_sub" id="subDeveloperArch"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer/Architecture">Architecture</a></div><br />
<div class="menu_button_left_sub" id="subDeveloperAvai"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer/Availability">Availability</a></div><br />
<!--<br />
<div class="menu_button_left_sub" id="subDeveloper"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer/Technologies">something</a></div><br />
--><br />
<br />
<div class="menu_button_left" id="human"><a href="https://2010.igem.org/Team:Freiburg_Software/HumanPractise">Human Practice</a></div><br />
<br />
<div id="world_map"><br />
<a href="http://www2.clustrmaps.com/counter/maps.php?url=https://2010.igem.org/wiki/index.php?title=Team:Freiburg_Software" id="clustrMapsLink"><img src="http://www2.clustrmaps.com/counter/index2.php?url=https://2010.igem.org/wiki/index.php?title=Team:Freiburg_Software" style="border:0px;" alt="Locations of visitors to this page" title="Locations of visitors to this page" id="clustrMapsImg" onerror="this.onerror=null; this.src='http://clustrmaps.com/images/clustrmaps-back-soon.jpg'; document.getElementById('clustrMapsLink').href='http://clustrmaps.com';" /></a><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/headTeam:Freiburg Software/head2010-10-28T00:12:54Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/css}}<br />
{{:Team:Freiburg_Software/css_head}}<br />
<br />
<html><br />
<br />
<!-- Banner --><br />
<br />
<div id="banner"></div><br />
<br />
<!-- Menu --><br />
<!-- Menu top --><br />
<div id="menu_top"><br />
<div class="menu_button_top" id="home"><a href="https://2010.igem.org/Team:Freiburg_Software">Home</a></div><br />
<div class="menu_button_top" id="notebook"><a href="https://2010.igem.org/Team:Freiburg_Software/Notebook">Notebook</a></div><br />
<div class="menu_button_top" id="meetings"><a href="https://2010.igem.org/Team:Freiburg_Software/Meetings">Meetings</a></div><br />
</div><br />
<br />
<!-- Menu left --><br />
<div id="menu_left"><br />
<div class="menu_button_left" id="team"><a href="https://2010.igem.org/Team:Freiburg_Software/Team">Team</a></div><br />
<div class="menu_button_left_sub" id="subTeam2010"><a href="https://2010.igem.org/Team:Freiburg_Software/Team/2010">2010</a></div><br />
<div class="menu_button_left_sub" id="subTeamPic"><a href="https://2010.igem.org/Team:Freiburg_Software/Team/Photos">Photos</a></div><br />
<div class="menu_button_left_sub" id="subTeamCol"><a href="https://2010.igem.org/Team:Freiburg_Software/Team/Collaboration">Collaboration</a></div><br />
<br />
<div class="menu_button_left" id="project"><a href="https://2010.igem.org/Team:Freiburg_Software/Project">Project</a></div><br />
<div class="menu_button_left_sub" id="subProjectProspect"><a href="https://2010.igem.org/Team:Freiburg_Software/Project/Prospect">Prospect</a></div><br />
<div class="menu_button_left_sub" id="subProjectHistory"><a href="https://2010.igem.org/Team:Freiburg_Software/Project/History">History</a></div><br />
<br />
<div class="menu_button_left" id="user"><a href="https://2010.igem.org/Team:Freiburg_Software/User">User</a></div><br />
<div class="menu_button_left_sub" id="subUserGuide"><a href="https://2010.igem.org/Team:Freiburg_Software/User/Guide">User Guide</a></div><br />
<div class="menu_button_left_sub" id="subUserRobot"><a href="https://2010.igem.org/Team:Freiburg_Software/User/Robots">The Robots</a></div><br />
<br />
<div class="menu_button_left" id="developer"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer">Developer</a></div><br />
<div class="menu_button_left_sub" id="subDeveloperGuide"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer/Guide">Guide</a></div><br />
<div class="menu_button_left_sub" id="subDeveloperTech"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer/Technologies">Technologies</a></div><br />
<div class="menu_button_left_sub" id="subDeveloperArch"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer/Architecture">Architecture</a></div><br />
<div class="menu_button_left_sub" id="subDeveloperAvai"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer/Availability">Availability</a></div><br />
<!--<br />
<div class="menu_button_left_sub" id="subDeveloper"><a href="https://2010.igem.org/Team:Freiburg_Software/Developer/Technologies">something</a></div><br />
--><br />
<br />
<div class="menu_button_left" id="human"><a href="https://2010.igem.org/Team:Freiburg_Software/HumanPractice">Human Practise</a></div><br />
<br />
<div id="world_map"><br />
<a href="http://www2.clustrmaps.com/counter/maps.php?url=https://2010.igem.org/wiki/index.php?title=Team:Freiburg_Software" id="clustrMapsLink"><img src="http://www2.clustrmaps.com/counter/index2.php?url=https://2010.igem.org/wiki/index.php?title=Team:Freiburg_Software" style="border:0px;" alt="Locations of visitors to this page" title="Locations of visitors to this page" id="clustrMapsImg" onerror="this.onerror=null; this.src='http://clustrmaps.com/images/clustrmaps-back-soon.jpg'; document.getElementById('clustrMapsLink').href='http://clustrmaps.com';" /></a><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/Team/2010Team:Freiburg Software/Team/20102010-10-27T23:21:00Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/head}}<br />
<br />
<html><br />
<!-- page special style --><br />
<br />
<style type="text/css"><br />
<br />
#subTeam2010 a {<br />
opacity: 0.92;<br />
color: white;<br />
}<br />
<br />
</style><br />
<br />
<div id=main_area><br />
<h1>Team 2010</h1><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a0/Freiburg_software_10_Niklas.jpg" alt="niklas" title="Niklas" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Niklas Meinzer</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Computer science (Bioinformatics)</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Create Robots, developing library</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i> You are a "Emmi"-coffee junkie ;) . Had a lot of fun with him in<br />front of our laptops (and I like your music, hehe).<br />
<i>Paresh: </i> My first contact point for doubts about <br />German culture (and sometimes history ;) ).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/27/Freiburg_software_10_Paresh.jpg" alt="paresh" title="Paresh" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Paresh Paradkar</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Computer science</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Create Robots</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i>He sure is a funny guy!<br />Thanks for helping to improve my English skills.<br /><br />
<i>Niklas: </i>Shares my love for the Big Bang Theory</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/9/9b/Freiburg_software_10_Fabian.jpg" alt="fabian" title="Fabian" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Fabian Haas</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Biology</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Wiki, Graphics, Organisation</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Niklas:</i> Will probably spend less time on his diploma thesis, than he spent on our logo.<br /><br />
<i>Paresh:</i> He is very helpful and equally cheerful,<br />Has always a smiling face :).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b3/Freiburg_software_10_Joerg.jpg" alt="joerg" title="Jörg" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Jörg Walossek</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Biology, Bioinformatics</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>API-Programming, Bug-hunter</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Niklas: </i>My fellow bug hunter....<br /><br />
<i>Fabian: </i>Jörg, nicht schneutzen, sonst platzt der Bär!!!<br />(Jörg, don't sniff, otherwise the bear will explode!!!)</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2c/Freiburg_software_10_Paul.jpg" alt="paul" title="Paul" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Paul Staab</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Mathematics</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>API-Programming</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i>Strait forward.<br /><br />
<i>Jörg: </i>Expert for writing wiki text.</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<hr class="line_300" /><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Freiburg_software_10_Kristian.jpg" alt="kristian" title="Kristian" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Kristian Müller</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Biology Dr.</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Administration</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i>Always there for us!</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/Freiburg_software_10_katja.jpg" alt="katja" title="Katja" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Katja Arndt</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Biology Prof.</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Administration</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td></td><br />
</tr><br />
</table><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/Team/2010Team:Freiburg Software/Team/20102010-10-27T23:15:42Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/head}}<br />
<br />
<html><br />
<!-- page special style --><br />
<br />
<style type="text/css"><br />
<br />
#subTeam2010 a {<br />
opacity: 0.92;<br />
color: white;<br />
}<br />
<br />
</style><br />
<br />
<div id=main_area><br />
<h1>Team 2010</h1><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a0/Freiburg_software_10_Niklas.jpg" alt="niklas" title="Niklas" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Niklas Meinzer</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Computer science (Bioinformatics)</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Create Robots, developing library</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i> You are a "Emmi"-coffee junkie ;) . Had a lot of fun with him in<br />front of our laptops (and I like your music, hehe).<br />
<i>Paresh: </i> My first contact point for doubts about <br />German culture (and sometimes history ;) ).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/27/Freiburg_software_10_Paresh.jpg" alt="paresh" title="Paresh" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Paresh Paradkar</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Computer science</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Create Robots</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i>He sure is a funny guy!<br />Thanks for helping to improve my English skills.<br /><br />
<i>Niklas: </i>Shares my love for the Big Bang Theory</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/9/9b/Freiburg_software_10_Fabian.jpg" alt="fabian" title="Fabian" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Fabian Haas</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Biology</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Wiki, Graphics, Organisation</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Niklas:</i> Will probably spend less time on his diploma thesis, than he spent on our logo.<br /><br />
<i>Paresh:</i> He is very helpful and equally cheerful,<br />Has always a smiling face :).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b3/Freiburg_software_10_Joerg.jpg" alt="joerg" title="Jörg" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Jörg Walossek</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Biology, Bioinformatics</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>API-Programming, Bug-hunter</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Niklas: </i>My fellow bug hunter....<br /><br />
<i>Fabian: </i>Jörg, nicht schneutzen, sonst platzt der Bär!!!<br />(Jörg, don't sniff, otherwise the bear will explode!!!)</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2c/Freiburg_software_10_Paul.jpg" alt="paul" title="Paul" class="team_portrait" /><br />
<br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Paul Staab</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Mathematics</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>API-Programming</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i>Strait forward.<br /><br />
<i>Jörg: </i>Expert for writing wiki text.</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<hr class="line_300" /><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Freiburg_software_10_Kristian.jpg" alt="kristian" title="Kristian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Kristian Müller<br /><br />
<span class="team_bolder">Field of study:</span> Biology Dr.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/Freiburg_software_10_katja.jpg" alt="katja" title="Katja" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Katja Arndt<br /><br />
<span class="team_bolder">Field of study:</span> Biology Prof.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/Team/2010Team:Freiburg Software/Team/20102010-10-27T23:09:28Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/head}}<br />
<br />
<html><br />
<!-- page special style --><br />
<br />
<style type="text/css"><br />
<br />
#subTeam2010 a {<br />
opacity: 0.92;<br />
color: white;<br />
}<br />
<br />
</style><br />
<br />
<div id=main_area><br />
<h1>Team 2010</h1><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a0/Freiburg_software_10_Niklas.jpg" alt="niklas" title="Niklas" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Niklas Meinzer</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Computer science (Bioinformatics)</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Create Robots, developing library</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i> You are a "Emmi"-coffee junkie ;) . Had a lot of fun with him in<br />front of our laptops (and I like your music, hehe).<br />
<i>Paresh: </i> My first contact point for doubts about <br />German culture (and sometimes history ;) ).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/27/Freiburg_software_10_Paresh.jpg" alt="paresh" title="Paresh" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Paresh Paradkar</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Computer science</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Create Robots</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i>He sure is a funny guy!<br />Thanks for helping to improve my English skills.<br /><br />
<i>Niklas: </i>Shares my love for the Big Bang Theory</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/9/9b/Freiburg_software_10_Fabian.jpg" alt="fabian" title="Fabian" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Fabian Haas</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Biology</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Wiki, Graphics, Organisation</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Niklas:</i> Will probably spend less time on his diploma thesis, than he spent on our logo.<br /><br />
<i>Paresh:</i> He is very helpful and equally cheerful,<br />Has always a smiling face :).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b3/Freiburg_software_10_Joerg.jpg" alt="joerg" title="Jörg" class="team_portrait" /><br />
<br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Jörg Walossek</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Biology, Bioinformatics</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>API-Programming, Bug-hunter</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Niklas: </i>My fellow bug hunter....<br /><br />
<i>Fabian: </i>Jörg, nicht schneutzen, sonst platzt der Bär!!!<br />(Jörg, don't sniff, otherwise the bear will explode!!!)</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2c/Freiburg_software_10_Paul.jpg" alt="paul" title="Paul" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Paul Staab<br /><br />
<span class="team_bolder">Field of study:</span> Mathematics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<br />
<hr class="line_300" /><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Freiburg_software_10_Kristian.jpg" alt="kristian" title="Kristian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Kristian Müller<br /><br />
<span class="team_bolder">Field of study:</span> Biology Dr.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/Freiburg_software_10_katja.jpg" alt="katja" title="Katja" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Katja Arndt<br /><br />
<span class="team_bolder">Field of study:</span> Biology Prof.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/Team/2010Team:Freiburg Software/Team/20102010-10-27T23:06:59Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/head}}<br />
<br />
<html><br />
<!-- page special style --><br />
<br />
<style type="text/css"><br />
<br />
#subTeam2010 a {<br />
opacity: 0.92;<br />
color: white;<br />
}<br />
<br />
</style><br />
<br />
<div id=main_area><br />
<h1>Team 2010</h1><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a0/Freiburg_software_10_Niklas.jpg" alt="niklas" title="Niklas" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Niklas Meinzer</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Computer science (Bioinformatics)</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Create Robots, developing library</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i> You are a "Emmi"-coffee junkie ;) . Had a lot of fun with him in<br />front of our laptops (and I like your music, hehe).<br />
<i>Paresh: </i> My first contact point for doubts about <br />German culture (and sometimes history ;) ).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/27/Freiburg_software_10_Paresh.jpg" alt="paresh" title="Paresh" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Paresh Paradkar</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Computer science</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Create Robots</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Fabian: </i>He sure is a funny guy!<br />Thanks for helping to improve my English skills.<br /><br />
<i>Niklas: </i>Shares my love for the Big Bang Theory</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/9/9b/Freiburg_software_10_Fabian.jpg" alt="fabian" title="Fabian" class="team_portrait" /><br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><td>Fabian Haas</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><td>Biology</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><td>Wiki, Graphics, Organisation</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><td><i>Niklas:</i> Will probably spend less time on his diploma thesis,<br />than he spent on our logo.<br /><br />
<i>Paresh:</i> He is very helpful and equally cheerful,<br />Has always a smiling face :).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b3/Freiburg_software_10_Joerg.jpg" alt="joerg" title="Jörg" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Jörg Walossek<br /><br />
<span class="team_bolder">Field of study:</span> Biology, Bioinformatics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming, Bug-hunter<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas: </i>My fellow bug hunter....<br /><br />
<i>Fabian: </i>Jörg, nicht schneutzen, sonst platzt der Bär!!!<br />(Jörg, don't sniff, otherwise the bear will explode!!!)<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2c/Freiburg_software_10_Paul.jpg" alt="paul" title="Paul" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Paul Staab<br /><br />
<span class="team_bolder">Field of study:</span> Mathematics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<br />
<hr class="line_300" /><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Freiburg_software_10_Kristian.jpg" alt="kristian" title="Kristian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Kristian Müller<br /><br />
<span class="team_bolder">Field of study:</span> Biology Dr.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/Freiburg_software_10_katja.jpg" alt="katja" title="Katja" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Katja Arndt<br /><br />
<span class="team_bolder">Field of study:</span> Biology Prof.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/Team/2010Team:Freiburg Software/Team/20102010-10-27T23:06:22Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/head}}<br />
<br />
<html><br />
<!-- page special style --><br />
<br />
<style type="text/css"><br />
<br />
#subTeam2010 a {<br />
opacity: 0.92;<br />
color: white;<br />
}<br />
<br />
</style><br />
<br />
<div id=main_area><br />
<h1>Team 2010</h1><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a0/Freiburg_software_10_Niklas.jpg" alt="niklas" title="Niklas" class="team_portrait" /><br />
<br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><br />
<td>Niklas Meinzer</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><br />
<td>Computer Science (Bioinformatics)</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Project Contributions:</td><br />
<td>Developed the following robots: Alignment robot, BLAST robot, Primer Designer<br /><br />
Developed BioBrick import and SynBioWave library</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><br />
<td><i>Fabian: </i> You are a "Emmi"-coffee junkie ;) . Had a lot of fun with him in front of our laptops (and I like your music, hehe).<br /><br />
<i>Paresh: </i> My first contact point for doubts about German culture (and sometimes history ;) ).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/27/Freiburg_software_10_Paresh.jpg" alt="paresh" title="Paresh" class="team_portrait" /><br />
<br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><br />
<td>Paresh Paradkar</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><br />
<td>Computer Science</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Project Contributions:</td><br />
<td>Developed the following Robots: REBase robot, Translation robot, Codon Usage Robot</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><br />
<td><i>Fabian: </i>He sure is a funny guy!<br />Thanks for helping to improve my English skills.<br /><br />
<i>Niklas: </i>Shares my love for the Big Bang Theory</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/9/9b/Freiburg_software_10_Fabian.jpg" alt="fabian" title="Fabian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Fabian Haas<br /><br />
<span class="team_bolder">Field of study:</span> Biology<br /><br />
<span class="team_bolder">Project Contributions:</span> Designed the wiki and provided biological expertise during robot development<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas:</i> Will probably spend less time on his diploma thesis,<br />than he spent on our logo.<br /><br />
<i>Paresh:</i> He is very helpful and equally cheerful,<br />Has always a smiling face :).<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b3/Freiburg_software_10_Joerg.jpg" alt="joerg" title="Jörg" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Jörg Walossek<br /><br />
<span class="team_bolder">Field of study:</span> Biology, Bioinformatics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming, Bug-hunter<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas: </i>My fellow bug hunter....<br /><br />
<i>Fabian: </i>Jörg, nicht schneutzen, sonst platzt der Bär!!!<br />(Jörg, don't sniff, otherwise the bear will explode!!!)<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2c/Freiburg_software_10_Paul.jpg" alt="paul" title="Paul" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Paul Staab<br /><br />
<span class="team_bolder">Field of study:</span> Mathematics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<br />
<hr class="line_300" /><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Freiburg_software_10_Kristian.jpg" alt="kristian" title="Kristian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Kristian Müller<br /><br />
<span class="team_bolder">Field of study:</span> Biology Dr.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/Freiburg_software_10_katja.jpg" alt="katja" title="Katja" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Katja Arndt<br /><br />
<span class="team_bolder">Field of study:</span> Biology Prof.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_BiowareTeam:Freiburg Bioware2010-10-27T22:54:02Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<html><br />
<div class="virus"><img src="https://static.igem.org/mediawiki/2010/2/24/Freiburg10_rot250trans.gif" title="virus (3.5MB)" id="animated_virus"/></div><br />
<div class="div_home"><br />
<p><br />
Gene delivery using viral vectors holds great promise for the treatment of acquired and inherited diseases. The human Adeno-Associated Virus (AAV) is a small, non-pathogenic, single-stranded DNA virus gaining increasing attention being both versatile and effective. Taking current knowledge into account, we generated a recombinant, modularized, BioBrick-compatible AAV ‘Virus Construction Kit’. We provide parts for modified capsid proteins, targeting modules, tumor-specific promoters, and prodrug-activating enzymes as well as readily assembled vectors for gene delivery and production of non-replicative virus particles. The viral tropism is altered by N-terminal fusion or by loop replacement of the capsid proteins. Functionality of viruses constructed from our kit was demonstrated by fluorescent protein expression in infected cells and by prodrug-induced killing of tumor cells upon viral delivery of a thymidine kinase. Incorporating multiple layers of safety, we provide a general tool to the growing field of personalized medicine and demonstrate its use in tumor therapy.<br />
</p><br />
</div><br />
<br />
<!---Box on the upper left: Project Results---><br />
<div class="box_home"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project"><img class="right" src="https://static.igem.org/mediawiki/2010/5/5f/Freiburg10_Virus_Logo_Small.png" id="ccc" /><br />
</a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Results"><h2>Project Results</h2></a><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Results#highlights"><h5>Highlights: </h5></a><br />
This Site is in Construction, later you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold">[more]</span></a></p><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold"><h5>Heading:</h5></span></a><br />
This Site is in Construction, later on you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold">[Klick for more]</span></a></p><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><span class="bold"><h5>Head-Line:</h5></span></a><br />
This Site is in Construction, later you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold">[Klick for more]</span></a></p><br />
</div><br />
<br />
<!---Big box on the left: Virus Construction Kit - Manual---><br />
<br />
<div class="box_long"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/f/fb/Freiburg10_Manual_Logo_small.png" id="ccc" /><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><h2>Virus Construction Kit - The Manual</h2></a><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><h5>Heading:</h5></a><br />
This site is under construction, later you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><span class="bold">[more]</span></a></p><br />
</div><br />
<br />
<!--- News Ticker ---><br />
<br />
<div class="box_long box_long_news news_ticker"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Statistics"><h2>Statistics - In a Minute</h2></a><br />
<ul id="news" class="newsticker"><br />
<li><div class="news"><img class="right" src="https://static.igem.org/mediawiki/2010/0/0b/Freiburg10_Number_of_Plasmids.png" id="ccc" /><p style="font-size: 12px;"><br />
What happened in the labduring iGEM? </p><br />
</div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/a/a5/Freiburg10_Longest_Wikipage.png"<br />
alt="Longest Wikipage" width="368"><p style="font-size: 12px;">Longest Wikipage:<br />with 222,795 bytes</p></div><br />
</li><br />
<li><div class="news"><img src="https://static.igem.org/mediawiki/2010/1/10/Freiburg10_Number_of_Biobricks.png"<br />
alt="Number of BioBricks" width="368"><p style="font-size: 12px;">Number of Biobricks:<br /> 116</p></div></li><br />
<li><div class="news"><img heigth="100px" src="https://static.igem.org/mediawiki/2010/3/3f/Freiburg10_Number_of_ordered_Oligo-Nucleotides.png"<br />
alt="Number of ordered Oligo-Nucleotides" width="184"><p style="font-size: 12px;">Number of Ordered Oligos:<br /> 193</p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/f/f3/Freiburg10_Minipreps_total.png"<br />
alt="Minipreps total" width="184"><p style="font-size: 12px;">Mini-Preps total:<br /> 1085</p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/f/f7/Freiburg10_Midipreps_total.png"<br />
alt="Midipreps total" width="368"><p style="font-size: 12px;">Midi-Preps total:<br /> 106</p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/d/d6/Freiburg10_Highest_Prep_concentration.png"<br />
alt="Highest Prep concentration (Midi)" width="368"><p style="font-size: 12px;">Highest Midi-Prep Concentration:<br />5045,6 ng/µL </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/a/af/Freiburg10_Number_of_Glyzerolstocks.png"<br />
alt="Number of Glycerolstocks" width="368"><p style="font-size: 12px;">Number of Glycerolstocks:<br /> 763 </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/6/60/Freiburg10_Number_of_Team_members.png"<br />
alt="Number of Team members" width="368"><p style="font-size: 12px;">Number of Team members:<br /> 15 </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/0/03/Freiburg10_Days_in_the_lab.png"<br />
alt="Days in the lab" width="368"><p style="font-size: 12px;">Days in the lab:<br /> 170 </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/d/d1/Freiburg10_Longest_Labday.png"<br />
alt="Longest Labday" width="368"><p style="font-size: 12px;">Longest Labday:<br />18h </p></div></</li><br />
<li><div class="news"><img height="100px"<br />
src="https://static.igem.org/mediawiki/2010/b/b5/Freiburg10_Coffee_consumed_during_iGEM.png"<br />
alt="Coffee consumed during iGEM" width="184"><p style="font-size: 12px;">Coffee Consumed During iGEM:<br /> 2238 Cups</p></div></li><br />
<li><div class="news"><img heigth="100px"class="right" src="https://static.igem.org/mediawiki/2010/5/5f/Freiburg10_Virus_Logo_Small.png" id="ccc" /><p style="font-size: 12px;"><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Statistics"><h5>!Freiburg Bioware Statistics!</h5></a></p></div></li><br />
</ul><br />
</div><br />
<div class="clearfix"></div><br />
<br />
<div height="290px"><br />
<!---Box on the upper right: BioBricks---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/BioBricks"><img class="right" src="https://static.igem.org/mediawiki/2010/d/d1/Freiburg_10_BioBrick_icon_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/BioBricks"><h2>BioBricks</h2></a><br />
<p class="standard">Modularization and modification of the viral capsids for retargeting approaches and directed gene delivery of suicide genes resulted in many different BioBricks.<br> Click here to explore them.</p><br />
</div><br />
<br />
<!---Box on the lower left: Biosafety---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Safety"><img class="right" src="https://static.igem.org/mediawiki/2010/f/f9/Freiburg10_Danger_Virus_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Safety"><h2>Biosafety</h2></a><br />
<p class="standard">The aspect of biological safety was considered well and a risk assessment and security profile for the Adeno-associated Virus were created. Read more about Biosafety issues..</p><br />
<br />
</div><br />
<br />
<!---Box on the lower right: Notebook---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/9/95/Freiburg_10_Notebook_image_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook"><br />
<h2>Notebook</h2></a><br />
<p><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook"><span class="bold"><h5>Only cloning and cell culture? </h5></span></a><br /><br />
No! Besides <br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal"><span class="bold">BioBrick assembly</span></a>, flow cytometry analysis, quantification based methos via ELISA or Western Blot and cytotoxicity assays have been performed <a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Methods"><span class="bold"><h5>(go to Methods)</h5></span></p><br />
</a><br />
</div><br />
<br />
<br />
<!---Box on the lower right: Team---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Team_2010"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/b/bd/Freiburg10_Virus_Logo_Small_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Team_2010"><br />
<h2>Team</h2></a><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Team_2010"><h5>Fun and Science at the same time?</h5></a></a><br /><br />
Yes! The iGEM team Freiburg did not only share the lab bench, but as well some nice days <a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Photo_Gallery"><span class="bold">canoeing</span></a> and initiated the photo contest <a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Cuckoo_Clock"><span class="bold">Cuckoo Clock Competition</span></a></p><br />
</div><br />
</div><br />
<div class="clearfix"></div><br />
<br /><br />
<h1>Sponsors</h1><br />
<br />
<div class="map" height="1169px"><br />
<map name="Sponsoren_iGEM" id="Sponsoren_iGEM"><br />
<area shape="circle" coords="705,369,65" href="http://www.uni-potsdam.de/" target="_blank" alt="Uni Potsdam" title="Uni Potsdam" /><br />
<area shape="circle" coords="156,138,121" href="http://www.uni-freiburg.de/start-en.html?set_language=en" target="_blank" alt="Uni Freiburg" title="Uni Freiburg" /><br />
<area shape="rect" coords="304,8,815,269" href="http://www.bioss.uni-freiburg.de/cms/index.php#" target="_blank" alt="Bioss" title="Bioss" /><br />
<area shape="rect" coords="501,311,611,434" href="http://www.molbiotech.uni-freiburg.de/" target="_blank" alt="kuk.lab" title="kuk.lab" /><br />
<area shape="rect" coords="274,329,480,412" href="http://www.daad.de/en/index.html" alt="daad" target="_blank" title="daad" /><br />
<area shape="rect" coords="67,324,238,419" href="http://www.frias.uni-freiburg.de/" alt="frias" target="_blank" title="frias" /><br />
<area shape="rect" coords="95,454,376,606" href="http://www.roche.com/index.htm" target="_blank" alt="Roche" title="Roche" /><br />
<area shape="rect" coords="510,458,677,606" href="http://www.qiagen.com/default_qs.aspx" target="_blank" alt="Qiagen" title="Qiagen" /><br />
<area shape="rect" coords="477,671,708,752" href="http://www.starlab.de/int/?l=2" target="_blank" alt="Starlab" title="Starlab" /><br />
<area shape="rect" coords="551,799,787,861" href="http://www.peqlab.com" target="_blank" alt="peqlab" title="peqlab" /><br />
<area shape="rect" coords="291,801,494,859" href="http://www.eppendorf.com/int/?l=1&amp;action=start" target="_blank" alt="Eppendorf" title="Eppendorf" /><br />
<area shape="rect" coords="183,656,299,774" href="http://www.zeiss.de/en" target="_blank" alt="Zeiss" title="Zeiss" /><br />
<area shape="rect" coords="43,801,226,859" href="http://www.gilson.com/en/" target="_blank" alt="Gilson" title="Gilson" /><br />
<area shape="rect" coords="44,872,218,936" href="http://www.fermentas.de/index.php?&amp;language=en" target="_blank" alt="Fermentas" title="Fermentas" /><br />
<area shape="rect" coords="42,942,259,1002" href="http://www.home.agilent.com" target="_blank" alt="aigilent" title="aigilent" /><br />
<area shape="rect" coords="289,958,388,1041" href="http://www.avidity.com/" target="_blank" alt="Avidity" title="Avidity" /><br />
<area shape="rect" coords="412,960,566,1048" href="http://www.hiss-dx.de/hiss/index.php?id=43&amp;L=1" target="_blank" alt="Hiss" title="Hiss" /><br />
<area shape="rect" coords="591,981,795,1043" href="http://www.biozym.com/site/21/Produkte.aspx" target="_blank" alt="Biozym" title="Biozym" /><br />
<area shape="rect" coords="592,876,750,956" href="http://www.gatc-biotech.com" target="_blank" alt="GATC" title="GATC" /><br />
<area shape="rect" coords="296,886,540,948" href="http://www.geneart.com/" target="_blank" alt="Geneart" title="Geneart" /><br />
<area shape="rect" coords="495,1070,808,1151" href="http://www.atg-biosynthetics.com/" target="_blank" alt="ATG" title="ATG" /><br />
<area shape="rect" coords="242,1086,469,1154" href="http://www.purimex.com/" alt="purimex" target="_blank" title="purimex" /><br />
<area shape="rect" coords="45,1084,219,1154" href="http://www.dkfz.de/index.html" alt="dkfz" target="_blank" title="dkfz" /><br />
<area shape="rect" coords="46,1021,264,1075" href="http://www.mathworks.com" target="_blank" alt="Mathworks" title="Mathworks" /><br />
</map><br />
<img src="https://static.igem.org/mediawiki/2010/4/49/Freiburg10_Sponsoren_Image_Map.gif" width="826" height="1169" border="0" alt="" title="" usemap="#Sponsoren_iGEM" /><br />
</div><br />
<br />
<br /><br />
<br /><br />
<center><a href="http://www2.clustrmaps.com/counter/maps.php?url=https://2010.igem.org/Team:Freiburg_Bioware" id="clustrMapsLink"><img src="http://www2.clustrmaps.com/counter/index2.php?url=https://2010.igem.org/Team:Freiburg_Bioware" style="border:0px;" alt="Locations of visitors to this page" title="Locations of visitors to this page" id="clustrMapsImg" onerror="this.onerror=null; this.src='http://clustrmaps.com/images/clustrmaps-back-soon.jpg'; document.getElementById('clustrMapsLink').href='http://clustrmaps.com';" /><br />
</a></center><br />
<br />
</html><br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_BiowareTeam:Freiburg Bioware2010-10-27T22:49:06Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<html><br />
<div class="virus"><img src="https://static.igem.org/mediawiki/2010/2/24/Freiburg10_rot250trans.gif" title="virus (3.5MB)" id="animated_virus"/></div><br />
<div class="div_home"><br />
<p><br />
Gene delivery using viral vectors holds great promise for the treatment of acquired and inherited diseases. The human Adeno-Associated Virus (AAV) is a small, non-pathogenic, single-stranded DNA virus gaining increasing attention being both versatile and effective. Taking current knowledge into account, we generated a recombinant, modularized, BioBrick-compatible AAV ‘Virus Construction Kit’. We provide parts for modified capsid proteins, targeting modules, tumor-specific promoters, and prodrug-activating enzymes as well as readily assembled vectors for gene delivery and production of non-replicative virus particles. The viral tropism is altered by N-terminal fusion or by loop replacement of the capsid proteins. Functionality of viruses constructed from our kit was demonstrated by fluorescent protein expression in infected cells and by prodrug-induced killing of tumor cells upon viral delivery of a thymidine kinase. Incorporating multiple layers of safety, we provide a general tool to the growing field of personalized medicine and demonstrate its use in tumor therapy.<br />
</p><br />
</div><br />
<br />
<!---Box on the upper left: Project Results---><br />
<div class="box_home"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project"><img class="right" src="https://static.igem.org/mediawiki/2010/5/5f/Freiburg10_Virus_Logo_Small.png" id="ccc" /><br />
</a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Results"><h2>Project Results</h2></a><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Results#highlights"><h5>Highlights: </h5></a><br />
This Site is in Construction, later you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold">[more]</span></a></p><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold"><h5>Heading:</h5></span></a><br />
This Site is in Construction, later on you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold">[Klick for more]</span></a></p><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><span class="bold"><h5>Head-Line:</h5></span></a><br />
This Site is in Construction, later you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold">[Klick for more]</span></a></p><br />
</div><br />
<br />
<!---Big box on the left: Virus Construction Kit - Manual---><br />
<br />
<div class="box_long"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/f/fb/Freiburg10_Manual_Logo_small.png" id="ccc" /><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><h2>Virus Construction Kit - The Manual</h2></a><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><h5>Heading:</h5></a><br />
This site is under construction, later you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><span class="bold">[more]</span></a></p><br />
</div><br />
<br />
<!--- News Ticker ---><br />
<br />
<div class="box_long box_long_news news_ticker"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Statistics"><h2>Statistics - In a Minute</h2></a><br />
<ul id="news" class="newsticker"><br />
<li><div class="news"><img class="right" src="https://static.igem.org/mediawiki/2010/0/0b/Freiburg10_Number_of_Plasmids.png" id="ccc" /><p style="font-size: 12px;"><br />
What happened in the labduring iGEM? </p><br />
</div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/a/a5/Freiburg10_Longest_Wikipage.png"<br />
alt="Longest Wikipage" width="368"><p style="font-size: 12px;">Longest Wikipage:<br />with 222,795 bytes</p></div><br />
</li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/1/10/Freiburg10_Number_of_Biobricks.png"<br />
alt="Number of BioBricks" width="368"><p style="font-size: 12px;>Number of Biobricks:<br /> 116</p></div></li><br />
<li><div class="news"><img heigth="100px"<br />
src="https://static.igem.org/mediawiki/2010/3/3f/Freiburg10_Number_of_ordered_Oligo-Nucleotides.png"<br />
alt="Number of ordered Oligo-Nucleotides" width="184"><p style="font-size: 12px;">Number of Ordered Oligos:<br /> 193</p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/f/f3/Freiburg10_Minipreps_total.png"<br />
alt="Minipreps total" width="184"><p style="font-size: 12px;">Mini-Preps total:<br /> 1085</p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/f/f7/Freiburg10_Midipreps_total.png"<br />
alt="Midipreps total" width="368"><p style="font-size: 12px;">Midi-Preps total:<br /> 106</p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/d/d6/Freiburg10_Highest_Prep_concentration.png"<br />
alt="Highest Prep concentration (Midi)" width="368"><p style="font-size: 12px;">Highest Midi-Prep Concentration:<br />5045,6 ng/µL </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/a/af/Freiburg10_Number_of_Glyzerolstocks.png"<br />
alt="Number of Glycerolstocks" width="368"><p style="font-size: 12px;">Number of Glycerolstocks:<br /> 763 </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/6/60/Freiburg10_Number_of_Team_members.png"<br />
alt="Number of Team members" width="368"><p style="font-size: 12px;">Number of Team members:<br /> 15 </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/0/03/Freiburg10_Days_in_the_lab.png"<br />
alt="Days in the lab" width="368"><p style="font-size: 12px;">Days in the lab:<br /> 170 </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/d/d1/Freiburg10_Longest_Labday.png"<br />
alt="Longest Labday" width="368"><p style="font-size: 12px;">Longest Labday:<br />18h </p></div></</li><br />
<li><div class="news"><img height="100px"<br />
src="https://static.igem.org/mediawiki/2010/b/b5/Freiburg10_Coffee_consumed_during_iGEM.png"<br />
alt="Coffee consumed during iGEM" width="184"><p style="font-size: 12px;">Coffee Consumed During iGEM:<br /> 2238 Cups</p></div></li><br />
<li><div class="news"><img heigth="100px"class="right" src="https://static.igem.org/mediawiki/2010/5/5f/Freiburg10_Virus_Logo_Small.png" id="ccc" /><p style="font-size: 12px;"><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Statistics"><h5>!Freiburg Bioware Statistics!</h5></a></p></div></li><br />
</ul><br />
</div><br />
<div class="clearfix"></div><br />
<br />
<div height="290px"><br />
<!---Box on the upper right: BioBricks---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/BioBricks"><img class="right" src="https://static.igem.org/mediawiki/2010/d/d1/Freiburg_10_BioBrick_icon_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/BioBricks"><h2>BioBricks</h2></a><br />
<p class="standard">Modularization and modification of the viral capsids for retargeting approaches and directed gene delivery of suicide genes resulted in many different BioBricks.<br> Click here to explore them.</p><br />
</div><br />
<br />
<!---Box on the lower left: Biosafety---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Safety"><img class="right" src="https://static.igem.org/mediawiki/2010/f/f9/Freiburg10_Danger_Virus_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Safety"><h2>Biosafety</h2></a><br />
<p class="standard">The aspect of biological safety was considered well and a risk assessment and security profile for the Adeno-associated Virus were created. Read more about Biosafety issues..</p><br />
<br />
</div><br />
<br />
<!---Box on the lower right: Notebook---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/9/95/Freiburg_10_Notebook_image_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook"><br />
<h2>Notebook</h2></a><br />
<p><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook"><span class="bold"><h5>Only cloning and cell culture? </h5></span></a><br /><br />
No! Besides <br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal"><span class="bold">BioBrick assembly</span></a>, flow cytometry analysis, quantification based methos via ELISA or Western Blot and cytotoxicity assays have been performed <a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Methods"><span class="bold"><h5>(go to Methods)</h5></span></p><br />
</a><br />
</div><br />
<br />
<br />
<!---Box on the lower right: Team---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Team_2010"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/b/bd/Freiburg10_Virus_Logo_Small_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Team_2010"><br />
<h2>Team</h2></a><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Team_2010"><h5>Fun and Science at the same time?</h5></a></a><br /><br />
Yes! The iGEM team Freiburg did not only share the lab bench, but as well some nice days <a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Photo_Gallery"><span class="bold">canoeing</span></a> and initiated the photo contest <a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Cuckoo_Clock"><span class="bold">Cuckoo Clock Competition</span></a></p><br />
</div><br />
</div><br />
<div class="clearfix"></div><br />
<br /><br />
<h1>Sponsors</h1><br />
<br />
<div class="map" height="1169px"><br />
<map name="Sponsoren_iGEM" id="Sponsoren_iGEM"><br />
<area shape="circle" coords="705,369,65" href="http://www.uni-potsdam.de/" target="_blank" alt="Uni Potsdam" title="Uni Potsdam" /><br />
<area shape="circle" coords="156,138,121" href="http://www.uni-freiburg.de/start-en.html?set_language=en" target="_blank" alt="Uni Freiburg" title="Uni Freiburg" /><br />
<area shape="rect" coords="304,8,815,269" href="http://www.bioss.uni-freiburg.de/cms/index.php#" target="_blank" alt="Bioss" title="Bioss" /><br />
<area shape="rect" coords="501,311,611,434" href="http://www.molbiotech.uni-freiburg.de/" target="_blank" alt="kuk.lab" title="kuk.lab" /><br />
<area shape="rect" coords="274,329,480,412" href="http://www.daad.de/en/index.html" alt="daad" target="_blank" title="daad" /><br />
<area shape="rect" coords="67,324,238,419" href="http://www.frias.uni-freiburg.de/" alt="frias" target="_blank" title="frias" /><br />
<area shape="rect" coords="95,454,376,606" href="http://www.roche.com/index.htm" target="_blank" alt="Roche" title="Roche" /><br />
<area shape="rect" coords="510,458,677,606" href="http://www.qiagen.com/default_qs.aspx" target="_blank" alt="Qiagen" title="Qiagen" /><br />
<area shape="rect" coords="477,671,708,752" href="http://www.starlab.de/int/?l=2" target="_blank" alt="Starlab" title="Starlab" /><br />
<area shape="rect" coords="551,799,787,861" href="http://www.peqlab.com" target="_blank" alt="peqlab" title="peqlab" /><br />
<area shape="rect" coords="291,801,494,859" href="http://www.eppendorf.com/int/?l=1&amp;action=start" target="_blank" alt="Eppendorf" title="Eppendorf" /><br />
<area shape="rect" coords="183,656,299,774" href="http://www.zeiss.de/en" target="_blank" alt="Zeiss" title="Zeiss" /><br />
<area shape="rect" coords="43,801,226,859" href="http://www.gilson.com/en/" target="_blank" alt="Gilson" title="Gilson" /><br />
<area shape="rect" coords="44,872,218,936" href="http://www.fermentas.de/index.php?&amp;language=en" target="_blank" alt="Fermentas" title="Fermentas" /><br />
<area shape="rect" coords="42,942,259,1002" href="http://www.home.agilent.com" target="_blank" alt="aigilent" title="aigilent" /><br />
<area shape="rect" coords="289,958,388,1041" href="http://www.avidity.com/" target="_blank" alt="Avidity" title="Avidity" /><br />
<area shape="rect" coords="412,960,566,1048" href="http://www.hiss-dx.de/hiss/index.php?id=43&amp;L=1" target="_blank" alt="Hiss" title="Hiss" /><br />
<area shape="rect" coords="591,981,795,1043" href="http://www.biozym.com/site/21/Produkte.aspx" target="_blank" alt="Biozym" title="Biozym" /><br />
<area shape="rect" coords="592,876,750,956" href="http://www.gatc-biotech.com" target="_blank" alt="GATC" title="GATC" /><br />
<area shape="rect" coords="296,886,540,948" href="http://www.geneart.com/" target="_blank" alt="Geneart" title="Geneart" /><br />
<area shape="rect" coords="495,1070,808,1151" href="http://www.atg-biosynthetics.com/" target="_blank" alt="ATG" title="ATG" /><br />
<area shape="rect" coords="242,1086,469,1154" href="http://www.purimex.com/" alt="purimex" target="_blank" title="purimex" /><br />
<area shape="rect" coords="45,1084,219,1154" href="http://www.dkfz.de/index.html" alt="dkfz" target="_blank" title="dkfz" /><br />
<area shape="rect" coords="46,1021,264,1075" href="http://www.mathworks.com" target="_blank" alt="Mathworks" title="Mathworks" /><br />
</map><br />
<img src="https://static.igem.org/mediawiki/2010/4/49/Freiburg10_Sponsoren_Image_Map.gif" width="826" height="1169" border="0" alt="" title="" usemap="#Sponsoren_iGEM" /><br />
</div><br />
<br />
<br /><br />
<br /><br />
<center><a href="http://www2.clustrmaps.com/counter/maps.php?url=https://2010.igem.org/Team:Freiburg_Bioware" id="clustrMapsLink"><img src="http://www2.clustrmaps.com/counter/index2.php?url=https://2010.igem.org/Team:Freiburg_Bioware" style="border:0px;" alt="Locations of visitors to this page" title="Locations of visitors to this page" id="clustrMapsImg" onerror="this.onerror=null; this.src='http://clustrmaps.com/images/clustrmaps-back-soon.jpg'; document.getElementById('clustrMapsLink').href='http://clustrmaps.com';" /><br />
</a></center><br />
<br />
</html><br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_BiowareTeam:Freiburg Bioware2010-10-27T22:45:53Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}}{{:Team:Freiburg_Bioware/jquery}}{{:Team:Freiburg_Bioware/menu_home}}<br />
<html><br />
<div class="virus"><img src="https://static.igem.org/mediawiki/2010/2/24/Freiburg10_rot250trans.gif" title="virus (3.5MB)" id="animated_virus"/></div><br />
<div class="div_home"><br />
<p><br />
Gene delivery using viral vectors holds great promise for the treatment of acquired and inherited diseases. The human Adeno-Associated Virus (AAV) is a small, non-pathogenic, single-stranded DNA virus gaining increasing attention being both versatile and effective. Taking current knowledge into account, we generated a recombinant, modularized, BioBrick-compatible AAV ‘Virus Construction Kit’. We provide parts for modified capsid proteins, targeting modules, tumor-specific promoters, and prodrug-activating enzymes as well as readily assembled vectors for gene delivery and production of non-replicative virus particles. The viral tropism is altered by N-terminal fusion or by loop replacement of the capsid proteins. Functionality of viruses constructed from our kit was demonstrated by fluorescent protein expression in infected cells and by prodrug-induced killing of tumor cells upon viral delivery of a thymidine kinase. Incorporating multiple layers of safety, we provide a general tool to the growing field of personalized medicine and demonstrate its use in tumor therapy.<br />
</p><br />
</div><br />
<br />
<!---Box on the upper left: Project Results---><br />
<div class="box_home"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project"><img class="right" src="https://static.igem.org/mediawiki/2010/5/5f/Freiburg10_Virus_Logo_Small.png" id="ccc" /><br />
</a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Results"><h2>Project Results</h2></a><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Results#highlights"><h5>Highlights: </h5></a><br />
This Site is in Construction, later you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold">[more]</span></a></p><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold"><h5>Heading:</h5></span></a><br />
This Site is in Construction, later on you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold">[Klick for more]</span></a></p><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><span class="bold"><h5>Head-Line:</h5></span></a><br />
This Site is in Construction, later you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Virus_Construction_Kit"><span class="bold">[Klick for more]</span></a></p><br />
</div><br />
<br />
<!---Big box on the left: Virus Construction Kit - Manual---><br />
<br />
<div class="box_long"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/f/fb/Freiburg10_Manual_Logo_small.png" id="ccc" /><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><h2>Virus Construction Kit - The Manual</h2></a><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><h5>Heading:</h5></a><br />
This site is under construction, later you will find more right here...<a href="https://2010.igem.org/Team:Freiburg_Bioware/Project/Virus_Construction_Kit"><span class="bold">[more]</span></a></p><br />
</div><br />
<br />
<!--- News Ticker ---><br />
<br />
<div class="box_long box_long_news news_ticker"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Statistics"><h2>Statistics - In a Minute</h2></a><br />
<ul id="news" class="newsticker"><br />
<li><div class="news"><img class="right" src="https://static.igem.org/mediawiki/2010/0/0b/Freiburg10_Number_of_Plasmids.png" id="ccc" /><p><br />
What happened in the labduring iGEM? </p><br />
</div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/a/a5/Freiburg10_Longest_Wikipage.png"<br />
alt="Longest Wikipage" width="368"><p style="font-size: 12px;">Longest Wikipage:<br />with 222,795 bytes</p></div><br />
</li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/1/10/Freiburg10_Number_of_Biobricks.png"<br />
alt="Number of BioBricks" width="368"><p style="font-size: 12px;>Number of Biobricks:<br /> 116</p></div></li><br />
<li><div class="news"><img heigth="100px"<br />
src="https://static.igem.org/mediawiki/2010/3/3f/Freiburg10_Number_of_ordered_Oligo-Nucleotides.png"<br />
alt="Number of ordered Oligo-Nucleotides" width="184"><p style="font-size: 12px;">Number of Ordered Oligos:<br /> 193</p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/f/f3/Freiburg10_Minipreps_total.png"<br />
alt="Minipreps total" width="184"><p style="font-size: 12px;">Mini-Preps total:<br /> 1085</p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/f/f7/Freiburg10_Midipreps_total.png"<br />
alt="Midipreps total" width="368"><p style="font-size: 12px;">Midi-Preps total:<br /> 106</p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/d/d6/Freiburg10_Highest_Prep_concentration.png"<br />
alt="Highest Prep concentration (Midi)" width="368"><p style="font-size: 12px;">Highest Midi-Prep Concentration:<br />5045,6 ng/µL </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/a/af/Freiburg10_Number_of_Glyzerolstocks.png"<br />
alt="Number of Glycerolstocks" width="368"><p style="font-size: 12px;">Number of Glycerolstocks:<br /> 763 </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/6/60/Freiburg10_Number_of_Team_members.png"<br />
alt="Number of Team members" width="368"><p style="font-size: 12px;">Number of Team members:<br /> 15 </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/0/03/Freiburg10_Days_in_the_lab.png"<br />
alt="Days in the lab" width="368"><p style="font-size: 12px;">Days in the lab:<br /> 170 </p></div></li><br />
<li><div class="news"><img<br />
src="https://static.igem.org/mediawiki/2010/d/d1/Freiburg10_Longest_Labday.png"<br />
alt="Longest Labday" width="368"><p style="font-size: 12px;">Longest Labday:<br />18h </p></div></</li><br />
<li><div class="news"><img height="100px"<br />
src="https://static.igem.org/mediawiki/2010/b/b5/Freiburg10_Coffee_consumed_during_iGEM.png"<br />
alt="Coffee consumed during iGEM" width="184"><p style="font-size: 12px;">Coffee Consumed During iGEM:<br /> 2238 Cups</p></div></li><br />
<li><div class="news"><img heigth="100px"class="right" src="https://static.igem.org/mediawiki/2010/5/5f/Freiburg10_Virus_Logo_Small.png" id="ccc" /><p style="font-size: 12px;"><a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Statistics"><h5>!Freiburg Bioware Statistics!</h5></a></p></div></li><br />
</ul><br />
</div><br />
<div class="clearfix"></div><br />
<br />
<div height="290px"><br />
<!---Box on the upper right: BioBricks---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/BioBricks"><img class="right" src="https://static.igem.org/mediawiki/2010/d/d1/Freiburg_10_BioBrick_icon_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/BioBricks"><h2>BioBricks</h2></a><br />
<p class="standard">Modularization and modification of the viral capsids for retargeting approaches and directed gene delivery of suicide genes resulted in many different BioBricks.<br> Click here to explore them.</p><br />
</div><br />
<br />
<!---Box on the lower left: Biosafety---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Safety"><img class="right" src="https://static.igem.org/mediawiki/2010/f/f9/Freiburg10_Danger_Virus_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Safety"><h2>Biosafety</h2></a><br />
<p class="standard">The aspect of biological safety was considered well and a risk assessment and security profile for the Adeno-associated Virus were created. Read more about Biosafety issues..</p><br />
<br />
</div><br />
<br />
<!---Box on the lower right: Notebook---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/9/95/Freiburg_10_Notebook_image_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook"><br />
<h2>Notebook</h2></a><br />
<p><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook"><span class="bold"><h5>Only cloning and cell culture? </h5></span></a><br /><br />
No! Besides <br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Labjournal"><span class="bold">BioBrick assembly</span></a>, flow cytometry analysis, quantification based methos via ELISA or Western Blot and cytotoxicity assays have been performed <a href="https://2010.igem.org/Team:Freiburg_Bioware/NoteBook/Methods"><span class="bold"><h5>(go to Methods)</h5></span></p><br />
</a><br />
</div><br />
<br />
<br />
<!---Box on the lower right: Team---><br />
<div class="box_home_small"><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Team_2010"><br />
<img class="right" src="https://static.igem.org/mediawiki/2010/b/bd/Freiburg10_Virus_Logo_Small_small.png" id="ccc" /></a><br />
<a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Team_2010"><br />
<h2>Team</h2></a><br />
<p><a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Team_2010"><h5>Fun and Science at the same time?</h5></a></a><br /><br />
Yes! The iGEM team Freiburg did not only share the lab bench, but as well some nice days <a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Photo_Gallery"><span class="bold">canoeing</span></a> and initiated the photo contest <a href="https://2010.igem.org/Team:Freiburg_Bioware/Team/Cuckoo_Clock"><span class="bold">Cuckoo Clock Competition</span></a></p><br />
</div><br />
</div><br />
<div class="clearfix"></div><br />
<br /><br />
<h1>Sponsors</h1><br />
<br />
<div class="map" height="1169px"><br />
<map name="Sponsoren_iGEM" id="Sponsoren_iGEM"><br />
<area shape="circle" coords="705,369,65" href="http://www.uni-potsdam.de/" target="_blank" alt="Uni Potsdam" title="Uni Potsdam" /><br />
<area shape="circle" coords="156,138,121" href="http://www.uni-freiburg.de/start-en.html?set_language=en" target="_blank" alt="Uni Freiburg" title="Uni Freiburg" /><br />
<area shape="rect" coords="304,8,815,269" href="http://www.bioss.uni-freiburg.de/cms/index.php#" target="_blank" alt="Bioss" title="Bioss" /><br />
<area shape="rect" coords="501,311,611,434" href="http://www.molbiotech.uni-freiburg.de/" target="_blank" alt="kuk.lab" title="kuk.lab" /><br />
<area shape="rect" coords="274,329,480,412" href="http://www.daad.de/en/index.html" alt="daad" target="_blank" title="daad" /><br />
<area shape="rect" coords="67,324,238,419" href="http://www.frias.uni-freiburg.de/" alt="frias" target="_blank" title="frias" /><br />
<area shape="rect" coords="95,454,376,606" href="http://www.roche.com/index.htm" target="_blank" alt="Roche" title="Roche" /><br />
<area shape="rect" coords="510,458,677,606" href="http://www.qiagen.com/default_qs.aspx" target="_blank" alt="Qiagen" title="Qiagen" /><br />
<area shape="rect" coords="477,671,708,752" href="http://www.starlab.de/int/?l=2" target="_blank" alt="Starlab" title="Starlab" /><br />
<area shape="rect" coords="551,799,787,861" href="http://www.peqlab.com" target="_blank" alt="peqlab" title="peqlab" /><br />
<area shape="rect" coords="291,801,494,859" href="http://www.eppendorf.com/int/?l=1&amp;action=start" target="_blank" alt="Eppendorf" title="Eppendorf" /><br />
<area shape="rect" coords="183,656,299,774" href="http://www.zeiss.de/en" target="_blank" alt="Zeiss" title="Zeiss" /><br />
<area shape="rect" coords="43,801,226,859" href="http://www.gilson.com/en/" target="_blank" alt="Gilson" title="Gilson" /><br />
<area shape="rect" coords="44,872,218,936" href="http://www.fermentas.de/index.php?&amp;language=en" target="_blank" alt="Fermentas" title="Fermentas" /><br />
<area shape="rect" coords="42,942,259,1002" href="http://www.home.agilent.com" target="_blank" alt="aigilent" title="aigilent" /><br />
<area shape="rect" coords="289,958,388,1041" href="http://www.avidity.com/" target="_blank" alt="Avidity" title="Avidity" /><br />
<area shape="rect" coords="412,960,566,1048" href="http://www.hiss-dx.de/hiss/index.php?id=43&amp;L=1" target="_blank" alt="Hiss" title="Hiss" /><br />
<area shape="rect" coords="591,981,795,1043" href="http://www.biozym.com/site/21/Produkte.aspx" target="_blank" alt="Biozym" title="Biozym" /><br />
<area shape="rect" coords="592,876,750,956" href="http://www.gatc-biotech.com" target="_blank" alt="GATC" title="GATC" /><br />
<area shape="rect" coords="296,886,540,948" href="http://www.geneart.com/" target="_blank" alt="Geneart" title="Geneart" /><br />
<area shape="rect" coords="495,1070,808,1151" href="http://www.atg-biosynthetics.com/" target="_blank" alt="ATG" title="ATG" /><br />
<area shape="rect" coords="242,1086,469,1154" href="http://www.purimex.com/" alt="purimex" target="_blank" title="purimex" /><br />
<area shape="rect" coords="45,1084,219,1154" href="http://www.dkfz.de/index.html" alt="dkfz" target="_blank" title="dkfz" /><br />
<area shape="rect" coords="46,1021,264,1075" href="http://www.mathworks.com" target="_blank" alt="Mathworks" title="Mathworks" /><br />
</map><br />
<img src="https://static.igem.org/mediawiki/2010/4/49/Freiburg10_Sponsoren_Image_Map.gif" width="826" height="1169" border="0" alt="" title="" usemap="#Sponsoren_iGEM" /><br />
</div><br />
<br />
<br /><br />
<br /><br />
<center><a href="http://www2.clustrmaps.com/counter/maps.php?url=https://2010.igem.org/Team:Freiburg_Bioware" id="clustrMapsLink"><img src="http://www2.clustrmaps.com/counter/index2.php?url=https://2010.igem.org/Team:Freiburg_Bioware" style="border:0px;" alt="Locations of visitors to this page" title="Locations of visitors to this page" id="clustrMapsImg" onerror="this.onerror=null; this.src='http://clustrmaps.com/images/clustrmaps-back-soon.jpg'; document.getElementById('clustrMapsLink').href='http://clustrmaps.com';" /><br />
</a></center><br />
<br />
</html><br />
{{:Team:Freiburg_Bioware/Footer}}</div>Fahahttp://2010.igem.org/Team:Freiburg_Software/css_fontTeam:Freiburg Software/css font2010-10-27T22:18:06Z<p>Faha: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
/* Font */<br />
<br />
p {<br />
color: white;<br />
margin: 0px 0px 0px 5px;<br />
}<br />
<br />
ul {<br />
color: white;<br />
}<br />
<br />
code {<br />
background: #cccccc;<br />
color: black;<br />
}<br />
<br />
p.main {<br />
font-size: 12px;<br />
color: white;<br />
text-align: justify;<br />
margin: 15px 15px 15px 25px; <br />
}<br />
<br />
p.caption {<br />
text-align: left;<br />
font-size: 11px;<br />
color: white;<br />
font-style: italic;<br />
text-align: justify;<br />
margin: 5px 5px 5px 5px; <br />
}<br />
<br />
h1, h2, h3, h4, h5 {<br />
color: white;<br />
font-weight: bold;<br />
text-decoration: none;<br />
border: none;<br />
}<br />
<br />
h1 {<br />
margin: 20px 15px 15px 15px;<br />
font-size: 18px;<br />
}<br />
<br />
h2 {<br />
margin: 15px 10px 10px 20px;<br />
font-size: 16px;<br />
}<br />
<br />
h3 {<br />
margin: 15px 10px 10px 25px;<br />
font-size: 12px;<br />
font-weight: bolder;<br />
}<br />
<br />
<br />
h5 {<br />
margin: 5px 5px 5px 5px;<br />
font-size: 12px;<br />
text-align: center;<br />
text-decoration: none;<br />
}<br />
<br />
p a {<br />
color: yellow;<br />
}<br />
p a:visited {<br />
color: #ffff77;<br />
}<br />
<br />
.team_bolder {<br />
font-weight: bolder;<br />
vertical-align: top;<br />
width: 150px;<br />
}<br />
</style></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/css_fontTeam:Freiburg Software/css font2010-10-27T22:17:38Z<p>Faha: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
/* Font */<br />
<br />
p {<br />
color: white;<br />
margin: 0px 0px 0px 5px;<br />
}<br />
<br />
ul {<br />
color: white;<br />
}<br />
<br />
code {<br />
background: #cccccc;<br />
color: black;<br />
}<br />
<br />
p.main {<br />
font-size: 12px;<br />
color: white;<br />
text-align: justify;<br />
margin: 15px 15px 15px 25px; <br />
}<br />
<br />
p.caption {<br />
text-align: left;<br />
font-size: 11px;<br />
color: white;<br />
font-style: italic;<br />
text-align: justify;<br />
margin: 5px 5px 5px 5px; <br />
}<br />
<br />
h1, h2, h3, h4, h5 {<br />
color: white;<br />
font-weight: bold;<br />
text-decoration: none;<br />
border: none;<br />
}<br />
<br />
h1 {<br />
margin: 20px 15px 15px 15px;<br />
font-size: 18px;<br />
}<br />
<br />
h2 {<br />
margin: 15px 10px 10px 20px;<br />
font-size: 16px;<br />
}<br />
<br />
h3 {<br />
margin: 15px 10px 10px 25px;<br />
font-size: 12px;<br />
font-weight: bolder;<br />
}<br />
<br />
<br />
h5 {<br />
margin: 5px 5px 5px 5px;<br />
font-size: 12px;<br />
text-align: center;<br />
text-decoration: none;<br />
}<br />
<br />
p a {<br />
color: yellow;<br />
}<br />
p a:visited {<br />
color: #ffff77;<br />
}<br />
<br />
.team_bolder {<br />
font-weight: bolder;<br />
vertical-align: top;<br />
width: 200px;<br />
}<br />
</style></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/css_fontTeam:Freiburg Software/css font2010-10-27T22:16:56Z<p>Faha: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
/* Font */<br />
<br />
p {<br />
color: white;<br />
margin: 0px 0px 0px 5px;<br />
}<br />
<br />
ul {<br />
color: white;<br />
}<br />
<br />
code {<br />
background: #cccccc;<br />
color: black;<br />
}<br />
<br />
p.main {<br />
font-size: 12px;<br />
color: white;<br />
text-align: justify;<br />
margin: 15px 15px 15px 25px; <br />
}<br />
<br />
p.caption {<br />
text-align: left;<br />
font-size: 11px;<br />
color: white;<br />
font-style: italic;<br />
text-align: justify;<br />
margin: 5px 5px 5px 5px; <br />
}<br />
<br />
h1, h2, h3, h4, h5 {<br />
color: white;<br />
font-weight: bold;<br />
text-decoration: none;<br />
border: none;<br />
}<br />
<br />
h1 {<br />
margin: 20px 15px 15px 15px;<br />
font-size: 18px;<br />
}<br />
<br />
h2 {<br />
margin: 15px 10px 10px 20px;<br />
font-size: 16px;<br />
}<br />
<br />
h3 {<br />
margin: 15px 10px 10px 25px;<br />
font-size: 12px;<br />
font-weight: bolder;<br />
}<br />
<br />
<br />
h5 {<br />
margin: 5px 5px 5px 5px;<br />
font-size: 12px;<br />
text-align: center;<br />
text-decoration: none;<br />
}<br />
<br />
p a {<br />
color: yellow;<br />
}<br />
p a:visited {<br />
color: #ffff77;<br />
}<br />
<br />
.team_bolder {<br />
font-weight: bolder;<br />
vertical-align: top;<br />
width: 60px;<br />
}<br />
</style></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/Team/2010Team:Freiburg Software/Team/20102010-10-27T22:14:40Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/head}}<br />
<br />
<html><br />
<!-- page special style --><br />
<br />
<style type="text/css"><br />
<br />
#subTeam2010 a {<br />
opacity: 0.92;<br />
color: white;<br />
}<br />
<br />
</style><br />
<br />
<div id=main_area><br />
<h1>Team 2010</h1><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a0/Freiburg_software_10_Niklas.jpg" alt="niklas" title="Niklas" class="team_portrait" /><br />
<br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><br />
<td>Niklas Meinzer</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><br />
<td>Computer science (Bioinformatics)</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><br />
<td>Create Robots, developing library</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><br />
<td><i>Fabian: </i> You are a "Emmi"-coffee junkie ;) . Had a lot of fun with him in<br />front of our laptops (and I like your music, hehe).<br />
<i>Paresh: </i> My first contact point for doubts about <br />German culture (and sometimes history ;) ).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/27/Freiburg_software_10_Paresh.jpg" alt="paresh" title="Paresh" class="team_portrait" /><br />
<br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><br />
<td>Paresh Paradkar</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><br />
<td>Computer science</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><br />
<td>Create Robots</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><br />
<td><i>Fabian: </i>He sure is a funny guy!<br />Thanks for helping to improve my English skills.<br /><br />
<i>Niklas: </i>Shares my love for the Big Bang Theory</td><br />
</tr><br />
</table><br />
<br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/9/9b/Freiburg_software_10_Fabian.jpg" alt="fabian" title="Fabian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Fabian Haas<br /><br />
<span class="team_bolder">Field of study:</span> Biology<br /><br />
<span class="team_bolder">Team Function:</span> Wiki, Graphics, Organisation<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas:</i> Will probably spend less time on his diploma thesis,<br />than he spent on our logo.<br /><br />
<i>Paresh:</i> He is very helpful and equally cheerful,<br />Has always a smiling face :).<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b3/Freiburg_software_10_Joerg.jpg" alt="joerg" title="Jörg" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Jörg Walossek<br /><br />
<span class="team_bolder">Field of study:</span> Biology, Bioinformatics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming, Bug-hunter<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas: </i>My fellow bug hunter....<br /><br />
<i>Fabian: </i>Jörg, nicht schneutzen, sonst platzt der Bär!!!<br />(Jörg, don't sniff, otherwise the bear will explode!!!)<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2c/Freiburg_software_10_Paul.jpg" alt="paul" title="Paul" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Paul Staab<br /><br />
<span class="team_bolder">Field of study:</span> Mathematics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<br />
<hr class="line_300" /><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Freiburg_software_10_Kristian.jpg" alt="kristian" title="Kristian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Kristian Müller<br /><br />
<span class="team_bolder">Field of study:</span> Biology Dr.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/Freiburg_software_10_katja.jpg" alt="katja" title="Katja" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Katja Arndt<br /><br />
<span class="team_bolder">Field of study:</span> Biology Prof.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/Team/2010Team:Freiburg Software/Team/20102010-10-27T22:13:50Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/head}}<br />
<br />
<html><br />
<!-- page special style --><br />
<br />
<style type="text/css"><br />
<br />
#subTeam2010 a {<br />
opacity: 0.92;<br />
color: white;<br />
}<br />
<br />
</style><br />
<br />
<div id=main_area><br />
<h1>Team 2010</h1><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a0/Freiburg_software_10_Niklas.jpg" alt="niklas" title="Niklas" class="team_portrait" /><br />
<br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><br />
<td class="color: white;">Niklas Meinzer</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><br />
<td class="color: white;">Computer science (Bioinformatics)</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><br />
<td class="color: white;">Create Robots, developing library</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><br />
<td class="color: white;"><i>Fabian: </i> You are a "Emmi"-coffee junkie ;) . Had a lot of fun with him in<br />front of our laptops (and I like your music, hehe).<br />
<i>Paresh: </i> My first contact point for doubts about <br />German culture (and sometimes history ;) ).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/27/Freiburg_software_10_Paresh.jpg" alt="paresh" title="Paresh" class="team_portrait" /><br />
<br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><br />
<td>Paresh Paradkar</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><br />
<td>Computer science</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><br />
<td>Create Robots</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><br />
<td><i>Fabian: </i>He sure is a funny guy!<br />Thanks for helping to improve my English skills.<br /><br />
<i>Niklas: </i>Shares my love for the Big Bang Theory</td><br />
</tr><br />
</table><br />
<br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/9/9b/Freiburg_software_10_Fabian.jpg" alt="fabian" title="Fabian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Fabian Haas<br /><br />
<span class="team_bolder">Field of study:</span> Biology<br /><br />
<span class="team_bolder">Team Function:</span> Wiki, Graphics, Organisation<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas:</i> Will probably spend less time on his diploma thesis,<br />than he spent on our logo.<br /><br />
<i>Paresh:</i> He is very helpful and equally cheerful,<br />Has always a smiling face :).<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b3/Freiburg_software_10_Joerg.jpg" alt="joerg" title="Jörg" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Jörg Walossek<br /><br />
<span class="team_bolder">Field of study:</span> Biology, Bioinformatics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming, Bug-hunter<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas: </i>My fellow bug hunter....<br /><br />
<i>Fabian: </i>Jörg, nicht schneutzen, sonst platzt der Bär!!!<br />(Jörg, don't sniff, otherwise the bear will explode!!!)<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2c/Freiburg_software_10_Paul.jpg" alt="paul" title="Paul" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Paul Staab<br /><br />
<span class="team_bolder">Field of study:</span> Mathematics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<br />
<hr class="line_300" /><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Freiburg_software_10_Kristian.jpg" alt="kristian" title="Kristian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Kristian Müller<br /><br />
<span class="team_bolder">Field of study:</span> Biology Dr.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/Freiburg_software_10_katja.jpg" alt="katja" title="Katja" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Katja Arndt<br /><br />
<span class="team_bolder">Field of study:</span> Biology Prof.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/css_boxesTeam:Freiburg Software/css boxes2010-10-27T22:05:27Z<p>Faha: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
/* Main area */<br />
<br />
#main_area {<br />
float: right;<br />
width: 780px;<br />
height: auto;<br />
margin: 0px 0px 0px 0px;<br />
background: #666666;<br />
}<br />
<br />
/* Box User */<br />
<br />
.box_robot {<br />
margin: 0px 20px 250px 15px;<br />
width: 200px;<br />
height: 215px;<br />
float: right;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
<br />
/* Box guide */<br />
<br />
.box_guide a {<br />
float: left;<br />
width: 750px;<br />
margin: 10px 5px 10px 5px;<br />
height: 120px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_guide a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.pic_text_right {<br />
margin: 5px 20px 5px 15px;<br />
float: right;<br />
text-align: left;<br />
}<br />
.pic_text_center {<br />
margin: 5px 15px 5px 15px;<br />
align: center;<br />
text-align: center;<br />
}<br />
.pic_text_left {<br />
margin: 5px 15px 5px 20px;<br />
float: left;<br />
text-align: left;<br />
}<br />
<br />
/* Box home */<br />
<br />
.box_home a {<br />
margin: 20px 20px 20px 20px;<br />
width: 150px;<br />
height: 150px;<br />
float: left;<br />
}<br />
<br />
#color_blue a {<br />
border: 1px outset blue;<br />
}<br />
#color_blue a:hover {<br />
border: 1px inset blue;<br />
text-decoration: none;<br />
}<br />
#color_red a {<br />
border: 1px outset red;<br />
}<br />
#color_red a:hover {<br />
border: 1px inset red;<br />
text-decoration: none;<br />
}<br />
#color_yellow a {<br />
border: 1px outset yellow;<br />
}<br />
#color_yellow a:hover {<br />
border: 1px inset yellow;<br />
text-decoration: none;<br />
}<br />
#color_green a {<br />
border: 1px outset green;<br />
}<br />
#color_green a:hover {<br />
border: 1px inset green;<br />
text-decoration: none;<br />
}<br />
<br />
/* Box Team */<br />
<br />
.box_team a {<br />
margin: 20px 20px 20px 30px;<br />
width: 200px;<br />
height: 200px;<br />
float: left;<br />
background: #777777;<br />
border: 2px groove #777777;<br />
}<br />
.box_team a:hover {<br />
border: 2px inset #777777;<br />
background-color: #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.box_team_750 {<br />
margin: 15px 15px 5px 15px;<br />
width: 750px;<br />
height: auto;<br />
float: left;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
.team_description {<br />
margin: 15px 0px 15px 0px;<br />
width: 500px;<br />
height: auto;<br />
border: none;<br />
background: transparent;<br />
float: left;<br />
vertical-align: top;<br />
color: white;<br />
}<br />
<br />
.picasa {<br />
width: 600px;<br />
height: 400px;<br />
margin: 20px 20px 20px 90px;<br />
}<br />
<br />
/* Box Developer */<br />
<br />
.box_code {<br />
margin: 10px 50px 10px 25px;<br />
background: #eeeeee;<br />
}<br />
<br />
.box_standard a {<br />
float: left;<br />
width: 370px;<br />
margin: 10px 5px 10px 5px;<br />
height: 300px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_standard a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
</style><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/css_boxesTeam:Freiburg Software/css boxes2010-10-27T22:04:41Z<p>Faha: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
/* Main area */<br />
<br />
#main_area {<br />
float: right;<br />
width: 780px;<br />
height: auto;<br />
margin: 0px 0px 0px 0px;<br />
background: #666666;<br />
}<br />
<br />
/* Box User */<br />
<br />
.box_robot {<br />
margin: 0px 20px 250px 15px;<br />
width: 200px;<br />
height: 215px;<br />
float: right;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
<br />
/* Box guide */<br />
<br />
.box_guide a {<br />
float: left;<br />
width: 750px;<br />
margin: 10px 5px 10px 5px;<br />
height: 120px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_guide a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.pic_text_right {<br />
margin: 5px 20px 5px 15px;<br />
float: right;<br />
text-align: left;<br />
}<br />
.pic_text_center {<br />
margin: 5px 15px 5px 15px;<br />
align: center;<br />
text-align: center;<br />
}<br />
.pic_text_left {<br />
margin: 5px 15px 5px 20px;<br />
float: left;<br />
text-align: left;<br />
}<br />
<br />
/* Box home */<br />
<br />
.box_home a {<br />
margin: 20px 20px 20px 20px;<br />
width: 150px;<br />
height: 150px;<br />
float: left;<br />
}<br />
<br />
#color_blue a {<br />
border: 1px outset blue;<br />
}<br />
#color_blue a:hover {<br />
border: 1px inset blue;<br />
text-decoration: none;<br />
}<br />
#color_red a {<br />
border: 1px outset red;<br />
}<br />
#color_red a:hover {<br />
border: 1px inset red;<br />
text-decoration: none;<br />
}<br />
#color_yellow a {<br />
border: 1px outset yellow;<br />
}<br />
#color_yellow a:hover {<br />
border: 1px inset yellow;<br />
text-decoration: none;<br />
}<br />
#color_green a {<br />
border: 1px outset green;<br />
}<br />
#color_green a:hover {<br />
border: 1px inset green;<br />
text-decoration: none;<br />
}<br />
<br />
/* Box Team */<br />
<br />
.box_team a {<br />
margin: 20px 20px 20px 30px;<br />
width: 200px;<br />
height: 200px;<br />
float: left;<br />
background: #777777;<br />
border: 2px groove #777777;<br />
}<br />
.box_team a:hover {<br />
border: 2px inset #777777;<br />
background-color: #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.box_team_750 {<br />
margin: 15px 15px 5px 15px;<br />
width: 750px;<br />
height: auto;<br />
float: left;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
.team_description {<br />
margin: 15px 15px 15px 15px;<br />
width: 500px;<br />
height: auto;<br />
border: none;<br />
background: transparent;<br />
float: left;<br />
vertical-align: top;<br />
color: white;<br />
}<br />
<br />
.picasa {<br />
width: 600px;<br />
height: 400px;<br />
margin: 20px 20px 20px 90px;<br />
}<br />
<br />
/* Box Developer */<br />
<br />
.box_code {<br />
margin: 10px 50px 10px 25px;<br />
background: #eeeeee;<br />
}<br />
<br />
.box_standard a {<br />
float: left;<br />
width: 370px;<br />
margin: 10px 5px 10px 5px;<br />
height: 300px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_standard a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
</style><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/css_fontTeam:Freiburg Software/css font2010-10-27T22:04:03Z<p>Faha: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
/* Font */<br />
<br />
p {<br />
color: white;<br />
margin: 0px 0px 0px 5px;<br />
}<br />
<br />
ul {<br />
color: white;<br />
}<br />
<br />
code {<br />
background: #cccccc;<br />
color: black;<br />
}<br />
<br />
p.main {<br />
font-size: 12px;<br />
color: white;<br />
text-align: justify;<br />
margin: 15px 15px 15px 25px; <br />
}<br />
<br />
p.caption {<br />
text-align: left;<br />
font-size: 11px;<br />
color: white;<br />
font-style: italic;<br />
text-align: justify;<br />
margin: 5px 5px 5px 5px; <br />
}<br />
<br />
h1, h2, h3, h4, h5 {<br />
color: white;<br />
font-weight: bold;<br />
text-decoration: none;<br />
border: none;<br />
}<br />
<br />
h1 {<br />
margin: 20px 15px 15px 15px;<br />
font-size: 18px;<br />
}<br />
<br />
h2 {<br />
margin: 15px 10px 10px 20px;<br />
font-size: 16px;<br />
}<br />
<br />
h3 {<br />
margin: 15px 10px 10px 25px;<br />
font-size: 12px;<br />
font-weight: bolder;<br />
}<br />
<br />
<br />
h5 {<br />
margin: 5px 5px 5px 5px;<br />
font-size: 12px;<br />
text-align: center;<br />
text-decoration: none;<br />
}<br />
<br />
p a {<br />
color: yellow;<br />
}<br />
p a:visited {<br />
color: #ffff77;<br />
}<br />
<br />
.team_bolder {<br />
font-weight: bolder;<br />
vertical-align: top;<br />
}<br />
</style></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/css_boxesTeam:Freiburg Software/css boxes2010-10-27T22:02:00Z<p>Faha: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
/* Main area */<br />
<br />
#main_area {<br />
float: right;<br />
width: 780px;<br />
height: auto;<br />
margin: 0px 0px 0px 0px;<br />
background: #666666;<br />
}<br />
<br />
/* Box User */<br />
<br />
.box_robot {<br />
margin: 0px 20px 250px 15px;<br />
width: 200px;<br />
height: 215px;<br />
float: right;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
<br />
/* Box guide */<br />
<br />
.box_guide a {<br />
float: left;<br />
width: 750px;<br />
margin: 10px 5px 10px 5px;<br />
height: 120px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_guide a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.pic_text_right {<br />
margin: 5px 20px 5px 15px;<br />
float: right;<br />
text-align: left;<br />
}<br />
.pic_text_center {<br />
margin: 5px 15px 5px 15px;<br />
align: center;<br />
text-align: center;<br />
}<br />
.pic_text_left {<br />
margin: 5px 15px 5px 20px;<br />
float: left;<br />
text-align: left;<br />
}<br />
<br />
/* Box home */<br />
<br />
.box_home a {<br />
margin: 20px 20px 20px 20px;<br />
width: 150px;<br />
height: 150px;<br />
float: left;<br />
}<br />
<br />
#color_blue a {<br />
border: 1px outset blue;<br />
}<br />
#color_blue a:hover {<br />
border: 1px inset blue;<br />
text-decoration: none;<br />
}<br />
#color_red a {<br />
border: 1px outset red;<br />
}<br />
#color_red a:hover {<br />
border: 1px inset red;<br />
text-decoration: none;<br />
}<br />
#color_yellow a {<br />
border: 1px outset yellow;<br />
}<br />
#color_yellow a:hover {<br />
border: 1px inset yellow;<br />
text-decoration: none;<br />
}<br />
#color_green a {<br />
border: 1px outset green;<br />
}<br />
#color_green a:hover {<br />
border: 1px inset green;<br />
text-decoration: none;<br />
}<br />
<br />
/* Box Team */<br />
<br />
.box_team a {<br />
margin: 20px 20px 20px 30px;<br />
width: 200px;<br />
height: 200px;<br />
float: left;<br />
background: #777777;<br />
border: 2px groove #777777;<br />
}<br />
.box_team a:hover {<br />
border: 2px inset #777777;<br />
background-color: #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.box_team_750 {<br />
margin: 15px 15px 5px 15px;<br />
width: 750px;<br />
height: auto;<br />
float: left;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
.team_description {<br />
margin: 15px 15px 15px 15px;<br />
width: 450px;<br />
height: auto;<br />
border: none;<br />
background: transparent;<br />
float: left;<br />
vertical-align: top;<br />
color: white;<br />
}<br />
<br />
.picasa {<br />
width: 600px;<br />
height: 400px;<br />
margin: 20px 20px 20px 90px;<br />
}<br />
<br />
/* Box Developer */<br />
<br />
.box_code {<br />
margin: 10px 50px 10px 25px;<br />
background: #eeeeee;<br />
}<br />
<br />
.box_standard a {<br />
float: left;<br />
width: 370px;<br />
margin: 10px 5px 10px 5px;<br />
height: 300px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_standard a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
</style><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/css_boxesTeam:Freiburg Software/css boxes2010-10-27T21:58:59Z<p>Faha: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
/* Main area */<br />
<br />
#main_area {<br />
float: right;<br />
width: 780px;<br />
height: auto;<br />
margin: 0px 0px 0px 0px;<br />
background: #666666;<br />
}<br />
<br />
/* Box User */<br />
<br />
.box_robot {<br />
margin: 0px 20px 250px 15px;<br />
width: 200px;<br />
height: 215px;<br />
float: right;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
<br />
/* Box guide */<br />
<br />
.box_guide a {<br />
float: left;<br />
width: 750px;<br />
margin: 10px 5px 10px 5px;<br />
height: 120px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_guide a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.pic_text_right {<br />
margin: 5px 20px 5px 15px;<br />
float: right;<br />
text-align: left;<br />
}<br />
.pic_text_center {<br />
margin: 5px 15px 5px 15px;<br />
align: center;<br />
text-align: center;<br />
}<br />
.pic_text_left {<br />
margin: 5px 15px 5px 20px;<br />
float: left;<br />
text-align: left;<br />
}<br />
<br />
/* Box home */<br />
<br />
.box_home a {<br />
margin: 20px 20px 20px 20px;<br />
width: 150px;<br />
height: 150px;<br />
float: left;<br />
}<br />
<br />
#color_blue a {<br />
border: 1px outset blue;<br />
}<br />
#color_blue a:hover {<br />
border: 1px inset blue;<br />
text-decoration: none;<br />
}<br />
#color_red a {<br />
border: 1px outset red;<br />
}<br />
#color_red a:hover {<br />
border: 1px inset red;<br />
text-decoration: none;<br />
}<br />
#color_yellow a {<br />
border: 1px outset yellow;<br />
}<br />
#color_yellow a:hover {<br />
border: 1px inset yellow;<br />
text-decoration: none;<br />
}<br />
#color_green a {<br />
border: 1px outset green;<br />
}<br />
#color_green a:hover {<br />
border: 1px inset green;<br />
text-decoration: none;<br />
}<br />
<br />
/* Box Team */<br />
<br />
.box_team a {<br />
margin: 20px 20px 20px 30px;<br />
width: 200px;<br />
height: 200px;<br />
float: left;<br />
background: #777777;<br />
border: 2px groove #777777;<br />
}<br />
.box_team a:hover {<br />
border: 2px inset #777777;<br />
background-color: #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.box_team_750 {<br />
margin: 15px 15px 5px 15px;<br />
width: 750px;<br />
height: auto;<br />
float: left;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
.team_description {<br />
margin: 15px 15px 15px 15px;<br />
width: 450px;<br />
height: auto;<br />
border: none;<br />
background: transparent;<br />
float: left;<br />
vertical-align: top;<br />
}<br />
<br />
.picasa {<br />
width: 600px;<br />
height: 400px;<br />
margin: 20px 20px 20px 90px;<br />
}<br />
<br />
/* Box Developer */<br />
<br />
.box_code {<br />
margin: 10px 50px 10px 25px;<br />
background: #eeeeee;<br />
}<br />
<br />
.box_standard a {<br />
float: left;<br />
width: 370px;<br />
margin: 10px 5px 10px 5px;<br />
height: 300px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_standard a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
</style><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/css_boxesTeam:Freiburg Software/css boxes2010-10-27T21:58:12Z<p>Faha: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
/* Main area */<br />
<br />
#main_area {<br />
float: right;<br />
width: 780px;<br />
height: auto;<br />
margin: 0px 0px 0px 0px;<br />
background: #666666;<br />
}<br />
<br />
/* Box User */<br />
<br />
.box_robot {<br />
margin: 0px 20px 250px 15px;<br />
width: 200px;<br />
height: 215px;<br />
float: right;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
<br />
/* Box guide */<br />
<br />
.box_guide a {<br />
float: left;<br />
width: 750px;<br />
margin: 10px 5px 10px 5px;<br />
height: 120px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_guide a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.pic_text_right {<br />
margin: 5px 20px 5px 15px;<br />
float: right;<br />
text-align: left;<br />
}<br />
.pic_text_center {<br />
margin: 5px 15px 5px 15px;<br />
align: center;<br />
text-align: center;<br />
}<br />
.pic_text_left {<br />
margin: 5px 15px 5px 20px;<br />
float: left;<br />
text-align: left;<br />
}<br />
<br />
/* Box home */<br />
<br />
.box_home a {<br />
margin: 20px 20px 20px 20px;<br />
width: 150px;<br />
height: 150px;<br />
float: left;<br />
}<br />
<br />
#color_blue a {<br />
border: 1px outset blue;<br />
}<br />
#color_blue a:hover {<br />
border: 1px inset blue;<br />
text-decoration: none;<br />
}<br />
#color_red a {<br />
border: 1px outset red;<br />
}<br />
#color_red a:hover {<br />
border: 1px inset red;<br />
text-decoration: none;<br />
}<br />
#color_yellow a {<br />
border: 1px outset yellow;<br />
}<br />
#color_yellow a:hover {<br />
border: 1px inset yellow;<br />
text-decoration: none;<br />
}<br />
#color_green a {<br />
border: 1px outset green;<br />
}<br />
#color_green a:hover {<br />
border: 1px inset green;<br />
text-decoration: none;<br />
}<br />
<br />
/* Box Team */<br />
<br />
.box_team a {<br />
margin: 20px 20px 20px 30px;<br />
width: 200px;<br />
height: 200px;<br />
float: left;<br />
background: #777777;<br />
border: 2px groove #777777;<br />
}<br />
.box_team a:hover {<br />
border: 2px inset #777777;<br />
background-color: #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.box_team_750 {<br />
margin: 15px 15px 5px 15px;<br />
width: 750px;<br />
height: auto;<br />
float: left;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
.team_description {<br />
margin: 15px 15px 15px 15px;<br />
width: 450px;<br />
height: auto;<br />
border: none;<br />
background: transparent;<br />
float: left;<br />
}<br />
<br />
.picasa {<br />
width: 600px;<br />
height: 400px;<br />
margin: 20px 20px 20px 90px;<br />
}<br />
<br />
/* Box Developer */<br />
<br />
.box_code {<br />
margin: 10px 50px 10px 25px;<br />
background: #eeeeee;<br />
}<br />
<br />
.box_standard a {<br />
float: left;<br />
width: 370px;<br />
margin: 10px 5px 10px 5px;<br />
height: 300px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_standard a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
</style><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/Team/2010Team:Freiburg Software/Team/20102010-10-27T21:57:16Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/head}}<br />
<br />
<html><br />
<!-- page special style --><br />
<br />
<style type="text/css"><br />
<br />
#subTeam2010 a {<br />
opacity: 0.92;<br />
color: white;<br />
}<br />
<br />
</style><br />
<br />
<div id=main_area><br />
<h1>Team 2010</h1><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a0/Freiburg_software_10_Niklas.jpg" alt="niklas" title="Niklas" class="team_portrait" /><br />
<br />
<table class="team_description"><br />
<tr><br />
<td class="team_bolder">Name:</td><br />
<td class="color: white;">Niklas Meinzer</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><br />
<td class="color: white;">Computer science (Bioinformatics)</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><br />
<td class="color: white;">Create Robots, developing library</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><br />
<td class="color: white;"><i>Fabian: </i> You are a "Emmi"-coffee junkie ;) . Had a lot of fun with him in<br />front of our laptops (and I like your music, hehe).<br />
<i>Paresh: </i> My first contact point for doubts about <br />German culture (and sometimes history ;) ).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/27/Freiburg_software_10_Paresh.jpg" alt="paresh" title="Paresh" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Paresh Paradkar<br /><br />
<span class="team_bolder">Field of study:</span> Computer science<br /><br />
<span class="team_bolder">Team Function:</span> Create Robots<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Fabian: </i>He sure is a funny guy!<br />Thanks for helping to improve my English skills.<br /><br />
<i>Niklas: </i>Shares my love for the Big Bang Theory<br /><br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/9/9b/Freiburg_software_10_Fabian.jpg" alt="fabian" title="Fabian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Fabian Haas<br /><br />
<span class="team_bolder">Field of study:</span> Biology<br /><br />
<span class="team_bolder">Team Function:</span> Wiki, Graphics, Organisation<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas:</i> Will probably spend less time on his diploma thesis,<br />than he spent on our logo.<br /><br />
<i>Paresh:</i> He is very helpful and equally cheerful,<br />Has always a smiling face :).<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b3/Freiburg_software_10_Joerg.jpg" alt="joerg" title="Jörg" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Jörg Walossek<br /><br />
<span class="team_bolder">Field of study:</span> Biology, Bioinformatics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming, Bug-hunter<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas: </i>My fellow bug hunter....<br /><br />
<i>Fabian: </i>Jörg, nicht schneutzen, sonst platzt der Bär!!!<br />(Jörg, don't sniff, otherwise the bear will explode!!!)<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2c/Freiburg_software_10_Paul.jpg" alt="paul" title="Paul" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Paul Staab<br /><br />
<span class="team_bolder">Field of study:</span> Mathematics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<br />
<hr class="line_300" /><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Freiburg_software_10_Kristian.jpg" alt="kristian" title="Kristian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Kristian Müller<br /><br />
<span class="team_bolder">Field of study:</span> Biology Dr.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/Freiburg_software_10_katja.jpg" alt="katja" title="Katja" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Katja Arndt<br /><br />
<span class="team_bolder">Field of study:</span> Biology Prof.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/css_boxesTeam:Freiburg Software/css boxes2010-10-27T21:56:55Z<p>Faha: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
/* Main area */<br />
<br />
#main_area {<br />
float: right;<br />
width: 780px;<br />
height: auto;<br />
margin: 0px 0px 0px 0px;<br />
background: #666666;<br />
}<br />
<br />
/* Box User */<br />
<br />
.box_robot {<br />
margin: 0px 20px 250px 15px;<br />
width: 200px;<br />
height: 215px;<br />
float: right;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
<br />
/* Box guide */<br />
<br />
.box_guide a {<br />
float: left;<br />
width: 750px;<br />
margin: 10px 5px 10px 5px;<br />
height: 120px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_guide a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.pic_text_right {<br />
margin: 5px 20px 5px 15px;<br />
float: right;<br />
text-align: left;<br />
}<br />
.pic_text_center {<br />
margin: 5px 15px 5px 15px;<br />
align: center;<br />
text-align: center;<br />
}<br />
.pic_text_left {<br />
margin: 5px 15px 5px 20px;<br />
float: left;<br />
text-align: left;<br />
}<br />
<br />
/* Box home */<br />
<br />
.box_home a {<br />
margin: 20px 20px 20px 20px;<br />
width: 150px;<br />
height: 150px;<br />
float: left;<br />
}<br />
<br />
#color_blue a {<br />
border: 1px outset blue;<br />
}<br />
#color_blue a:hover {<br />
border: 1px inset blue;<br />
text-decoration: none;<br />
}<br />
#color_red a {<br />
border: 1px outset red;<br />
}<br />
#color_red a:hover {<br />
border: 1px inset red;<br />
text-decoration: none;<br />
}<br />
#color_yellow a {<br />
border: 1px outset yellow;<br />
}<br />
#color_yellow a:hover {<br />
border: 1px inset yellow;<br />
text-decoration: none;<br />
}<br />
#color_green a {<br />
border: 1px outset green;<br />
}<br />
#color_green a:hover {<br />
border: 1px inset green;<br />
text-decoration: none;<br />
}<br />
<br />
/* Box Team */<br />
<br />
.box_team a {<br />
margin: 20px 20px 20px 30px;<br />
width: 200px;<br />
height: 200px;<br />
float: left;<br />
background: #777777;<br />
border: 2px groove #777777;<br />
}<br />
.box_team a:hover {<br />
border: 2px inset #777777;<br />
background-color: #888888;<br />
text-decoration: none;<br />
}<br />
<br />
.box_team_750 {<br />
margin: 15px 15px 5px 15px;<br />
width: 750px;<br />
height: auto;<br />
float: left;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
<br />
.team_description {<br />
width: 450px;<br />
height: auto;<br />
border: none;<br />
background: transparent;<br />
float: left;<br />
}<br />
<br />
.picasa {<br />
width: 600px;<br />
height: 400px;<br />
margin: 20px 20px 20px 90px;<br />
}<br />
<br />
/* Box Developer */<br />
<br />
.box_code {<br />
margin: 10px 50px 10px 25px;<br />
background: #eeeeee;<br />
}<br />
<br />
.box_standard a {<br />
float: left;<br />
width: 370px;<br />
margin: 10px 5px 10px 5px;<br />
height: 300px;<br />
background: #777777;<br />
border: 3px groove #777777;<br />
}<br />
.box_standard a:hover {<br />
background: #888888;<br />
border: 3px groove #888888;<br />
text-decoration: none;<br />
}<br />
<br />
</style><br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Software/Team/2010Team:Freiburg Software/Team/20102010-10-27T21:53:14Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Software/head}}<br />
<br />
<html><br />
<!-- page special style --><br />
<br />
<style type="text/css"><br />
<br />
#subTeam2010 a {<br />
opacity: 0.92;<br />
color: white;<br />
}<br />
<br />
</style><br />
<br />
<div id=main_area><br />
<h1>Team 2010</h1><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/a/a0/Freiburg_software_10_Niklas.jpg" alt="niklas" title="Niklas" class="team_portrait" /><br />
<table style="float: right;"><br />
<tr><br />
<td class="team_bolder">Name:</td><br />
<td class="color: white;">Niklas Meinzer</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Field of study:</td><br />
<td class="color: white;">Computer science (Bioinformatics)</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">Team Function:</td><br />
<td class="color: white;">Create Robots, developing library</td><br />
</tr><br />
<tr><br />
<td class="team_bolder">What the others says about me:</td><br />
<td class="color: white;"><i>Fabian: </i> You are a "Emmi"-coffee junkie ;) . Had a lot of fun with him in<br />front of our laptops (and I like your music, hehe).<br />
<i>Paresh: </i> My first contact point for doubts about <br />German culture (and sometimes history ;) ).</td><br />
</tr><br />
</table><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/27/Freiburg_software_10_Paresh.jpg" alt="paresh" title="Paresh" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Paresh Paradkar<br /><br />
<span class="team_bolder">Field of study:</span> Computer science<br /><br />
<span class="team_bolder">Team Function:</span> Create Robots<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Fabian: </i>He sure is a funny guy!<br />Thanks for helping to improve my English skills.<br /><br />
<i>Niklas: </i>Shares my love for the Big Bang Theory<br /><br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/9/9b/Freiburg_software_10_Fabian.jpg" alt="fabian" title="Fabian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Fabian Haas<br /><br />
<span class="team_bolder">Field of study:</span> Biology<br /><br />
<span class="team_bolder">Team Function:</span> Wiki, Graphics, Organisation<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas:</i> Will probably spend less time on his diploma thesis,<br />than he spent on our logo.<br /><br />
<i>Paresh:</i> He is very helpful and equally cheerful,<br />Has always a smiling face :).<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b3/Freiburg_software_10_Joerg.jpg" alt="joerg" title="Jörg" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Jörg Walossek<br /><br />
<span class="team_bolder">Field of study:</span> Biology, Bioinformatics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming, Bug-hunter<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
<i>Niklas: </i>My fellow bug hunter....<br /><br />
<i>Fabian: </i>Jörg, nicht schneutzen, sonst platzt der Bär!!!<br />(Jörg, don't sniff, otherwise the bear will explode!!!)<br />
</p><br />
</div><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/2/2c/Freiburg_software_10_Paul.jpg" alt="paul" title="Paul" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Paul Staab<br /><br />
<span class="team_bolder">Field of study:</span> Mathematics<br /><br />
<span class="team_bolder">Team Function:</span> API-Programming<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<br />
<hr class="line_300" /><br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/d/df/Freiburg_software_10_Kristian.jpg" alt="kristian" title="Kristian" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Kristian Müller<br /><br />
<span class="team_bolder">Field of study:</span> Biology Dr.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
<br />
<div class="box_team_750"><br />
<img src="https://static.igem.org/mediawiki/2010/b/b4/Freiburg_software_10_katja.jpg" alt="katja" title="Katja" class="team_portrait" /><br />
<p class="main" style="float: left;"><br />
<span class="team_bolder">Name:</span> Katja Arndt<br /><br />
<span class="team_bolder">Field of study:</span> Biology Prof.<br /><br />
<span class="team_bolder">Team Function:</span> Administration<br /><br />
<span class="team_bolder">What the others says about me:</span><br /><br />
</p><br />
</div><br />
<br />
</div><br />
<br />
</html></div>Fahahttp://2010.igem.org/Team:Freiburg_Bioware/Team/CollaborationTeam:Freiburg Bioware/Team/Collaboration2010-10-27T21:42:30Z<p>Faha: </p>
<hr />
<div>{{:Team:Freiburg_Bioware/Head}} <br />
{{:Team:Freiburg_Bioware/jquery}}<br />
{{:Team:Freiburg_Bioware/menu_home}}<br />
<br />
<html><br />
<h1>Collaboration</h1><br />
<h2><span lang="EN-US">Collaboration with iGEM headquarters</span></h2><br />
<p class="MsoNormal" style="text-align: justify;"><span lang="EN-US">In<br />
addition to<br />
the usual team collaborations, we communicated with the iGEM<br />
headquarters and<br />
pointed out that we had difficulties with the pSB1C3 plasmid vector<br />
sequence. A<br />
restriction digest of the backbone yielded more fragments than<br />
expected.<br />
Therefore we sequenced the whole backbone and found 7 mutations.<br />
Although the<br />
vector replicated fine and the antibiotic resistance was functional, we<br />
feared potential<br />
future problems and sent the correct sequence to the iGEM headquarters.<br />
Based<br />
on these findings iGEM headquarters introduced versioning of the<br />
plasmid<br />
backbones and our pSB1C3 was named pSB1C3_001.<br />
<br><br />
<p class="MsoNormal"<br />
style="margin-bottom: 0.0001pt; text-align: justify;"><span<br />
lang="EN-US">Mutations in the pSB1C3 backbone:</span></p><br />
<br><br />
<img<br />
src="https://static.igem.org/mediawiki/2010/e/e6/Freiburg10_pSB1C3_mutations.png" width="600"><br />
<p class="MsoNormal"> </p><br />
<h2><span lang="EN-US">Collaboration with the iGEM 2010 Team<br />
ESBS-Strasbourg</span></h2><br />
<p class="MsoNormal"<br />
style="margin-bottom: 0.0001pt; text-align: justify;"><span<br />
lang="EN-US">We established a collaboration with the iGEM 2010<br />
Team ESBS-Strasbourg, who asked for our assembled Biobricks of YFP and<br />
CFP<br />
cloned into the standard pSB1C3 backbone. We sent out the plasmids so<br />
that they<br />
could use and test the plasmids for their cloning purposes. To expand<br />
our<br />
collaboration, the Strasbourg team visited us at our laboratory. Both<br />
teams<br />
made a presentation of their project and exchanged impressions and<br />
ideas about<br />
iGEM and the daily laboratory work. After that, we spent time together<br />
having a<br />
nice barbecue. </span></p><br />
<br><br />
<table style="text-align: left; width: 90%;" border="0" cellpadding="2"<br />
cellspacing="2"><br />
<tbody><br />
<tr><br />
<td style="vertical-align: top;"><img<br />
src="https://static.igem.org/mediawiki/2010/5/5a/Freiburg10_Logo_Team_ESBS-Strasbourg.jpg" width="160"></td><br />
<td style="vertical-align: top;"><br />
<embed type="application/x-shockwave-flash"<br />
src="http://picasaweb.google.com/s/c/bin/slideshow.swf"<br />
flashvars="host=picasaweb.google.com&amp;hl=de&amp;feat=flashalbum&amp;RGB=0x000000&amp;feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5516756369958846513%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCJrAlpPV3cnrMg%26hl%3Dde"<br />
pluginspage="http://www.macromedia.com/go/getflashplayer" height="320"<br />
width="420"><br><br />
</td><br />
</tr><br />
</tbody><br />
</table><br />
<br><br />
<p class="MsoNormal"<br />
style="margin-bottom: 0.0001pt; text-align: justify;"><span<br />
lang="EN-US">&nbsp;</span></p><br />
<br><br />
<h2 style="text-align: justify;"><span lang="EN-US">Collaboration with<br />
the iGEM<br />
2010 Team Freiburg Software</span></h2><br />
<p class="MsoNormal"<br />
style="margin-bottom: 0.0001pt; text-align: justify;"><span<br />
lang="EN-US">The <a href="https://2010.igem.org/Team:Freiburg_Software/Team/Collaboration">Software Team Freiburg</a> programmed Add-on robots<br />
for many applications and could offer us some useful features for our<br />
cloning<br />
approaches. One of them is for example a primer designer. The primers<br />
are<br />
designed by choosing the melting temperature and the binding site of<br />
the<br />
template sequence. The robot finally creates the sequence of the<br />
forward primer<br />
(Primer 1) and the reverse Primer (Primer 2). Furthermore, the Software<br />
Team<br />
supported us in the design and coding of our homepage. In return, our<br />
team helped<br />
with information about biological interests and cloning procedures and<br />
organized the t-shirts and the trip to Boston.</span></p><br />
<p class="MsoNormal"<br />
style="margin-bottom: 0.0001pt; text-align: justify;"><span<br />
lang="EN-US">Example for the functioning of the primer designer<br />
robot:</span></p><br />
<br><br />
<img<br />
src="https://static.igem.org/mediawiki/2010/2/21/Freiburg10_Primer_designer_Example.jpg" width="700"><br />
<p class="MsoNormal"<br />
style="margin-bottom: 0.0001pt; text-align: justify;"><span<br />
lang="EN-US">&nbsp;</span></p><br />
<p class="MsoNormal"<br />
style="margin-bottom: 0.0001pt; text-align: justify;"><span<br />
lang="EN-US">&nbsp;</span></p><br />
<h2><span lang="EN-US">Collaboration with the iGEM 2010 Team Stockholm </span></h2><br />
<img<br />
src="https://static.igem.org/mediawiki/2010/2/21/Freiburg10_Logo_iGEM_Stockholm.png" width="200"><br />
<p class="MsoNormal"<br />
style="margin-bottom: 0.0001pt; text-align: justify;"><span<br />
lang="EN-US">The iGEM Team Stockholm 2010 was interested in using the<br />
Freiburg standard 25 and contacted us in order to get information about<br />
cloning<br />
vectors from our stocks concerning the three pSB1X3-derived<br />
BBa_J18901-3<br />
plasmids, as well as the pMA (-BBRF) vector (BBa_K157000) available in<br />
the<br />
Registry. We made the advice that the Freiburg iGEM 2009 team last year<br />
used<br />
the pMA vector for almost all cloning steps. The plasmid is small and<br />
delivers<br />
high yields of plasmid DNA. In comparison to that the larger<br />
BBa_J18901-3<br />
plasmids carry two antibiotic resistances making the part assembly more<br />
restricted.</span></p><br />
<br><br />
<h2 style="text-align: justify;"><span lang="EN-US">Community outreach<br />
in collaboration with BIOSS and<br />
Europa Park</span></h2><br />
<img<br />
src="https://static.igem.org/mediawiki/2010/6/65/Freiburg10_Logo_BIOSS.jpg" width="300"><br />
<img<br />
src="https://static.igem.org/mediawiki/2010/f/f2/Freiburg10_Logo_Europapark.jpg" width="300"><br />
<p class="MsoNormal" style="text-align: justify;"><span lang="EN-US">The<br />
sience days at Europa Park take place every year making sciences<br />
attractive for young people. Pupils of different ages take a look in<br />
sciences by doing practical experiments and playing games.<br />
In association with BIOSS we prepared a game for the younger kids, in<br />
which they could actively join in. The game gives the kids an<br />
imagination about a cells inner life by playing the role of kinases,<br />
phosphatases and signalling proteins. In addition, we made<br />
questionaires and tested the knowledge of the pupils in biology.<br />
<br><br />
<br><br />
Here you can download the game instruction and the questionary:<br />
<br><br />
<br><br />
<a<br />
href="https://static.igem.org/mediawiki/2010/a/a0/Freiburg10_Cell_signalling_game.pdf">Instruction<br />
for cell signalling game</a><br />
<br><br />
<a<br />
href="https://static.igem.org/mediawiki/2010/3/3a/Freiburg10_Europa_Park_Questionaires.pdf">Questionary</a><br />
<p class="MsoNormal"><br><br />
<br><br />
</p><br />
<div style="float: right; width: 480px; height: auto;"><br />
<embed type="application/x-shockwave-flash"<br />
src="http://picasaweb.google.com/s/c/bin/slideshow.swf"<br />
flashvars="host=picasaweb.google.com&amp;hl=de&amp;feat=flashalbum&amp;RGB=0x000000&amp;feed=http%3A%2F%2Fpicasaweb.google.com%2Fdata%2Ffeed%2Fapi%2Fuser%2FIGEM.Freiburg.2010%2Falbumid%2F5531959655935087601%3Falt%3Drss%26kind%3Dphoto%26authkey%3DGv1sRgCPO1_Zq7kPbXIg%26hl%3Dde"<br />
pluginspage="http://www.macromedia.com/go/getflashplayer" height="320"<br />
width="420"></div><br />
</span></p><br />
</span></p><br />
</html><br />
<br />
{{:Team:Freiburg_Bioware/Footer}}</div>Faha