http://2010.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=250&target=Cathterry&year=&month=2010.igem.org - User contributions [en]2024-03-28T10:28:53ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:Peking/Notebook/Protocols/SDS%26WBTeam:Peking/Notebook/Protocols/SDS&WB2011-01-14T13:36:14Z<p>Cathterry: /* SDS-PAGE Protocol */</p>
<hr />
<div>{{:Team:Peking/Headernotebook}}<br />
{{:Team:Peking/boxes}}<br />
{{:Team:Peking/boxesII}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="ttrans"><br />
<br><br><br />
<font size=5><font color=#484848><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Protocol by PKU 2010</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Notebook|Notebook]] > [[Team:Peking/Notebook/Protocols|Protocols]] > [[Team:Peking/Notebook/Protocols/SDS%26WB|SDS-PAGE & Western Blot protocol]]<html><br />
</div><br />
<br />
<br />
<div id="middletrans"><br />
</html><br />
==SDS-PAGE Protocol==<br />
1. Selection of a SDS-PAGE gel. Typically 10% acrylamide gels are used for high molecular weight (MW) proteins (>50 kDa), 12% gels for mid range MW proteins (15 - 50 kDa), and 15% gels for low MW proteins (<15 kDa). Load 5 ul marker or 20 ul protein sample each lane.<br />
<br />
<br />
2. Run at 80V until samples enter the separation gel in gel running buffer (19.3 mM Glycine, 2.5 mM Tris base, 0.1% SDS), and then run at 120V. Electrophoresis is complete when the dye front migrates about 2 mm from the bottom of the gel..<br />
<br />
<br />
3. Stain with Coomassie brilliant blue for 1 h, and then destain in destain buffer (50% H2O, 20% AcOH, 30% methanol) for 1h.<br />
<br />
==Western Blot Protocol==<br />
1. After loading 5 ul prestained protein marker or 20 ul His-Tag fusion protein sample each lane, run SDS-PAGE (without staining). <br />
<br />
<br />
2. Cut a piece of PVDF membrane and wet in 10 ml methanol for 5 min. Then add 40 ml distilled water and shake for 10 min. Transfer PVDF membrane to western transfer buffer (39 mM glycine, 48 mM Tris base, 0.037% SDS, 20% methanol)untill use.<br />
<br />
<br />
3. Balance the gel and two holders in western transfer buffer for 10 min.<br />
<br />
<br />
4. Assemble "sanwich":<br />
<br />
Black (negative charge)-holder-gel-membrane-holder-red (positive charge)<br />
<br />
<br />
5. Transfer at 20 mA/lane for 20 min.<br />
<br />
<br />
6. Wash membrane for 10 min, with 15 ml 1X TBS (150 mM NaCl, 20 mM Tris-HCl pH7.5) <br />
<br />
<br />
7. Incubate for 1 h in 27 ml blocking buffer (dissolve 5% skimmed milk powder in TTBS (dissolve 0.1% Tween20 in TBS)).<br />
<br />
<br />
8. Wash three times, each for 10 min, with 20 ml TTBS. <br />
<br />
<br />
9. Incubate for 1 h in His-Tag Monoclonal Antibody diluted 1:800 in blocking buffer.<br />
<br />
<br />
10. Wash three times, each for 10 min, with 20 ml TTBS. <br />
<br />
<br />
11. Incubate for 1 h with Rabbit anti-Mouse IgG AP Conjugate diluted 1:800 in blocking buffer.<br />
<br />
<br />
12. Wash three times, each for 10 min, with 20 ml TTBS. <br />
<br />
<br />
13. Prepare developing solution by adding 60 μl NBT solution and 60 μl BCIP solution to 15 ml AP buffer.<br />
<br />
<br />
14. Place membrane in clean tray and add developing solution. Incubate membrane at room temperature until color <br />
develops. Strong purple signals should appear within 2–10 min.<br />
<br />
<br />
15. To stop reaction, wash blot thoroughly in deionized water. Allow to air dry. Store dry blots at room temperature wrapped in plastic.<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomtrans"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Notebook/Protocols/SDS%26WBTeam:Peking/Notebook/Protocols/SDS&WB2011-01-14T13:36:01Z<p>Cathterry: /* SDS-PAGE Protocol */</p>
<hr />
<div>{{:Team:Peking/Headernotebook}}<br />
{{:Team:Peking/boxes}}<br />
{{:Team:Peking/boxesII}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="ttrans"><br />
<br><br><br />
<font size=5><font color=#484848><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Protocol by PKU 2010</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Notebook|Notebook]] > [[Team:Peking/Notebook/Protocols|Protocols]] > [[Team:Peking/Notebook/Protocols/SDS%26WB|SDS-PAGE & Western Blot protocol]]<html><br />
</div><br />
<br />
<br />
<div id="middletrans"><br />
</html><br />
==SDS-PAGE Protocol==<br />
1. Selection of a SDS-PAGE gel. Typically 10% acrylamide gels are used for high molecular weight (MW) proteins (>50 kDa), 12% gels for mid range MW proteins (15 - 50 kDa), and 15% gels for low MW proteins (<15 kDa). Load 5 ul marker or 20 ul protein sample each lane.<br />
<br />
<br />
2. Run at 80V until samples enter the separation gel in gel running buffer (19.3 mM Glycine, 2.5 mM Tris base, 0.1% SDS), and then run at 120V. Electrophoresis is complete when the dye front migrates about 2 mm from the bottom of the gel..<br />
<br />
<br />
3. Stain with Coomassie brilliant blue for 1 h, and then destain in destain buffer (50% H2O, 20% AcOH, 30% methanol) for 1h.<br />
<br />
I AM SB<br />
<br />
==Western Blot Protocol==<br />
1. After loading 5 ul prestained protein marker or 20 ul His-Tag fusion protein sample each lane, run SDS-PAGE (without staining). <br />
<br />
<br />
2. Cut a piece of PVDF membrane and wet in 10 ml methanol for 5 min. Then add 40 ml distilled water and shake for 10 min. Transfer PVDF membrane to western transfer buffer (39 mM glycine, 48 mM Tris base, 0.037% SDS, 20% methanol)untill use.<br />
<br />
<br />
3. Balance the gel and two holders in western transfer buffer for 10 min.<br />
<br />
<br />
4. Assemble "sanwich":<br />
<br />
Black (negative charge)-holder-gel-membrane-holder-red (positive charge)<br />
<br />
<br />
5. Transfer at 20 mA/lane for 20 min.<br />
<br />
<br />
6. Wash membrane for 10 min, with 15 ml 1X TBS (150 mM NaCl, 20 mM Tris-HCl pH7.5) <br />
<br />
<br />
7. Incubate for 1 h in 27 ml blocking buffer (dissolve 5% skimmed milk powder in TTBS (dissolve 0.1% Tween20 in TBS)).<br />
<br />
<br />
8. Wash three times, each for 10 min, with 20 ml TTBS. <br />
<br />
<br />
9. Incubate for 1 h in His-Tag Monoclonal Antibody diluted 1:800 in blocking buffer.<br />
<br />
<br />
10. Wash three times, each for 10 min, with 20 ml TTBS. <br />
<br />
<br />
11. Incubate for 1 h with Rabbit anti-Mouse IgG AP Conjugate diluted 1:800 in blocking buffer.<br />
<br />
<br />
12. Wash three times, each for 10 min, with 20 ml TTBS. <br />
<br />
<br />
13. Prepare developing solution by adding 60 μl NBT solution and 60 μl BCIP solution to 15 ml AP buffer.<br />
<br />
<br />
14. Place membrane in clean tray and add developing solution. Incubate membrane at room temperature until color <br />
develops. Strong purple signals should appear within 2–10 min.<br />
<br />
<br />
15. To stop reaction, wash blot thoroughly in deionized water. Allow to air dry. Store dry blots at room temperature wrapped in plastic.<br />
<br />
<br />
<br />
<br />
<br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomtrans"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Notebook/WYWangTeam:Peking/Notebook/WYWang2010-10-28T01:47:55Z<p>Cathterry: /* 8.14 */</p>
<hr />
<div>{{:Team:Peking/Headernotebook}}<br />
{{:Team:Peking/boxes}}<br />
__NOTOC__<br />
<br />
<br />
<html><br />
<div id="Notebook Title"><br />
<div id="topgreen"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Weiye Wang's Notes</font></font></font><br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="https://2010.igem.org/Team:Peking/Team/WYWang"><img src="https://static.igem.org/mediawiki/2010/a/a9/Wwy.jpg" width="40px" alt="goto her page"id="imggreen"> </a><br />
<!--<br><br><br><br />
<font color=#FFFFFF><font size=4><b>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Haoqian Zhang</b></font></font>--><br />
<br />
<br />
</div><br />
<br />
<div id="notebook home"><br />
<div id="middlegreen"><br />
<font color=#ffffff><br />
</html><br />
<br />
My wetlab mission is to select a T3 promoter with medium expression level from T3 phage genome: Constructing 3 multi-plasmid systems, using IPTG, mercury and arabinose as the inducer of T3 polymerase’s expression, so that to characterize the response properties of these T3 polymerase dependent promoters. The design and construction of our team's wiki is also under my charge.<br />
<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2010/9/91/PKU_Adobe_Reader_Logo.jpg" width=20><br />
<a href="https://static.igem.org/mediawiki/2010/7/75/Lab_Notes-WWY.pdf"><font color=#FFFFFF>download her notes</font></a><br />
</html><br />
<br />
=='''Contents'''==<br />
<br />
* <span style="font-size:4mm;">[[Team:Peking/Notebook/WYWang#July| July, 2010]]</span><br />
<br />
* <span style="font-size:4mm;">[[Team:Peking/Notebook/WYWang#August| August, 2010]]</span><br />
<br />
* <span style="font-size:4mm;">[[Team:Peking/Notebook/WYWang#September| September, 2010]]</span><br />
<br />
* <span style="font-size:4mm;">[[Team:Peking/Notebook/WYWang#9.21-10.27| October, 2010]]</span><br />
<br />
<br />
==July==<br />
{| class="calendar" border="0" rules="rows" width="650px" style="color:#ffffff"<br />
|- <br />
|style="text-align:center"| Mon<br />
|style="text-align:center"| Tue<br />
|style="text-align:center"| Wed<br />
|style="text-align:center"| Thu<br />
|style="text-align:center"| Fri<br />
|style="text-align:center"| Sat<br />
|style="text-align:center"| Sun<br />
|- <br />
|style="text-align:center"| -<br />
|style="text-align:center"| -<br />
|style="text-align:center"| -<br />
|style="text-align:center"| -<br />
|style="text-align:center"| 1<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.2|2]]<br />
|style="text-align:center"| 3<br />
|- <br />
|style="text-align:center"| 4<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.5|5]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.6|6]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.7|7]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.8|8]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.9|9]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.10|10]]<br />
|- <br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.11|11]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.12|12]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.13|13]]<br />
|style="text-align:center"| 14<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.15|15]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.16|16]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#7.17|17]]<br />
|- <br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.18|18]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.19|19]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.20|20]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.21|21]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.22|22]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.23|23]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.24|24]]<br />
<br />
|- <br />
|style="text-align:center"| 25<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.26|26]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#7.27|27]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.28|28]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.29|29]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.30|30]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#7.31|31]]<br />
|- <br />
|}<br />
[<html><a href="#top">TOP</a></html>]<br />
<br />
===7.2===<br />
<br />
get designed primers<br />
<br />
*T3 promters+fragments of GFP(BBa_E0240)(Forward), and name them in my own order: <br />
<br />
phiOL For: ccg gaattc TATTTACCCTCACTAAAGGGAAT tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phiOR For: ccg gaattc CATTAACCCTCACTAAAGGGAGA tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi1.05 For: ccg gaattc CATTAACCCTCACTAACGGGAGA tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi1.1 For: ccg gaattc AGTTAACCCTCACTAACGGGAGA tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi1.3 For: ccg gaattc TAATAACCCTCACTAACAGGAGA tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi1.5 For: ccg gaattc CATTAACCCTCACTAACAGGAGA tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi2.5 For: ccg gaattc TAATTACCCTCACTAAAGGGAAC tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi4.3 For: ccg gaattc AATTAACCCTCACTAACGGGAAC tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi6.5 For: ccg gaattc AATTAACCCTCACTAAAGGGAAG tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi9 For: ccg gaattc TAATTACCCTCACTAAAGGGAGA tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi10 For: ccg gaattc AATTAACCCTCACTAAAGGGAGA tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi11 For: ccg gaattc CTTTAACCCTCACTAACAGGAGG tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi13 For: ccg gaattc AATTAACCCTCACTAAAGGGAGA tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
phi3.8 For: ccg gaattc AATTAACACTCACTAAAGGGAGA tcaca cagga aagta ctaga tgcgt aaagg<br />
<br />
notice: <br />
<br />
1) No.13(phi13) has the same sequence with No. 9(phi6.5)<br />
<br />
2) E0240: B0032 RBS (medium) +GFP(E0040)+ terminator(B0010+B0012) is 876 bps long<br />
<br />
3) The sequence of T3 promoters are extracted directly from T3 phage genome, and some of the T3 promoters may already have an RBS on their tails.<br />
<br />
4) No.9 (phi6.5) is the Most Commonly used T3 promoter, which always exists on commercialized vectors (such as EZ-T).<br />
<br />
*fragments of GFP(BBa_E0240) (Reverse):<br />
<br />
Rev Standard E0840: aaa ctgcag cggccgc t actagt a TATAAACGCA GAAAGGCCCA<br />
<br />
*BBa_G00000+T3 RNA polymerase(forward)<br />
<br />
*T3 RNA polymerase(reverse)+BBa_G00001<br />
<br />
===7.5===<br />
<br />
1. Dissolve the primers got days before; PCR reaction (using 20μl phusion system) to get 12 T3 promoter+GFP(E0240) fragments and EX+T3 RNA polymerase+SP fragments . <br />
<br />
20uL reaction system:<br />
<br />
5x PHF buffer II 4uL<br />
<br />
ddNTP Mixture 1.6uL<br />
<br />
For 1uL<br />
<br />
Rev 1uL<br />
<br />
Template plasmid 0.2uL<br />
<br />
phusionHF 0.2uL<br />
<br />
ddH2O 12 uL<br />
<br />
phusion system: 1000bp/15s<br />
<br />
2. Electrophoresis the PCR reaction products in 1.5% agarose gel. (Using trans 2K plus as marker)<br />
<br />
3. Excise the gel slice and extract the T3 promoter+GFP(E0240) fragments, which is about 2.6 k bps’ long. Preserving those fragments in -20 ℃ fridge.<br />
<br />
Result: NO.7 & NO.13 didn’t see the string, PCR failed, only 12 T3P+GFP fragments were collected.<br />
<br />
<br />
<br />
===7.6===<br />
<br />
1. PCR reaction to get NO.7 & NO.13 T3P+GFP fragments. (20μl phusion system still)<br />
<br />
2. Electrophoresis the PCR reaction products in 1.5% agarose gel. (Using trans 2K plus as marker), successfully extracted the NO.7 T3P+GFP fragments. Preserve them in -20 ℃ fridge.NO.13 failed again.<br />
<br />
3.Picking colonies of following 2 strains in the afternoon(16:00pm): 2 colonies of pSB6A1, & 2 colonies of pSB4K5 in order to get enough plasmid backbones. Cultivate at 37℃ overnight.<br />
<br />
<br />
<br />
===7.7===<br />
<br />
1. Miniprep of Psb1A2 & Psb4K5 plasmids.<br />
<br />
2. PCR reaction to get NO.13 T3P+GFP fragments. This time using 20uL Taq reaction system:<br />
<br />
20uL Taq reaction system:<br />
<br />
2x EASY TAQ buffer 10uL<br />
<br />
For 1uL<br />
<br />
Rev 1uL<br />
<br />
Template plasmid 0.5uL<br />
<br />
ddH2O 7.5 uL<br />
<br />
phusion system:~ 1000bp/60s<br />
<br />
3. Electrophoresis the PCR reaction products in 1.5% agarose gel. (Using trans 2K plus as marker), successfully extracted the NO.13 T3P+GFP fragments.<br />
<br />
4. Digestion and identification by Electrophoresis:<br />
<br />
1) EcorI & PstI cut T3P+GFP fragments(14 tubes totally, each in 20uL digestion system)<br />
<br />
2)XbaI & PstI cut EX+T3pol+SP fragments<br />
<br />
3)EcorI & PstI cut Psb6A1 &Psb4K5<br />
<br />
<br />
<br />
===7.8===<br />
<br />
1. Purified the digested fragments from gel, and ligation for 1.5h.<br />
<br />
1) 14*T3P+GFP(E,P cut) with Psb4K5( E,Pcut)<br />
<br />
2)EX+T3 pol+SP(E,S cut) with RBS(B0032)+SP (cutted backbone of Psb1A2)<br />
<br />
2. Transformation of ligation mixture. (10:30 pm)<br />
<br />
<br />
<br />
===7.9===<br />
<br />
1. 14:00pm, all colonies on the plates are red, which means the enzyme-digestion failed the day before yesterday. Check the experimental notes and realized that I forgot to add buffer into the digestion system.<br />
<br />
2. re-digestion of the fragments and plasmids:<br />
<br />
1) EcorI & PstI cut T3P+GFP fragments(14 tubes totally, each in 20uL digestion system)<br />
<br />
2)XbaI & PstI cut EX+T3pol+SP fragments<br />
<br />
3)EcorI & PstI cut Psb6A1 &Psb4K5<br />
<br />
Enyzme 1.5uL each<br />
<br />
Sample 15uL<br />
<br />
1 0x NEB buffer 2uL<br />
<br />
3.Electrophoresis and Purification of the digested fragments.<br />
<br />
<br />
<br />
===7.10===<br />
<br />
1. Ligating the digested fragments again.(NO.1 T3P+GFP splashed = =|||)<br />
<br />
2. Transform the ligation mixture into trans5a competent cells.<br />
<br />
<br />
<br />
===7.11===<br />
<br />
1. Re-ligation of NO.1 T3P+GFP and Psb4K5 digested backbone.<br />
<br />
2. Transformation of the NO.1 T3P+GFP ligation mixture.<br />
<br />
3. Picking colonies from the other 13 T3P+GFP(pSB4K5)plates and cultivating; each T3P+GFP picking 3 candidates. Picking colonies from RBS(B0032)+T3 pol(1A2): also 3 candidates.<br />
<br />
<br />
<br />
===7.12===<br />
<br />
1. No colony existed on RBS_T3pol #1, and few colonies appeared on three NO.4 T3P+GFP(Psb4K5) plates.<br />
<br />
2. Miniprep 2+13*3 tubes of plasmids.<br />
<br />
3. Picking colonies from the NO.1 T3P+GFP(pSB4K5)plate: 3 candidates. Shaking.<br />
<br />
<br />
<br />
===7.13===<br />
<br />
1. Sent the two RBS+T3pol plasmid candidates to sequence company.<br />
<br />
2. Culture result wasn’t very satisfied: Exam the shaking table and found the temperature inside is 39℃, which is too high for bacteria to grow.<br />
<br />
3. Miniprep 3 candidates of NO.1 T3P+GFP.<br />
<br />
4. PCR reaction to exam whether all the 45 T3P+GFP candidates have the wanted sequence.(using T3P primers I received on July 2ed):<br />
<br />
Electrophoresis result show that all 45 candidates have the wanted sequence ( ~0.9k bps)<br />
<br />
<br />
<br />
===7.15===<br />
<br />
1. Get SpeI+PstI cutted T7P(on Psb1A2) from Heng Pan, and digest RBS_T3pol(already got 2 candidates: RBS_T3pol_2 & RBS_ T3pol_3) with XbaI +PstI( in order to link the RBS_T3pol downstream the T7P)<br />
<br />
2. Electrophoresis and Purify the digestion product<br />
<br />
3. Ligation: SP cut T7P + XP cut RBS_T3pol<br />
<br />
4. Transform the ligation mixture into competent cells<br />
<br />
<br />
<br />
===7.16===<br />
<br />
1. T7P+RBS_T3pol_3’s transformation failed, no colony appeared.<br />
<br />
2. Pick 3 colonies from T7P+RBS_T3pol_2’s plate and culture it in shaking table.<br />
<br />
3. The result of sequence (RBS_T3pol two candidates) failed, no signal.<br />
<br />
<br />
<br />
===7.17===<br />
<br />
1. Miniprep the 3 candidates of T7P+RBS_T3pol_2 and sent the plasmid to sequence company.<br />
<br />
2. Using 3 candidates of T7P+RBS_T3pol_2 and 6 T3P_GFP candidates which is randomly chose to do the co-transformation ( transform two different plasmids simultaneously), in order to see which one of the 3 T7P+RBS_T3pol_2 candidates has the function.<br />
<br />
Selected T3P_GFP: 1_1; 2_2; 3_3; 11_1; 12_2; 13_3;<br />
<br />
So 3*6=18 pairs was made to co-transform into trans1-T1 competent cells( which is phage-resisted); 18 plates were put into oven.<br />
<br />
<br />
<br />
===7.18===<br />
<br />
1. 12/18 plates failed to grow colonies. ( antibiotics added too much?)<br />
<br />
2. Induction for the 1st time: pick 1 colony of each co-transformation plate, culture in 37℃ shaking table, cultured until O.D600 level become 0.98( actually 0.4-0.6 maybe better). Add IPTG and induce the expression of T7 RNAP.<br />
<br />
The induction failed finally, no GFP signal was observed.<br />
<br />
3. Method II: transfer 1 plasmid first (T7P+RBS_T3pol on Psb1A2), then make the transformed cell become competent again, and transform the second plasmid(T3P_GFP on Psb4K5) into it.<br />
<br />
<br />
<br />
===7.19===<br />
<br />
1. The result of T7P+RBS_T3pol showed that the digestion on July 15th is failed, and the RBS_T3pol on Psb1A2 failed to be cut down. The results also showed that the RBS_T3pol sequence is correct.<br />
<br />
2. Digest the RBS_T3pol again and do the ligation.<br />
<br />
3. Pick 6 colonies of T3P_GFP(1_1; 2_2; 3_3; 11_1; 12_2; 13_3;) and RBS_T3pol, cultured for miniprep to extend the plasmid resource.<br />
<br />
<br />
<br />
===7.20===<br />
<br />
1. Transform the two RBS_T3pol+T7Pbackbone ligation mixture in the morning.<br />
<br />
2. No colony grew on one of the two plates (RBS_T3pol_2 failed) in the evening. Pick 2 candidates from T7P+RBS_T3pol_3, cultured and miniprep in the evening, named them T7P_T3pol 3.1 &T7P_T3pol3.2.<br />
<br />
3. Found a way to exam whether T7P is successfully link upstream the RBS_T3pol: using SFC_I enzyme, whose recognition site is only inside T7P( no recognition site on RBS_T3pol and Psb1A2 backbone)<br />
<br />
4. Receive the sequence result of T3P_GFPs: T3P_GFP 1.1 failed.<br />
<br />
5. Digest the T7P_T3pol 3.1 &T7P_T3pol3.2 with SfcI and PstI, if T7P is successfully linked, a 3000 bps string will appear on the Electrophoresis gel.<br />
<br />
<br />
<br />
===7.21===<br />
<br />
1. Electrophoresis result show no signal. Pick T7P_T3pol candidates again from the plate grow yesterday; miniprep them in the afternoon. <br />
<br />
Digest with SfcI enzyme, and using uncut RBS_T3pol as a negative control.<br />
<br />
2. Miniprep: <br />
<br />
1)RBS_T3pol_2 and RBS_T3pol_3<br />
<br />
2)T3P_GFPs<br />
<br />
3. Sent T3P_GFP candidates to the sequence company: NO.4_1;NO.5_1;NO.6_!;NO.7_1;NO.8_1<br />
<br />
4. Transform RBS_T3pol sequenced plasmid into trans1T-1competent cells to keep the strain.<br />
<br />
5. Digest RBS_T3pol_2 and RBS_T3pol_3 using XbaI and PstI again. The Electrophoresis result show that the objected 2.6k string is mixed with the Psb1A2 backbone’s string (which is 2.1k long), thus become hard to distinguish and separate them.<br />
<br />
6. About the SfcI +PstIexam: SfcI’s recognition site:CTRYAG<br />
<br />
There are more than 4 recognition site if the T7P is successfully linked upstream the RBS_T3pol on Psb1A2.<br />
<br />
<br />
<br />
===7.22===<br />
<br />
1. Miniprep to get more RBS_T3pol plasmids.<br />
<br />
2. Sent T3P_GFP candidates to sequence company: NO.9_1;NO.10_1;NO.14_1<br />
<br />
3. Digestion of RBS_T3pol with XbaI and PstI and do the ligation again.<br />
<br />
4. Consult An Xiao for more advise:<br />
<br />
1) The amount of enzyme in digestion system cannot be more than 1/10<br />
<br />
2)10*BSA is demanded if required<br />
<br />
3) TAE used in electrophoresis is needed refresh frequently.<br />
<br />
5. Go no SfcI+PstI exam of the T7P_T3pol candidates.<br />
<br />
The electrophoresis result wasn’t very good. Maybe one possible candidate is selected; named it T7P_T3pol neo.<br />
<br />
<br />
<br />
===7.23===<br />
<br />
1. Transform the T7P_T3pol neo in to trans1-T1 cells.<br />
<br />
2. XbaI and PstI digestion to make show the reserved RBS_T3pol is the right plasmid.(2.6k bps fragments are observed)<br />
<br />
3.Pick more T7P_T3pol candidates and cultured.<br />
<br />
<br />
<br />
===7.24===<br />
<br />
1. Miniprep to the T7P_T3pol candidates.(10 totally)<br />
<br />
2. SfcI single-digest-system to exam whether the T7P is existed or not.<br />
<br />
If T7P is existed, a ~1k bps fragment will be observed by Electrophoresis.<br />
<br />
This time 7 candidates show the positive Electrophoresis results. Select 4 of them and sent them to the sequence company.<br />
<br />
<br />
<br />
===7.26===<br />
<br />
1. The result of sequence is received, which show that 2 candidates is correct: T7P_RBS_T3pol is successfully constructed.<br />
<br />
2. Do the induction pre-experiment again(like July 18th ), co-transform two plasmid into BL21 competent cells.( randomly choose T3P_GFP 2_2;3_3;11_1;12_2; totally 2*4=8 pairs)<br />
<br />
<br />
<br />
===7.27===<br />
<br />
1. Tragedy! All the 8 plates failed to grow colonies!!<br />
<br />
1) BL21 competent cell isn’t robust, cannot product enough antibiotic-resistant plasmid?<br />
<br />
2) low-efficiency of co-transformation<br />
<br />
3) BL21 competent cell is affected by the phage?<br />
<br />
2. Transform the correct sequenced T7P_RBS_T3pol into trans1-T1 to restore the strain.<br />
<br />
3. Sent T3P_GFP candidates to sequence:NO1_3;NO.6_2;NO7_2;NO.8_2;NO.9_2<br />
<br />
<br />
<br />
===7.28===<br />
<br />
1. Pick colonies from T7P_RBS_T3pol(tran1-T1) to get more plasmids. Pick colonies of T7P_RBS_T3pol(BL21) to product competent cell.<br />
<br />
2. Scribe and restore some already-sequenced T3P_GFP:NO2_2;NO.3_3;NO.11_1;NO12_2<br />
<br />
<br />
<br />
===7.29===<br />
<br />
1. Turn T7P_RBS_T3pol(BL21) into competent cells.<br />
<br />
2. Sequence result failed, re-pick T3P_GFP#1,5,6,7,8,9,10 from plates cultured on July 11th.<br />
<br />
3. Found a serious problem: The plates applied on the morning is covered by bacteria lawn.<br />
<br />
1) Kan+ antibiotic lose its function<br />
<br />
2) The transformation efficiency of DIY competent cells are too high<br />
<br />
3) The bacteria lawn is not the wanted BL21 cells, the plates are polluted<br />
<br />
So new plates(K+) are made, and picked more colonies of T7P_RBS_T3pol(BL21) for tomorrow’s DIY competent cells.<br />
<br />
<br />
<br />
===7.30===<br />
<br />
1. DIY T7P_RBS_T3pol(BL21) competent cells again, and transfer T3P_GFP plasmids into the cells(1_1,2_2,3_3,4_1,5_3,6_3,7_3,8_3,9_3,10_3,11_1,12_2,14_1)<br />
<br />
2. Unfortunately, the bacteria lawn began to grow again 5h after plate-apply.<br />
<br />
3. In order to exam whether these lawn are bacteria pollution or not, try to pick several colonies from the plates cultivated yesterday, cultured and miniprep to get its plasmids. Using EcorI and PstI to digest it.<br />
<br />
The Digestion result show the lawn contain the wanted T7P_RBS_T3pol(BL21) cells.(~3k fragments detected)<br />
<br />
<br />
<br />
===7.31===<br />
<br />
1.3rd time to DIY T7P_RBS_T3pol(BL21) cells and transfer T3P_GFP into them. Lawn appeared again, digestion show several unwanted fragments.<br />
<br />
2. Consult An Xiao: the reason of lawn’s growing maybe result from T7P’s leakage, which lead to the downstream Amp+ ‘s over expression.<br />
<br />
1)book BL21(DES)plySs competent cells, which have little T7 RNAP leakage<br />
<br />
2)link a terminator after T3 pol.(using terminator B0015, 100bps)<br />
<br />
==August==<br />
{| class="calendar" border="0" rules="rows" width="650px" style="color:#ffffff"<br />
|- <br />
|style="text-align:center"| Mon<br />
|style="text-align:center"| Tue<br />
|style="text-align:center"| Wed<br />
|style="text-align:center"| Thu<br />
|style="text-align:center"| Fri<br />
|style="text-align:center"| Sat<br />
|style="text-align:center"| Sun<br />
|- <br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.1|1]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.2|2]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.3|3]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.4|4]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.5|5]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.6-8.11|6]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.6-8.11|7]]<br />
|- <br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.6-8.11|8]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#8.6-8.11|9]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.6-8.11|10]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.6-8.11|11]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.12|12]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.13|13]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.14|14]]<br />
|- <br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.15|15]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.16|16]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.17|17]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.18|18]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.19|19]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.20|20]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.21|21]]<br />
|- <br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.22|22]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.23|23]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.24|24]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.25|25]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.26-8.27|26]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.26-8.27|27]]<br />
|style="text-align:center"| 28<br />
|- <br />
|style="text-align:center"| 29<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.30|30]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#8.31|31]]<br />
|style="text-align:center"| -<br />
|style="text-align:center"| -<br />
|style="text-align:center"| -<br />
|style="text-align:center"| -<br />
|}<br />
[<html><a href="#top">TOP</a></html>]<br />
<br />
===8.1===<br />
<br />
Ligation of B0015 to T7P_RBS_T3pol, transformation into Trans1-T1(2plates)<br />
<br />
<br />
<br />
===8.2===<br />
<br />
1. One plates grow better. Pick colonies and miniprep in the evening.<br />
<br />
Digest them by NdeI+PstI<br />
<br />
If the ligation succeeded, 4k fragment and 890bps fragments will be seen.<br />
<br />
If failed, 4k fragments and 7.9 fragments.<br />
<br />
2. BL21(DES)plySs arrive, transfer T7P_RBS_T3pol into them.<br />
<br />
<br />
<br />
===8.3===<br />
<br />
Exam the digestion product. (succeed~~get 3 possible candidates, sent them to sequence)<br />
<br />
<br />
<br />
===8.4===<br />
1. Got sequencing’s results of T3P_GFPs<br />
<br />
Now I’ve got T3P_GFPNO.1, 2, 3, 4, 5, 7, 8, 10,11, 12, 13, 14;<br />
<br />
No. 6 failed, results show the sample sent has the same sequence with No.11<br />
<br />
No. 9 failed, results show the sample sent has the same sequence with No.5<br />
<br />
2. Got sequencing’s results of T7P_RBS_T3pol_terminator 15_1, correct.<br />
<br />
Transfer the plasmids into BL21(DES)plySs. (failed…)<br />
<br />
<br />
<br />
===8.5===<br />
<br />
More sequence result give out, which show T7P_RBS_T3pol_terminator 15_1, 15_2, 15_3 are all correct.<br />
<br />
<br />
<br />
===8.6-8.11===<br />
<br />
Go back to home in Shanghai ~~<br />
<br />
Visit the EXPO<br />
<br />
<br />
<br />
===8.12===<br />
<br />
1. Transfer T7P_RBS_T3pol_terminator 15_1 into BL21(DES)plySs, again.<br />
<br />
<br />
<br />
===8.13===<br />
<br />
1. Pick 3 colonies of the BL21(DES)plySs+ T7P_RBS_T3pol_terminator 15_1, cultivate in tubes, then turn them into DIY competent cells.<br />
<br />
Transfer T3P_GFP NO.1, NO.2, NO.3, NO.4, NO.5, NO.7, NO.8, NO.10, NO.11, NO.12, NO.14.<br />
<br />
<br />
<br />
===8.14===<br />
<br />
1. The plates transferred yesterday: 4/11 failed<br />
<br />
2. Using co-transformation ( 2 plasmids being transfered into competent cells simultaneously )to deal with the low efficiency of transformation which using DIY competent cells.<br />
<br />
===8.15===<br />
<br />
IPTG induction ~~!! Under 37 degree, shaking for 2h. Collect the O.D. very 30min.<br />
<br />
Failed. Almost no fluorescent signal detected. But NO.4 NO.5 seems to have some weak signal.<br />
<br />
<br />
<br />
===8.16===<br />
<br />
Induction again. Under 37 degree, shaking for 8h. Collect the O.D. very 30min. <br />
<br />
Failed, still no GFP fluorescent signal.<br />
<br />
<br />
<br />
===8.17===<br />
<br />
1. Colony PCR of the inducted bacteria to see whether these bacteria are the wanted bacteria(T7P_RBS_T3pol_terminator 15_1+T3P GFP)<br />
<br />
*Using hc primers to exam whether there are T3 pol sequence ( recogonization site only on T3 polymerase; positive results will have see a 1.6k bps fragment):<br />
<br />
hc-T7P-F<br />
<br />
AGCACTTCAAGAAGCACG<br />
<br />
hc-T7P-R<br />
<br />
TGAGCCAGTTCATCGCCT<br />
<br />
*Using T3P_GPF primers to exam the existence of T3P_GFP(800-900bp fragment)<br />
<br />
Only NO.4, NO.5, NO.7 have the target T3P_GFP positive result, which seems to fit with the 8.15 Induction’s result.<br />
<br />
<br />
<br />
===8.18===<br />
<br />
1. Induction again (2h) . Still failed.<br />
<br />
Dissolve fresh IPTG. ( preserve away from light)<br />
<br />
2. Transfer T3P_GFP into DIY T7P_RBS_T3pol_terminator 15_1 BL21(DES)plySs competent cells.<br />
<br />
<br />
<br />
===8.19===<br />
<br />
1. Pick colonies from plates transferred yesterday. Preserve the strain, and do the colony PCR to check the existence of the two plasmids.<br />
<br />
Notice: bacteria lawn appeared again in spite of the terminator’s existence.<br />
<br />
*change the backbone of T7P_RBS_T3pol_terminator 15_1 into Psb1C3.<br />
<br />
*EP digest and check whether bacteria existence happened again: positive(T7P_RBS_T3pol_terminator 15_1’s existence checked).<br />
<br />
*PCR exam try to confirm the existence of T3pol and T3_GFP<br />
<br />
<br />
<br />
===8.20===<br />
<br />
1. Check the PCR result, no positive result.-bacteria polluted.<br />
<br />
'''the possible reason of lawn’s appearance''':<br />
<br />
*O.D. level-too high: 0.2-0.6 is better (mine is 0.9-1.0)<br />
<br />
*plasmids volume too little: only 5μl-better 10μl?<br />
<br />
2. Check the sequence result again- T7P_RBS_T3pol_terminator 15_1 has 1 point mutation (although maybe the sequencing error)!!! And T7P_RBS_T3pol_terminator 15_2 & T7P_RBS_T3pol_terminator 15_3 is correct.<br />
<br />
Transfer T7P_RBS_T3pol_terminator 15_2 & T7P_RBS_T3pol_terminator 15_3 into BL21(DES)plySs ~~<br />
<br />
3. Transfer the backbone-changed T7P_RBS_T3pol_terminator 15_1 into trans1-T1(abandoned, since the T7P_RBS_T3pol_terminator 15_1 may be a wrong copy)<br />
<br />
===8.21===<br />
<br />
1. SP digest the RBS-T3pol, link with XP cut terminator<br />
<br />
2. XP digest T7P_RBS_T3pol_terminator 15_2 to change the backbone into Psb1C3.<br />
<br />
3.'''in order to confirm the expression of T3 RNAP, induce the T7P_RBS_T3pol_terminator 15_1 BL21 bacteria(only one plasmid inside) to do the PAGE exam'''<br />
<br />
37℃ , 2h<br />
<br />
4. Transfer the T3P_GFP NO.2, NO.4, NO.5, NO.7, NO.8, NO.9, NO.10, NO.14 into the DIY competent cells.<br />
<br />
===8.22===<br />
<br />
1.Induction again, freeze and extract RNA from the bacteria, in order to have RT-PCR-EXAM to confirm the expression of T3 RNAP.<br />
<br />
2. Transfer T3P_GFPs into DIY competent cells.<br />
<br />
===8.23===<br />
<br />
1. miniprep the backbone-changed T7P_RBS_T3pol_terminator 15_2 & T7P_RBS_T3pol_terminator 15_3 bacteria. Sent to sequence.<br />
<br />
2. Low efficiency of transformation still…<br />
<br />
<br />
<br />
===8.24===<br />
<br />
1.Try transformation again; PCR and Enzyme Digestion again to confirm the existence of each plasmids.<br />
<br />
Successfully confirm the following 5 T3P_GFP+ T7P_RBS_T3pol_terminator strains:<br />
<br />
NO.7 NO.8 NO.4 NO.5 NO.10<br />
<br />
===8.25===<br />
<br />
1. IPTG induction again(NO.7 and NO.8)(37℃, 5h, failed again)<br />
<br />
*Insult Xing Teng- induction should be practiced under a lower temperature, such as 18℃, and longer time, such as 16h.<br />
<br />
===8.26-27===<br />
<br />
1. Get more confirmed two-plasmid strains.(NO.9 & NO.11 obtained~ NO.9 is the most widely used commercial T3P~~)<br />
<br />
2. Follow Xing Teng’s advice, using 0.001M/L IPTG to induce under 18℃ for 16h.<br />
<br />
'''PAGE result confirmed the expression of T3 RNAP.'''<br />
<br />
===8.30===<br />
<br />
Using IPTG to induce under 32℃ for 5h(NO.9 & NO 11).(Concentration gradient from 10^-7 to 10^-1 M IPTG)<br />
<br />
This time NO.9 and No.11 detected fluorescent signal in 0.001 M IPTG!!!!<br />
<br />
===8.31===<br />
<br />
Induction again. (NO.8 NO.9 NO.11), 30℃, 6h, (Concentration gradient from 10^-7 to 10^-1 M IPTG)<br />
<br />
Result:<br />
<br />
10^-3M IPTG highest signal<br />
<br />
Unfortunately, the leakage problem was very serious.<br />
<br />
Two plans to avoid the leakage:<br />
<br />
*Using merR system ,induce the expression of T7 RNAP with Hg(II) .<br />
<br />
Problem: in merR system, plasmids conflict existed(Ori competition)= =||| The backbone-change of PmerT_T3pol(1C3) into3C5 is required.<br />
<br />
*Substitute T7P with PBAD, and using arabinose to induce the expression of T7 RNAP<br />
<br />
==September==<br />
<br />
{| class="calendar" border="0" rules="rows" width="650px" style="color:#ffffff"<br />
|- <br />
|style="text-align:center"| Mon<br />
|style="text-align:center"| Tue<br />
|style="text-align:center"| Wed<br />
|style="text-align:center"| Thu<br />
|style="text-align:center"| Fri<br />
|style="text-align:center"| Sat<br />
|style="text-align:center"| Sun<br />
|- <br />
|style="text-align:center"| -<br />
|style="text-align:center"| -<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.1-9.10|1]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.1-9.10|2]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#9.1-9.10|3]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#9.1-9.10|4]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#9.1-9.10|5]]<br />
|- <br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.1-9.10|6]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#9.1-9.10|7]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#9.1-9.10|8]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.1-9.10|9]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.1-9.10|10]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.11-9.20|11]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.11-9.20|12]]<br />
|- <br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.11-9.20|13]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#9.11-9.20|14]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.11-9.20|15]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.11-9.20|16]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.11-9.20|17]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.11-9.20|18]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.11-9.20|19]]<br />
|- <br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.11-9.20|20]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.21-10.27|21]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#9.21-10.27|22]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.21-10.27|23]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#9.21-10.27|24]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#9.21-10.27|25]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.21-10.27|26]]<br />
|- <br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.21-10.27|27]]<br />
|style="text-align:center"|[[Team:Peking/Notebook/WYWang#9.21-10.27|28]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.21-10.27|29]]<br />
|style="text-align:center"| [[Team:Peking/Notebook/WYWang#9.21-10.27|30]]<br />
|style="text-align:center"| -<br />
|style="text-align:center"| -<br />
|style="text-align:center"| -<br />
|}<br />
[<html><a href="#top">TOP</a></html>]<br />
<br />
===9.1-9.10===<br />
<br />
IPTG induction.<br />
<br />
Statistics of NO.4, NO.5, NO.7, NO.8, NO.9, NO.10, NO.11, NO.12, NO.14 (NO.13 are the same as No.11) are collected<br />
<br />
<br />
<br />
===9.11-9.20===<br />
<br />
Construct the ara-induction system and Hg-induction system, but unfortunately failed…= =|||<br />
<br />
<br />
<br />
===9.21-10.27===<br />
<br />
Began to focus on wiki construction. Miao Jing took the major charge of the left bench work.<br />
<br />
<html><br />
</div><br />
<br />
<br />
<br />
<div id="project description bottom"><br />
<div id="bottomgreen"><br />
<br><br />
<a href="https://2010.igem.org/Team:Peking/Team/WYWang"><font color=#FFFFFF>==go to her page==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</div><br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Gallery/SPTeam:Peking/Gallery/SP2010-10-28T01:34:52Z<p>Cathterry: /* Dear 2010 PKU iGEMers, I love U forever */</p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Special Memory</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] > [[Team:Peking/Gallery/SP|Special Memory]]<html><br />
</div><br />
<br />
<div id="middleblue"><br />
</html><br />
=Dear 2010 PKU iGEMers, I love U forever >3<)=<br />
<html><br />
<embed src="https://static.igem.org/mediawiki/igem.org/8/81/PKU_SP.swf" width=650 height=400 name="I LOVE U FOREVER" align="justify" ></html><br />
<html><br />
</div><br />
<br />
<div id="bottomblue"><br />
</div><br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/ProjectDiscriptionTeam:Peking/Project/ProjectDiscription2010-10-28T00:36:31Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Project Discription</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/ProjectDiscription|Project Discription]] <html><br />
</div><br />
<div id="project description"><br />
<div id="middlewhite"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:center;<br />
}<br />
</style><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;Pollution of toxic heavy metals generated by anthropogenic activities is a worldwide concern while aquatic environments are frequently the final recipients of most of heavy metal pollutants (Bakis and Tuncan; Boyd). For instance, enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (Fig.1 Tchounwou et al., 2003). Traditional techniques to detect or decontaminate heavy metals in natural samples can be costly and time consuming, especially at low metal concentration; therefore, robust and inexpensive methods to detect and decontaminate heavy metals in water are highly desirable (Tecon and van der Meer, 2008; van der Meer and Belkin). Namely, we need to develop a high-performance heavy metal decontamination kit which can accomplish the detection and absorption of heavy metals in aquatic environment conveniently.<br> <br><br />
</html>[[image:ProFig1.jpg|center|530]]<html><br><br />
Fig.1&nbsp;Enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (A) Profile of historic concentrations of Hg in the Upper Fremont Glacier. (D) Profiles of anthropogenic Pb fluxes in Lake Bolterskardet. Adapted from Tchounwou et al., 2003<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;In the field of biodetection and bioremediation, despite numerous proofs of principle, most bioreporters and bioabsorbents have remained confined to the laboratory (van der Meer and Belkin). Also, bacterial reporters and absorbents are NOT rational enough in design and NOT complex enough in function (Chakraborty et al., 2008; Diesel et al., 2009; Sharon Yagur-Kroll, 2010). Additionally, we notice that genetic manipulation in this field is in need of streamline methods (Hansen and Sorensen, 2000) and it's time for a series of issues on the field application to be taken into consideration (Kuppardt et al., 2009).<br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>https://static.igem.org/mediawiki/2010/4/46/Pkulogo.jpg" <html><br><br><br />
Fig2. Our heavy metal decontamination kit consists of a bioreporter system and a bioabsorbent. Bioreporter system acts as a sensor for certain heavy metal and will report the presence and extent of heavy metal pollution in water by a quantifiable and naked-eye recognizable output signal. When heavy metal detected, bioabsorbent will be put to use. Bioabsorbent is genetically engineered bacteria which is capable of absorbing heavy metal from water significantly and will auto-aggregate and sediment after water detoxified.<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;Based on the principle of Biological Network Control and Reverse Engineering (Chikofsky and Cross, 1990), we engineered our bacteria to resolve these hard truths mentioned above. MerR family transcription factors (TFs) were exploited to construct a series of biorepoters for heavy metal detection and bioabsorbents for heavy metal decontamination (Fig.2 and Fig.3, Hobman, 2007; Hobman et al., 2005). <br> <br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/a/a9/ProFig3.png" ><br><br>Fig3. Schemes of reverse engineering principle based project. We primarily took system apart, followed by description of function, structure and operation of each part, especially the heavy metal responsive regulator. Then mathematical modeling and 3D structure modeling were conducted to analyze the collected information. Then appropriate topology candidates for needed function were carefully searched. We selected a candidate and re-designed genetic components to accomplish expected bioreporter or bioabsorbent function in need, which was verified by following bioware experiments. Therefore, We opened up an alternative approach to efficient and robust biosensor and bioabsorbent engineering.<br><br><br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;We analyzed the function and operation of a MerR family TF, MerR into detail via bioware experiments and modeling. We found that the TF expression level in cytosol and the binding affinity between TF and its operator site have great influence on bacterial sensitivity to mercury. Then, rational design of genetic circuits was conducted to confer mercury sensor and regulator components high efficiency and robustness. As is expected, these constructed bioreporters are capable of discriminating mercury concentration ranging from 10^-8 M to 10^-6 M in water, regardless of incubation time and bioreporter activity in a wide window. In other words, there is no necessity to calibrate before detection. This means that the field application of bioreporter can be carried out without costly equipment while fidelity and sensitivity are still conserved. <br><br><img src="https://static.igem.org/mediawiki/2010/1/11/Sensor.png" ><br />
<img src="https://static.igem.org/mediawiki/2010/2/21/JM1.png"width=400><img src="https://static.igem.org/mediawiki/2010/7/7d/Figure18PKU.png" width=320><img src="https://static.igem.org/mediawiki/2010/3/34/Figure15PKU.jpg"width=320><br><br />
<br />
<br />
<a href="https://2010.igem.org/Team:Peking/Project/Biosensor" target="_blank" >learn more...</a><br><br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;Meanwhile, we took a closer look into the structure of MerR family TFs(Brown et al., 2003; Hobman, 2007; Hobman et al., 2005). The metal binding domain of MerR is a 48-residue, named alpha-helix 5(Guo et al.; Song et al., 2007). A strategy to engineer MerR TF proteins was developed baedsed previous work (Qin et al., 2006; Song et al., 2004). We directly fused two copies of metal binding domain into a single-chain, antiparallel coiled coil, called Metal Binding Peptide ( MBP<html>). And then high-performance bioabsorbent was implemented by expressing MBP on the surface, in periplasm and in cytosol of E.coli, former 2 of which were accomplished by fusion of MBP with special translocation protein, OmpA and DsbA. The following function test results showed that our bacteria can absorb more than 50% of 10-6 mol/L Hg (II) in 2 hours; WHICH IS in consistent with previous work that artificial MBP chain can simulate the in vivo metal-binding ability of dimeric, full-length MerR. <br><br />
<br><img src="https://static.igem.org/mediawiki/2010/4/47/ObsorbentS.png"width=230 ><img src="https://static.igem.org/mediawiki/2010/5/5e/Oc5.jpg" width=400><img src="https://static.igem.org/mediawiki/2010/2/26/Pc4.png"width=320><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"width=325><br><br />
<a href="https://2010.igem.org/Team:Peking/Project/Bioabsorbent" target="_blank" >learn more...</a><br><br />
<br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;Additionally, we noticed that MerR family TFs share a highly conserved homology at their metal binding domain (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioreporter and bioabsorbent engineering may be applicable to other cases. We then expanded our reverse engineering strategy to cope with another common toxic heavy metal, lead (Borremans et al., 2001; Chakraborty et al., 2008; Chen et al., 2005; Julian et al., 2009; Mergeay et al., 2003). We primarily took lead resistance operon apart, followed by description of function, structure and operation of PbrR, a lead responsive regulator. Then modeling was conducted to analyze the characteristics of PbrR and topology of its regulation behavior. Information collected confirmed the possibility to design a genetic circuit whick can make lead sensor and regulator components more efficient and robust. Our engineered E.coli bioreporters is capable of discriminating different concentrations of lead ranging from 10^-8 to 10^-6, similar to mercury bioreporter mentioned above. We also engineered PbrR into single-chain coiled coil (MBP) via the same method as MerR. Exhilaratingly, the following inductive expression of PbrR MBP on the surface, in periplasm and in cytosol along with the lead (II) absorption test showed that our bacteria can absorb more than 95% of 10^-7M Pb (II) in 5 minutes, which is comparable to mercury MBP expression in E.coli, proving validness of our engineering strategy. <br><br />
<br><img src="https://static.igem.org/mediawiki/2010/2/20/ProFigbidui.jpg<br />
"width=68% align=left><embed src="https://static.igem.org/mediawiki/2010/4/4e/MerR.swf" width=32% align=right><br />
<embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf" width=32% align="right"><br><a href="https://2010.igem.org/Team:Peking/Project/Expansion" target="_blank" >learn more...</a><br />
<br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;In summary, we’ve developed a strategy for heavy metal bioreporter and bioabsorbent engineering, based on reverse engineering principle, which will help us to break the limitation of our current knowledge and research method. As MerR family TFs share highly conserved homology and most kinds of heavy metals have corresponding MerR family TFs(Brown et al., 2003; Hobman, 2007; Hobman et al., 2005; Julian et al., 2009), we can state that we have developed an intensible method to construct heavy metal decontamination kits composed of valid bioreporters and bioabsorbents for field application in the near future.<br> </p><br />
<br><br />
</div><br />
<br />
<div id="project description bottom"><br />
<div id="bottomwhite"><br />
<br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="80px"alt="go back to top"></a><br />
<a href="https://2010.igem.org/Team:Peking/Project/ProjectDiscription/Reference" target="_blank">reference</a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</div><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/ProjectDiscriptionTeam:Peking/Project/ProjectDiscription2010-10-28T00:34:29Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Project Discription</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/ProjectDiscription|Project Discription]] <html><br />
</div><br />
<div id="project description"><br />
<div id="middlewhite"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:center;<br />
}<br />
</style><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;Pollution of toxic heavy metals generated by anthropogenic activities is a worldwide concern while aquatic environments are frequently the final recipients of most of heavy metal pollutants (Bakis and Tuncan; Boyd). For instance, enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (Fig.1 Tchounwou et al., 2003). Traditional techniques to detect or decontaminate heavy metals in natural samples can be costly and time consuming, especially at low metal concentration; therefore, robust and inexpensive methods to detect and decontaminate heavy metals in water are highly desirable (Tecon and van der Meer, 2008; van der Meer and Belkin). Namely, we need to develop a high-performance heavy metal decontamination kit which can accomplish the detection and absorption of heavy metals in aquatic environment conveniently.<br> <br><br />
</html>[[image:ProFig1.jpg|center|530]]<html><br><br />
Fig.1&nbsp;Enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (A) Profile of historic concentrations of Hg in the Upper Fremont Glacier. (D) Profiles of anthropogenic Pb fluxes in Lake Bolterskardet. Adapted from Tchounwou et al., 2003<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;In the field of biodetection and bioremediation, despite numerous proofs of principle, most bioreporters and bioabsorbents have remained confined to the laboratory (van der Meer and Belkin). Also, bacterial reporters and absorbents are NOT rational enough in design and NOT complex enough in function (Chakraborty et al., 2008; Diesel et al., 2009; Sharon Yagur-Kroll, 2010). Additionally, we notice that genetic manipulation in this field is in need of streamline methods (Hansen and Sorensen, 2000) and it's time for a series of issues on the field application to be taken into consideration (Kuppardt et al., 2009).<br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>https://static.igem.org/mediawiki/2010/4/46/Pkulogo.jpg" <html><br><br><br />
Fig2. Our heavy metal decontamination kit consists of a bioreporter system and a bioabsorbent. Bioreporter system acts as a sensor for certain heavy metal and will report the presence and extent of heavy metal pollution in water by a quantifiable and naked-eye recognizable output signal. When heavy metal detected, bioabsorbent will be put to use. Bioabsorbent is genetically engineered bacteria which is capable of absorbing heavy metal from water significantly and will auto-aggregate and sediment after water detoxified.<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;Based on the principle of Biological Network Control and Reverse Engineering (Chikofsky and Cross, 1990), we engineered our bacteria to resolve these hard truths mentioned above. MerR family transcription factors (TFs) were exploited to construct a series of biorepoters for heavy metal detection and bioabsorbents for heavy metal decontamination (Fig.2 and Fig.3, Hobman, 2007; Hobman et al., 2005). <br> <br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/a/a9/ProFig3.png" ><br><br>Fig3. Schemes of reverse engineering principle based project. We primarily took system apart, followed by description of function, structure and operation of each part, especially the heavy metal responsive regulator. Then mathematical modeling and 3D structure modeling were conducted to analyze the collected information. Then appropriate topology candidates for needed function were carefully searched. We selected a candidate and re-designed genetic components to accomplish expected bioreporter or bioabsorbent function in need, which was verified by following bioware experiments. Therefore, We opened up an alternative approach to efficient and robust biosensor and bioabsorbent engineering.<br><br><br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;We analyzed the function and operation of a MerR family TF, MerR into detail via bioware experiments and modeling. We found that the TF expression level in cytosol and the binding affinity between TF and its operator site have great influence on bacterial sensitivity to mercury. Then, rational design of genetic circuits was conducted to confer mercury sensor and regulator components high efficiency and robustness. As is expected, these constructed bioreporters are capable of discriminating mercury concentration ranging from 10^-8 M to 10^-6 M in water, regardless of incubation time and bioreporter activity in a wide window. In other words, there is no necessity to calibrate before detection. This means that the field application of bioreporter can be carried out without costly equipment while fidelity and sensitivity are still conserved. <br><br><img src="https://static.igem.org/mediawiki/2010/1/11/Sensor.png" ><br />
<img src="https://static.igem.org/mediawiki/2010/2/21/JM1.png"width=400><img src="https://static.igem.org/mediawiki/2010/7/7d/Figure18PKU.png" width=320><img src="https://static.igem.org/mediawiki/2010/3/34/Figure15PKU.jpg"width=320><br><br />
<br />
<br />
<a href="https://2010.igem.org/Team:Peking/Project/Biosensor" target="_blank" >learn more...</a><br><br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;Meanwhile, we took a closer look into the structure of MerR family TFs(Brown et al., 2003; Hobman, 2007; Hobman et al., 2005). The metal binding domain of MerR is a 48-residue, named alpha-helix 5(Guo et al.; Song et al., 2007). A strategy to engineer MerR TF proteins was developed baedsed previous work (Qin et al., 2006; Song et al., 2004). We directly fused two copies of metal binding domain into a single-chain, antiparallel coiled coil, called Metal Binding Peptide ( MBP<html>). And then high-performance bioabsorbent was implemented by expressing MBP on the surface, in periplasm and in cytosol of E.coli, former 2 of which were accomplished by fusion of MBP with special translocation protein, OmpA and DsbA. The following function test results showed that our bacteria can absorb more than 50% of 10-6 mol/L Hg (II) in 2 hours; WHICH IS in consistent with previous work that artificial MBP chain can simulate the in vivo metal-binding ability of dimeric, full-length MerR. <br><br />
<br><img src="https://static.igem.org/mediawiki/2010/4/47/ObsorbentS.png"width=230 ><img src="https://static.igem.org/mediawiki/2010/5/5e/Oc5.jpg" width=400><img src="https://static.igem.org/mediawiki/2010/2/26/Pc4.png"width=320><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"width=330><br><br />
<a href="https://2010.igem.org/Team:Peking/Project/Bioabsorbent" target="_blank" >learn more...</a><br><br />
<br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;Additionally, we noticed that MerR family TFs share a highly conserved homology at their metal binding domain (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioreporter and bioabsorbent engineering may be applicable to other cases. We then expanded our reverse engineering strategy to cope with another common toxic heavy metal, lead (Borremans et al., 2001; Chakraborty et al., 2008; Chen et al., 2005; Julian et al., 2009; Mergeay et al., 2003). We primarily took lead resistance operon apart, followed by description of function, structure and operation of PbrR, a lead responsive regulator. Then modeling was conducted to analyze the characteristics of PbrR and topology of its regulation behavior. Information collected confirmed the possibility to design a genetic circuit whick can make lead sensor and regulator components more efficient and robust. Our engineered E.coli bioreporters is capable of discriminating different concentrations of lead ranging from 10^-8 to 10^-6, similar to mercury bioreporter mentioned above. We also engineered PbrR into single-chain coiled coil (MBP) via the same method as MerR. Exhilaratingly, the following inductive expression of PbrR MBP on the surface, in periplasm and in cytosol along with the lead (II) absorption test showed that our bacteria can absorb more than 95% of 10^-7M Pb (II) in 5 minutes, which is comparable to mercury MBP expression in E.coli, proving validness of our engineering strategy. <br><br />
<br><img src="https://static.igem.org/mediawiki/2010/2/20/ProFigbidui.jpg<br />
"width=68% align=left><embed src="https://static.igem.org/mediawiki/2010/4/4e/MerR.swf" width=32% align=right><br />
<embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf" width=32% align="right"><br><a href="https://2010.igem.org/Team:Peking/Project/Expansion" target="_blank" >learn more...</a><br />
<br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;In summary, we’ve developed a strategy for heavy metal bioreporter and bioabsorbent engineering, based on reverse engineering principle, which will help us to break the limitation of our current knowledge and research method. As MerR family TFs share highly conserved homology and most kinds of heavy metals have corresponding MerR family TFs(Brown et al., 2003; Hobman, 2007; Hobman et al., 2005; Julian et al., 2009), we can state that we have developed an intensible method to construct heavy metal decontamination kits composed of valid bioreporters and bioabsorbents for field application in the near future.<br> </p><br />
<br><br />
</div><br />
<br />
<div id="project description bottom"><br />
<div id="bottomwhite"><br />
<br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="80px"alt="go back to top"></a><br />
<a href="https://2010.igem.org/Team:Peking/Project/ProjectDiscription/Reference" target="_blank">reference</a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</div><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/ProjectDiscriptionTeam:Peking/Project/ProjectDiscription2010-10-28T00:27:24Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Project Discription</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/ProjectDiscription|Project Discription]] <html><br />
</div><br />
<div id="project description"><br />
<div id="middlewhite"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:center;<br />
}<br />
</style><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;Pollution of toxic heavy metals generated by anthropogenic activities is a worldwide concern while aquatic environments are frequently the final recipients of most of heavy metal pollutants (Bakis and Tuncan; Boyd). For instance, enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (Fig.1 Tchounwou et al., 2003). Traditional techniques to detect or decontaminate heavy metals in natural samples can be costly and time consuming, especially at low metal concentration; therefore, robust and inexpensive methods to detect and decontaminate heavy metals in water are highly desirable (Tecon and van der Meer, 2008; van der Meer and Belkin). Namely, we need to develop a high-performance heavy metal decontamination kit which can accomplish the detection and absorption of heavy metals in aquatic environment conveniently.<br> <br><br />
</html>[[image:ProFig1.jpg|center|530]]<html><br><br />
Fig.1&nbsp;Enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (A) Profile of historic concentrations of Hg in the Upper Fremont Glacier. (D) Profiles of anthropogenic Pb fluxes in Lake Bolterskardet. Adapted from Tchounwou et al., 2003<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;In the field of biodetection and bioremediation, despite numerous proofs of principle, most bioreporters and bioabsorbents have remained confined to the laboratory (van der Meer and Belkin). Also, bacterial reporters and absorbents are NOT rational enough in design and NOT complex enough in function (Chakraborty et al., 2008; Diesel et al., 2009; Sharon Yagur-Kroll, 2010). Additionally, we notice that genetic manipulation in this field is in need of streamline methods (Hansen and Sorensen, 2000) and it's time for a series of issues on the field application to be taken into consideration (Kuppardt et al., 2009).<br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>https://static.igem.org/mediawiki/2010/4/46/Pkulogo.jpg" <html><br><br><br />
Fig2. Our heavy metal decontamination kit consists of a bioreporter system and a bioabsorbent. Bioreporter system acts as a sensor for certain heavy metal and will report the presence and extent of heavy metal pollution in water by a quantifiable and naked-eye recognizable output signal. When heavy metal detected, bioabsorbent will be put to use. Bioabsorbent is genetically engineered bacteria which is capable of absorbing heavy metal from water significantly and will auto-aggregate and sediment after water detoxified.<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;Based on the principle of Biological Network Control and Reverse Engineering (Chikofsky and Cross, 1990), we engineered our bacteria to resolve these hard truths mentioned above. MerR family transcription factors (TFs) were exploited to construct a series of biorepoters for heavy metal detection and bioabsorbents for heavy metal decontamination (Fig.2 and Fig.3, Hobman, 2007; Hobman et al., 2005). <br> <br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/a/a9/ProFig3.png" ><br><br>Fig3. Schemes of reverse engineering principle based project. We primarily took system apart, followed by description of function, structure and operation of each part, especially the heavy metal responsive regulator. Then mathematical modeling and 3D structure modeling were conducted to analyze the collected information. Then appropriate topology candidates for needed function were carefully searched. We selected a candidate and re-designed genetic components to accomplish expected bioreporter or bioabsorbent function in need, which was verified by following bioware experiments. Therefore, We opened up an alternative approach to efficient and robust biosensor and bioabsorbent engineering.<br><br><br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;We analyzed the function and operation of a MerR family TF, MerR into detail via bioware experiments and modeling. We found that the TF expression level in cytosol and the binding affinity between TF and its operator site have great influence on bacterial sensitivity to mercury. Then, rational design of genetic circuits was conducted to confer mercury sensor and regulator components high efficiency and robustness. As is expected, these constructed bioreporters are capable of discriminating mercury concentration ranging from 10^-8 M to 10^-6 M in water, regardless of incubation time and bioreporter activity in a wide window. In other words, there is no necessity to calibrate before detection. This means that the field application of bioreporter can be carried out without costly equipment while fidelity and sensitivity are still conserved. <br><br><img src="https://static.igem.org/mediawiki/2010/1/11/Sensor.png" ><br />
<img src="https://static.igem.org/mediawiki/2010/2/21/JM1.png"width=400><img src="https://static.igem.org/mediawiki/2010/7/7d/Figure18PKU.png" width=320><img src="https://static.igem.org/mediawiki/2010/3/34/Figure15PKU.jpg"width=320><br><br />
<br />
<br />
<a href="https://2010.igem.org/Team:Peking/Project/Biosensor" target="_blank" >learn more...</a><br><br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;Meanwhile, we took a closer look into the structure of MerR family TFs(Brown et al., 2003; Hobman, 2007; Hobman et al., 2005). The metal binding domain of MerR is a 48-residue, named alpha-helix 5(Guo et al.; Song et al., 2007). A strategy to engineer MerR TF proteins was developed baedsed previous work (Qin et al., 2006; Song et al., 2004). We directly fused two copies of metal binding domain into a single-chain, antiparallel coiled coil, called Metal Binding Peptide ( MBP<html>). And then high-performance bioabsorbent was implemented by expressing MBP on the surface, in periplasm and in cytosol of E.coli, former 2 of which were accomplished by fusion of MBP with special translocation protein, OmpA and DsbA. The following function test results showed that our bacteria can absorb more than 50% of 10-6 mol/L Hg (II) in 2 hours; WHICH IS in consistent with previous work that artificial MBP chain can simulate the in vivo metal-binding ability of dimeric, full-length MerR. <br><br />
<br><img src="https://static.igem.org/mediawiki/2010/4/47/ObsorbentS.png"width=200 ><img src="https://static.igem.org/mediawiki/2010/5/5e/Oc5.jpg" width=400><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"width=320><img src="https://static.igem.org/mediawiki/2010/2/26/Pc4.png"width=320><br><br />
<a href="https://2010.igem.org/Team:Peking/Project/Bioabsorbent" target="_blank" >learn more...</a><br><br />
<br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;Additionally, we noticed that MerR family TFs share a highly conserved homology at their metal binding domain (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioreporter and bioabsorbent engineering may be applicable to other cases. We then expanded our reverse engineering strategy to cope with another common toxic heavy metal, lead (Borremans et al., 2001; Chakraborty et al., 2008; Chen et al., 2005; Julian et al., 2009; Mergeay et al., 2003). We primarily took lead resistance operon apart, followed by description of function, structure and operation of PbrR, a lead responsive regulator. Then modeling was conducted to analyze the characteristics of PbrR and topology of its regulation behavior. Information collected confirmed the possibility to design a genetic circuit whick can make lead sensor and regulator components more efficient and robust. Our engineered E.coli bioreporters is capable of discriminating different concentrations of lead ranging from 10^-8 to 10^-6, similar to mercury bioreporter mentioned above. We also engineered PbrR into single-chain coiled coil (MBP) via the same method as MerR. Exhilaratingly, the following inductive expression of PbrR MBP on the surface, in periplasm and in cytosol along with the lead (II) absorption test showed that our bacteria can absorb more than 95% of 10^-7M Pb (II) in 5 minutes, which is comparable to mercury MBP expression in E.coli, proving validness of our engineering strategy. <br><br />
<br><img src="https://static.igem.org/mediawiki/2010/2/20/ProFigbidui.jpg<br />
"width=68% align=left><embed src="https://static.igem.org/mediawiki/2010/4/4e/MerR.swf" width=32% align=right><br />
<embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf" width=32% align="right"><br><a href="https://2010.igem.org/Team:Peking/Project/Expansion" target="_blank" >learn more...</a><br />
<br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;In summary, we’ve developed a strategy for heavy metal bioreporter and bioabsorbent engineering, based on reverse engineering principle, which will help us to break the limitation of our current knowledge and research method. As MerR family TFs share highly conserved homology and most kinds of heavy metals have corresponding MerR family TFs(Brown et al., 2003; Hobman, 2007; Hobman et al., 2005; Julian et al., 2009), we can state that we have developed an intensible method to construct heavy metal decontamination kits composed of valid bioreporters and bioabsorbents for field application in the near future.<br> </p><br />
<br><br />
</div><br />
<br />
<div id="project description bottom"><br />
<div id="bottomwhite"><br />
<br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="80px"alt="go back to top"></a><br />
<a href="https://2010.igem.org/Team:Peking/Project/ProjectDiscription/Reference" target="_blank">reference</a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</div><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/ProjectDiscriptionTeam:Peking/Project/ProjectDiscription2010-10-28T00:25:30Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Project Discription</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/ProjectDiscription|Project Discription]] <html><br />
</div><br />
<div id="project description"><br />
<div id="middlewhite"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:center;<br />
}<br />
</style><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;Pollution of toxic heavy metals generated by anthropogenic activities is a worldwide concern while aquatic environments are frequently the final recipients of most of heavy metal pollutants (Bakis and Tuncan; Boyd). For instance, enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (Fig.1 Tchounwou et al., 2003). Traditional techniques to detect or decontaminate heavy metals in natural samples can be costly and time consuming, especially at low metal concentration; therefore, robust and inexpensive methods to detect and decontaminate heavy metals in water are highly desirable (Tecon and van der Meer, 2008; van der Meer and Belkin). Namely, we need to develop a high-performance heavy metal decontamination kit which can accomplish the detection and absorption of heavy metals in aquatic environment conveniently.<br> <br><br />
<img src="https://static.igem.org/mediawiki/2010/0/00/ProFig1.jpg" width="530" alt="Enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (A) Profile of historic concentrations of Hg in the Upper Fremont Glacier. (D) Profiles of anthropogenic Pb fluxes in Lake Bolterskardet. Adapted from Tchounwou et al., 2003"><br><br><br />
Fig.1&nbsp;Enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (A) Profile of historic concentrations of Hg in the Upper Fremont Glacier. (D) Profiles of anthropogenic Pb fluxes in Lake Bolterskardet. Adapted from Tchounwou et al., 2003<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;In the field of biodetection and bioremediation, despite numerous proofs of principle, most bioreporters and bioabsorbents have remained confined to the laboratory (van der Meer and Belkin). Also, bacterial reporters and absorbents are NOT rational enough in design and NOT complex enough in function (Chakraborty et al., 2008; Diesel et al., 2009; Sharon Yagur-Kroll, 2010). Additionally, we notice that genetic manipulation in this field is in need of streamline methods (Hansen and Sorensen, 2000) and it's time for a series of issues on the field application to be taken into consideration (Kuppardt et al., 2009).<br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>https://static.igem.org/mediawiki/2010/4/46/Pkulogo.jpg" <html><br><br><br />
Fig2. Our heavy metal decontamination kit consists of a bioreporter system and a bioabsorbent. Bioreporter system acts as a sensor for certain heavy metal and will report the presence and extent of heavy metal pollution in water by a quantifiable and naked-eye recognizable output signal. When heavy metal detected, bioabsorbent will be put to use. Bioabsorbent is genetically engineered bacteria which is capable of absorbing heavy metal from water significantly and will auto-aggregate and sediment after water detoxified.<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;Based on the principle of Biological Network Control and Reverse Engineering (Chikofsky and Cross, 1990), we engineered our bacteria to resolve these hard truths mentioned above. MerR family transcription factors (TFs) were exploited to construct a series of biorepoters for heavy metal detection and bioabsorbents for heavy metal decontamination (Fig.2 and Fig.3, Hobman, 2007; Hobman et al., 2005). <br> <br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/a/a9/ProFig3.png" ><br><br>Fig3. Schemes of reverse engineering principle based project. We primarily took system apart, followed by description of function, structure and operation of each part, especially the heavy metal responsive regulator. Then mathematical modeling and 3D structure modeling were conducted to analyze the collected information. Then appropriate topology candidates for needed function were carefully searched. We selected a candidate and re-designed genetic components to accomplish expected bioreporter or bioabsorbent function in need, which was verified by following bioware experiments. Therefore, We opened up an alternative approach to efficient and robust biosensor and bioabsorbent engineering.<br><br><br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;We analyzed the function and operation of a MerR family TF, MerR into detail via bioware experiments and modeling. We found that the TF expression level in cytosol and the binding affinity between TF and its operator site have great influence on bacterial sensitivity to mercury. Then, rational design of genetic circuits was conducted to confer mercury sensor and regulator components high efficiency and robustness. As is expected, these constructed bioreporters are capable of discriminating mercury concentration ranging from 10^-8 M to 10^-6 M in water, regardless of incubation time and bioreporter activity in a wide window. In other words, there is no necessity to calibrate before detection. This means that the field application of bioreporter can be carried out without costly equipment while fidelity and sensitivity are still conserved. <br><br><img src="https://static.igem.org/mediawiki/2010/1/11/Sensor.png" ><br />
<img src="https://static.igem.org/mediawiki/2010/2/21/JM1.png"width=400><img src="https://static.igem.org/mediawiki/2010/7/7d/Figure18PKU.png" width=320><img src="https://static.igem.org/mediawiki/2010/3/34/Figure15PKU.jpg"width=320><br><br />
<br />
<br />
<a href="https://2010.igem.org/Team:Peking/Project/Biosensor" target="_blank" >learn more...</a><br><br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;Meanwhile, we took a closer look into the structure of MerR family TFs(Brown et al., 2003; Hobman, 2007; Hobman et al., 2005). The metal binding domain of MerR is a 48-residue, named alpha-helix 5(Guo et al.; Song et al., 2007). A strategy to engineer MerR TF proteins was developed baedsed previous work (Qin et al., 2006; Song et al., 2004). We directly fused two copies of metal binding domain into a single-chain, antiparallel coiled coil, called Metal Binding Peptide ( MBP<html>). And then high-performance bioabsorbent was implemented by expressing MBP on the surface, in periplasm and in cytosol of E.coli, former 2 of which were accomplished by fusion of MBP with special translocation protein, OmpA and DsbA. The following function test results showed that our bacteria can absorb more than 50% of 10-6 mol/L Hg (II) in 2 hours; WHICH IS in consistent with previous work that artificial MBP chain can simulate the in vivo metal-binding ability of dimeric, full-length MerR. <br><br />
<br><img src="https://static.igem.org/mediawiki/2010/4/47/ObsorbentS.png"width=200 ><img src="https://static.igem.org/mediawiki/2010/5/5e/Oc5.jpg" width=400><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"width=320><img src="https://static.igem.org/mediawiki/2010/2/26/Pc4.png"width=320><br><br />
<a href="https://2010.igem.org/Team:Peking/Project/Bioabsorbent" target="_blank" >learn more...</a><br><br />
<br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;Additionally, we noticed that MerR family TFs share a highly conserved homology at their metal binding domain (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioreporter and bioabsorbent engineering may be applicable to other cases. We then expanded our reverse engineering strategy to cope with another common toxic heavy metal, lead (Borremans et al., 2001; Chakraborty et al., 2008; Chen et al., 2005; Julian et al., 2009; Mergeay et al., 2003). We primarily took lead resistance operon apart, followed by description of function, structure and operation of PbrR, a lead responsive regulator. Then modeling was conducted to analyze the characteristics of PbrR and topology of its regulation behavior. Information collected confirmed the possibility to design a genetic circuit whick can make lead sensor and regulator components more efficient and robust. Our engineered E.coli bioreporters is capable of discriminating different concentrations of lead ranging from 10^-8 to 10^-6, similar to mercury bioreporter mentioned above. We also engineered PbrR into single-chain coiled coil (MBP) via the same method as MerR. Exhilaratingly, the following inductive expression of PbrR MBP on the surface, in periplasm and in cytosol along with the lead (II) absorption test showed that our bacteria can absorb more than 95% of 10^-7M Pb (II) in 5 minutes, which is comparable to mercury MBP expression in E.coli, proving validness of our engineering strategy. <br><br />
<br><img src="https://static.igem.org/mediawiki/2010/2/20/ProFigbidui.jpg<br />
"width=68% align=left><embed src="https://static.igem.org/mediawiki/2010/4/4e/MerR.swf" width=32% align=right><br />
<embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf" width=32% align="right"><br><a href="https://2010.igem.org/Team:Peking/Project/Expansion" target="_blank" >learn more...</a><br />
<br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;In summary, we’ve developed a strategy for heavy metal bioreporter and bioabsorbent engineering, based on reverse engineering principle, which will help us to break the limitation of our current knowledge and research method. As MerR family TFs share highly conserved homology and most kinds of heavy metals have corresponding MerR family TFs(Brown et al., 2003; Hobman, 2007; Hobman et al., 2005; Julian et al., 2009), we can state that we have developed an intensible method to construct heavy metal decontamination kits composed of valid bioreporters and bioabsorbents for field application in the near future.<br> </p><br />
<br><br />
</div><br />
<br />
<div id="project description bottom"><br />
<div id="bottomwhite"><br />
<br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="80px"alt="go back to top"></a><br />
<a href="https://2010.igem.org/Team:Peking/Project/ProjectDiscription/Reference" target="_blank">reference</a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</div><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/File:Pkulogo.jpgFile:Pkulogo.jpg2010-10-28T00:24:04Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/ProjectDiscriptionTeam:Peking/Project/ProjectDiscription2010-10-28T00:22:32Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Project Discription</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/ProjectDiscription|Project Discription]] <html><br />
</div><br />
<div id="project description"><br />
<div id="middlewhite"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:center;<br />
}<br />
</style><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;Pollution of toxic heavy metals generated by anthropogenic activities is a worldwide concern while aquatic environments are frequently the final recipients of most of heavy metal pollutants (Bakis and Tuncan; Boyd). For instance, enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (Fig.1 Tchounwou et al., 2003). Traditional techniques to detect or decontaminate heavy metals in natural samples can be costly and time consuming, especially at low metal concentration; therefore, robust and inexpensive methods to detect and decontaminate heavy metals in water are highly desirable (Tecon and van der Meer, 2008; van der Meer and Belkin). Namely, we need to develop a high-performance heavy metal decontamination kit which can accomplish the detection and absorption of heavy metals in aquatic environment conveniently.<br> <br><br />
<img src="https://static.igem.org/mediawiki/2010/0/00/ProFig1.jpg" width="530" alt="Enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (A) Profile of historic concentrations of Hg in the Upper Fremont Glacier. (D) Profiles of anthropogenic Pb fluxes in Lake Bolterskardet. Adapted from Tchounwou et al., 2003"><br><br><br />
Fig.1&nbsp;Enhanced accumulation inferred from sediment and ice cores clearly show mercury continually accumulates in waters and rivers (A) Profile of historic concentrations of Hg in the Upper Fremont Glacier. (D) Profiles of anthropogenic Pb fluxes in Lake Bolterskardet. Adapted from Tchounwou et al., 2003<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;In the field of biodetection and bioremediation, despite numerous proofs of principle, most bioreporters and bioabsorbents have remained confined to the laboratory (van der Meer and Belkin). Also, bacterial reporters and absorbents are NOT rational enough in design and NOT complex enough in function (Chakraborty et al., 2008; Diesel et al., 2009; Sharon Yagur-Kroll, 2010). Additionally, we notice that genetic manipulation in this field is in need of streamline methods (Hansen and Sorensen, 2000) and it's time for a series of issues on the field application to be taken into consideration (Kuppardt et al., 2009).<br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2010/7/7d/T-shirt2.png" width="400" alt="bio decontamination kit"><br><br><br />
Fig2. Our heavy metal decontamination kit consists of a bioreporter system and a bioabsorbent. Bioreporter system acts as a sensor for certain heavy metal and will report the presence and extent of heavy metal pollution in water by a quantifiable and naked-eye recognizable output signal. When heavy metal detected, bioabsorbent will be put to use. Bioabsorbent is genetically engineered bacteria which is capable of absorbing heavy metal from water significantly and will auto-aggregate and sediment after water detoxified.<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;Based on the principle of Biological Network Control and Reverse Engineering (Chikofsky and Cross, 1990), we engineered our bacteria to resolve these hard truths mentioned above. MerR family transcription factors (TFs) were exploited to construct a series of biorepoters for heavy metal detection and bioabsorbents for heavy metal decontamination (Fig.2 and Fig.3, Hobman, 2007; Hobman et al., 2005). <br> <br> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<img src="https://static.igem.org/mediawiki/2010/a/a9/ProFig3.png" ><br><br>Fig3. Schemes of reverse engineering principle based project. We primarily took system apart, followed by description of function, structure and operation of each part, especially the heavy metal responsive regulator. Then mathematical modeling and 3D structure modeling were conducted to analyze the collected information. Then appropriate topology candidates for needed function were carefully searched. We selected a candidate and re-designed genetic components to accomplish expected bioreporter or bioabsorbent function in need, which was verified by following bioware experiments. Therefore, We opened up an alternative approach to efficient and robust biosensor and bioabsorbent engineering.<br><br><br><br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;We analyzed the function and operation of a MerR family TF, MerR into detail via bioware experiments and modeling. We found that the TF expression level in cytosol and the binding affinity between TF and its operator site have great influence on bacterial sensitivity to mercury. Then, rational design of genetic circuits was conducted to confer mercury sensor and regulator components high efficiency and robustness. As is expected, these constructed bioreporters are capable of discriminating mercury concentration ranging from 10^-8 M to 10^-6 M in water, regardless of incubation time and bioreporter activity in a wide window. In other words, there is no necessity to calibrate before detection. This means that the field application of bioreporter can be carried out without costly equipment while fidelity and sensitivity are still conserved. <br><br><img src="https://static.igem.org/mediawiki/2010/1/11/Sensor.png" ><br />
<img src="https://static.igem.org/mediawiki/2010/2/21/JM1.png"width=400><img src="https://static.igem.org/mediawiki/2010/7/7d/Figure18PKU.png" width=320><img src="https://static.igem.org/mediawiki/2010/3/34/Figure15PKU.jpg"width=320><br><br />
<br />
<br />
<a href="https://2010.igem.org/Team:Peking/Project/Biosensor" target="_blank" >learn more...</a><br><br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;Meanwhile, we took a closer look into the structure of MerR family TFs(Brown et al., 2003; Hobman, 2007; Hobman et al., 2005). The metal binding domain of MerR is a 48-residue, named alpha-helix 5(Guo et al.; Song et al., 2007). A strategy to engineer MerR TF proteins was developed baedsed previous work (Qin et al., 2006; Song et al., 2004). We directly fused two copies of metal binding domain into a single-chain, antiparallel coiled coil, called Metal Binding Peptide ( MBP<html>). And then high-performance bioabsorbent was implemented by expressing MBP on the surface, in periplasm and in cytosol of E.coli, former 2 of which were accomplished by fusion of MBP with special translocation protein, OmpA and DsbA. The following function test results showed that our bacteria can absorb more than 50% of 10-6 mol/L Hg (II) in 2 hours; WHICH IS in consistent with previous work that artificial MBP chain can simulate the in vivo metal-binding ability of dimeric, full-length MerR. <br><br />
<br><img src="https://static.igem.org/mediawiki/2010/4/47/ObsorbentS.png"width=200 ><img src="https://static.igem.org/mediawiki/2010/5/5e/Oc5.jpg" width=400><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"width=320><img src="https://static.igem.org/mediawiki/2010/2/26/Pc4.png"width=320><br><br />
<a href="https://2010.igem.org/Team:Peking/Project/Bioabsorbent" target="_blank" >learn more...</a><br><br />
<br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;Additionally, we noticed that MerR family TFs share a highly conserved homology at their metal binding domain (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioreporter and bioabsorbent engineering may be applicable to other cases. We then expanded our reverse engineering strategy to cope with another common toxic heavy metal, lead (Borremans et al., 2001; Chakraborty et al., 2008; Chen et al., 2005; Julian et al., 2009; Mergeay et al., 2003). We primarily took lead resistance operon apart, followed by description of function, structure and operation of PbrR, a lead responsive regulator. Then modeling was conducted to analyze the characteristics of PbrR and topology of its regulation behavior. Information collected confirmed the possibility to design a genetic circuit whick can make lead sensor and regulator components more efficient and robust. Our engineered E.coli bioreporters is capable of discriminating different concentrations of lead ranging from 10^-8 to 10^-6, similar to mercury bioreporter mentioned above. We also engineered PbrR into single-chain coiled coil (MBP) via the same method as MerR. Exhilaratingly, the following inductive expression of PbrR MBP on the surface, in periplasm and in cytosol along with the lead (II) absorption test showed that our bacteria can absorb more than 95% of 10^-7M Pb (II) in 5 minutes, which is comparable to mercury MBP expression in E.coli, proving validness of our engineering strategy. <br><br />
<br><img src="https://static.igem.org/mediawiki/2010/2/20/ProFigbidui.jpg<br />
"width=68% align=left><embed src="https://static.igem.org/mediawiki/2010/4/4e/MerR.swf" width=32% align=right><br />
<embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf" width=32% align="right"><br><a href="https://2010.igem.org/Team:Peking/Project/Expansion" target="_blank" >learn more...</a><br />
<br />
<br>&nbsp;&nbsp;&nbsp;&nbsp;In summary, we’ve developed a strategy for heavy metal bioreporter and bioabsorbent engineering, based on reverse engineering principle, which will help us to break the limitation of our current knowledge and research method. As MerR family TFs share highly conserved homology and most kinds of heavy metals have corresponding MerR family TFs(Brown et al., 2003; Hobman, 2007; Hobman et al., 2005; Julian et al., 2009), we can state that we have developed an intensible method to construct heavy metal decontamination kits composed of valid bioreporters and bioabsorbents for field application in the near future.<br> </p><br />
<br><br />
</div><br />
<br />
<div id="project description bottom"><br />
<div id="bottomwhite"><br />
<br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="80px"alt="go back to top"></a><br />
<a href="https://2010.igem.org/Team:Peking/Project/ProjectDiscription/Reference" target="_blank">reference</a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
</div><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Biosensor/BioreporterTeam:Peking/Project/Biosensor/Bioreporter2010-10-27T23:49:11Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Bioreporter</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Biosensor|Biosensor]] > [[Team:Peking/Project/Biosensor/Bioreporter|Bioreporter]]<html><br />
</div><br />
<div id="middlewhite"><br />
</html><br />
==Traffic-Light Bioassay For Application Ease==<br />
&nbsp;&nbsp;&nbsp;&nbsp;Traditional bioassays with biosensor bacteria are usually calibrated with analyte solutions of known concentrations that are analyzed along with the samples of interest (Chakraborty et al., 2008; Hansen and Sorensen, 2000). This is done as bioreporter output (fluorescence or colour) does not only depend on the target concentration, but also on the incubation time and physiological activity of the cells in the assay. Comparing the biosensor output with standardized colour tables in the field application seems rather difficult and error-prone. <br>&nbsp;&nbsp;&nbsp;&nbsp;To solve this hard truth, a new approach called ‘traffic light’ heavy metal bioassay was then developed. Previous work has shown that the “traffic light” bioassay could work independently of external calibration of the bioreporter output, thus to control assay variations and to improve application ease(Anke Wackwitz, 2008). Actually, an internal calibration based on the use of multiple isogenic bioreporter cell lines with the same output but drastically different sensitivity at a given heavy metal concentration is proceeded during this bioassy.<br><br />
<html><a href="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg"><img src="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg" width=650 ></a></html><br><br />
'''Fig 1. The traffic light bioassay uses, for example, four isogenic strains with the same reporter output but differing in the compound concentration threshold at which their reporter circuit is activated. The number of reporter strains reacting to a sample (rather than their reporter signal intensity per se) is then representative for the compound concentration range. Adapted from (van der Meer and Belkin)'''<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;Specially speaking, we pyramided the information collected during the Promoter Characterization, Operation Characterization and Modeling. It has been shown that the expression level of MerR and the binding affinity of MerR to the cognate promoter dyad sequence both significantly determinate the bacterial sensitivity to mercury — higher MerR expression intensity and lower binding affinity of MerR to DNA target would result in a less sensitive bacterial mercury sensor and vice versa. In order to verify this, we constructed a reporter system similar to the ones we used before, as shown in Fig 2C.(<html><a href="https://2010.igem.org/Team:Peking/Project/Biosensor/PromoterCharacterization">to read more…</a></html>). <br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" width=450></a></html><br><br />
'''Fig 2. Result of pyramiding. According to the information collected in promoter characterization and operation characterization, both the expression level of MerR and the semiconserved region of MerR binding site could determine the threshold of mercury sensitivity. (A) Each combination was carefully characterized. All of the dose response curves represented as a hill function. (B) When comparing these combinations, we can easily find that both of the factors worked as expected: for instance, BBa_J23101+Mutant 3 represents a higher threshold than that of BBa_J23101+Mutant 88 and BBa_J23103+Mutant 88 has a higher threshold than BBa_J23101+Mutant 88. (C) The genetic construction of the system used for characterization. '''<br />
<br><br><br />
'''Table 2 The parameters of Hill function fitting.'''<br />
<br />
[[Image:Pkutable2.png|center|650px]]<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Therefore, 4 isogenic biosensor strains with the same reporter output (beta-galactosidase) but differing in the mercury concentration threshold at which their reporter circuit is activated was constructed as is shown in Fig 3. <br><br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Interestingly, when we employed full length LacZ gene (BBa_I732017) as the reporter gene for design in Fig 3, a significant leakage expression emerged which was as high as we could not tell the difference in intensity of the beta-galactosidase activity between experimental group and the control. However, when using LacZ alpha fragment instead, we found that the leakage expression became negligible – Hg (II) induction would significantly activate the beta-galactosidase activity compared with the control and bacteria bearing the mercury sensing device behaved in a dose-response manner in response to mercury concentration gradient (Fig 4), which implied that when separated into 2 peptide fragments, the enzymatic activity of LacZ (beta-galactosidase) decreased remarkably and the decrement could be rescued by higher expression level of the alpha fragment. It was probably because the alpha-complementary process is mediated by intra-molecular non-covalent interactions. In comparison with the full length LacZ, alpha-complement forms the correct conformation for beta-galactosidase activity in lower possibility. Therefore, mercury sensing device exploiting full length LacZ as reporter gene can not actually sense the mercury. However, it may act as the positive control in the traffic light assay, which exhibits beta-galactosidase activity whether mercury is in presence or not (Fig 3). <br><br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg"><img src="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg" width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"><img src="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"><img src="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"><img src="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg"><img src="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg" ></a></html><br />
<br />
'''Fig 3. Scheme of construction of 4 isogenic biosensor strains. It was a pyramiding process during which the phenotypes of bacterial reporter developed previously in our project were combined, in order to implement strains with different mercury sensitivity. (E) BBa_J23103, BBa_J23101 and BBa_J23117 belong to a constitutive promoter library from partsregistry, among which BBa_J23103 is a very weak one, BBa_J23117 is medium and BBa_J23101 is the second strongest in the library. (A)Expression of MerR driven by weak constitutive promoter BBa_J23103 on low copy number plasmid backbone pSB3K3 was pyramided with wild type PmerT which is the most mercury-sensitive promoter combined with LacZ alpha fragment as the reporter gene on plasmid backbone pSB1A3. It is an extreme to confer the bioreporter the most sensitivity, based on our previous results. (B) Strong promoter BBa_J23101 drive the high expression intensity of MerR on plasmid backbone pSB1A2, while PmerT 88 on pSB3K3 is the most insensitive mercury-response promoter developed before. Reporter gene is still lacZ alpha fragment. This is the other extreme of MerR expression intensity, aiming to endow the bacteria the most insensitivity. (C) Promoter BBa_J23117 is medium compared with other 2 constitutive promoters, and the same with PmerT 03 which was screened out previously. This mercury sensing device is expected to be more sensitive than (A) and less than (B). (D) This device is similar to (A), except the reporter gene was replaced by LacZ full length gene. As mentioned in the context, when acting as the reporter gene, full length LacZ represents a significantly leakage expression, giving output regardless of the input, of which we took the advantage to regard it as the positive control in traffic light bioassay. '''<br><br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/85/Pkure1.png"><img src="https://static.igem.org/mediawiki/2010/8/85/Pkure1.png" width=650 ></a></html><br><br />
'''Fig 4. The primary result of traffic light bioassay, which was performed in the 96-well plate. The response of whole-cell bioreporter incubated with simulated mercury containing polluted water was recorded by digital image at 10h, 15h, 20h and 30h. 3 replicates of 1 biosensor strain behaved very similarly with respect to indicating the mercury concentration range in a wide time window. Surprisingly, the biosensor strain we selected was able to response to 7*10^-9M mercury (II) with repeatability and the color contrast of mercury concentration near the threshold seemed to be good. '''<br />
<br />
<br />
Further work to obtain results demonstrating that the bioreporter system using combinations of these biosensor strains to define mercury concentration ranges is still under progressing. However, as data obtained in Fig 4, the strain exploited in the proof of concept has already been sufficient to discriminate mercury concentration range that fits very well with the current permissive (e.g. World Health Organization) levels of mercury in common aquatic environment, such as drinking water (10^-8M) . <br />
<br />
==Tri-Node Response System for Accurate Measurement==<br />
When heavy metal emerges, a tri-node response will be switched on in our biosensor (Fig 5). Different strains with parameter variations between the nodes will have different response threshold to heavy metal ions, such as mercury, according to the result of our modeling. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png" width=650 ></a></html><br><br />
'''Fig 5. Structure of Tri-node response system. According to the results of modeling, we designed the specific genetic circuit to realize the linear response function. Node A is a generator of MerR. For Node B, the gene is the activator which can activate the psid promoter. Node C is GFP whose expression was driven by Psid (activated by activator) and PmerT (activated by MerR). '''<br />
<br />
To get a linear response curve of bioreporter in a wide concentration range, we constructed parameter spectrums. The first one was X1, which represents the concentration of MerR. We constructed the spectrum by prefixing different constitutive promoter to MerR. The second was to change K13 which denotes the affinity between MerR and the PmerT promoter. We exploited random mutagenesis to construct a libarary of PmerT with different MerR binding sequences. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png"><img src="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png" width=650 ></a></html><br><br />
'''Fig 6. Spectrum construction of parameters which are critical to the robustness of our genetic circuit design predicted by our modeling.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png"><img src="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png" width=650 ></a></html><br><br />
'''Fig 7. Our bioreporter with tri-node response system will possess a linear transfer function (right) rather than the natural hill function (left). '''<br />
<br />
<br />
Before wiki freezing, data collecting of the final result (linear transfer function transformed from hill function) are still under progressing. Primary result demonstrated that it worked as expected, which will be shown at Jamboree. <br />
If the transfer function of bioreporter response represents linear, the working range of the bioreporter will be expanded, and the error rating will be reduced. This type of bioreporter will be excellent for in lab accurate measurement or heavy metal pollution assessment.<br />
<br />
==Reference==<br />
Anke Wackwitz, H.H., Antonis Chatzinotas, Uta Breuer, Christelle Vogne, Jan Roelof Van Der Meer (2008). Internal arsenite bioassay calibration using multiple bioreporter cell lines. Microbial Biotechnology 1, 149-157.<br>Chakraborty, T., Babu, P.G., Alam, A., and Chaudhari, A. (2008). GFP expressing bacterial biosensor to measure lead contamination in aquatic environment. Current Science 94, 800-805.<br>Hansen, L.H., and Sorensen, S.J. (2000). Versatile biosensor vectors for detection and quantification of mercury. FEMS Microbiol Lett 193, 123-127.<br>van der Meer, J.R., and Belkin, S. Where microbiology meets microengineering: design and applications of reporter bacteria. Nat Rev Microbiol 8, 511-522.<br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Biosensor/BioreporterTeam:Peking/Project/Biosensor/Bioreporter2010-10-27T23:48:40Z<p>Cathterry: /* Tri-Node Response System for Accurate Measurement */</p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Bioreporter</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Biosensor|Biosensor]] > [[Team:Peking/Project/Biosensor/Bioreporter|Bioreporter]]<html><br />
</div><br />
<div id="middlewhite"><br />
</html><br />
=Traffic-Light Bioassay For Application Ease=<br />
&nbsp;&nbsp;&nbsp;&nbsp;Traditional bioassays with biosensor bacteria are usually calibrated with analyte solutions of known concentrations that are analyzed along with the samples of interest (Chakraborty et al., 2008; Hansen and Sorensen, 2000). This is done as bioreporter output (fluorescence or colour) does not only depend on the target concentration, but also on the incubation time and physiological activity of the cells in the assay. Comparing the biosensor output with standardized colour tables in the field application seems rather difficult and error-prone. <br>&nbsp;&nbsp;&nbsp;&nbsp;To solve this hard truth, a new approach called ‘traffic light’ heavy metal bioassay was then developed. Previous work has shown that the “traffic light” bioassay could work independently of external calibration of the bioreporter output, thus to control assay variations and to improve application ease(Anke Wackwitz, 2008). Actually, an internal calibration based on the use of multiple isogenic bioreporter cell lines with the same output but drastically different sensitivity at a given heavy metal concentration is proceeded during this bioassy.<br><br />
<html><a href="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg"><img src="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg" width=650 ></a></html><br><br />
'''Fig 1. The traffic light bioassay uses, for example, four isogenic strains with the same reporter output but differing in the compound concentration threshold at which their reporter circuit is activated. The number of reporter strains reacting to a sample (rather than their reporter signal intensity per se) is then representative for the compound concentration range. Adapted from (van der Meer and Belkin)'''<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;Specially speaking, we pyramided the information collected during the Promoter Characterization, Operation Characterization and Modeling. It has been shown that the expression level of MerR and the binding affinity of MerR to the cognate promoter dyad sequence both significantly determinate the bacterial sensitivity to mercury — higher MerR expression intensity and lower binding affinity of MerR to DNA target would result in a less sensitive bacterial mercury sensor and vice versa. In order to verify this, we constructed a reporter system similar to the ones we used before, as shown in Fig 2C.(<html><a href="https://2010.igem.org/Team:Peking/Project/Biosensor/PromoterCharacterization">to read more…</a></html>). <br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" width=450></a></html><br><br />
'''Fig 2. Result of pyramiding. According to the information collected in promoter characterization and operation characterization, both the expression level of MerR and the semiconserved region of MerR binding site could determine the threshold of mercury sensitivity. (A) Each combination was carefully characterized. All of the dose response curves represented as a hill function. (B) When comparing these combinations, we can easily find that both of the factors worked as expected: for instance, BBa_J23101+Mutant 3 represents a higher threshold than that of BBa_J23101+Mutant 88 and BBa_J23103+Mutant 88 has a higher threshold than BBa_J23101+Mutant 88. (C) The genetic construction of the system used for characterization. '''<br />
<br><br><br />
'''Table 2 The parameters of Hill function fitting.'''<br />
<br />
[[Image:Pkutable2.png|center|650px]]<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Therefore, 4 isogenic biosensor strains with the same reporter output (beta-galactosidase) but differing in the mercury concentration threshold at which their reporter circuit is activated was constructed as is shown in Fig 3. <br><br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Interestingly, when we employed full length LacZ gene (BBa_I732017) as the reporter gene for design in Fig 3, a significant leakage expression emerged which was as high as we could not tell the difference in intensity of the beta-galactosidase activity between experimental group and the control. However, when using LacZ alpha fragment instead, we found that the leakage expression became negligible – Hg (II) induction would significantly activate the beta-galactosidase activity compared with the control and bacteria bearing the mercury sensing device behaved in a dose-response manner in response to mercury concentration gradient (Fig 4), which implied that when separated into 2 peptide fragments, the enzymatic activity of LacZ (beta-galactosidase) decreased remarkably and the decrement could be rescued by higher expression level of the alpha fragment. It was probably because the alpha-complementary process is mediated by intra-molecular non-covalent interactions. In comparison with the full length LacZ, alpha-complement forms the correct conformation for beta-galactosidase activity in lower possibility. Therefore, mercury sensing device exploiting full length LacZ as reporter gene can not actually sense the mercury. However, it may act as the positive control in the traffic light assay, which exhibits beta-galactosidase activity whether mercury is in presence or not (Fig 3). <br><br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg"><img src="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg" width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"><img src="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"><img src="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"><img src="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg"><img src="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg" ></a></html><br />
<br />
'''Fig 3. Scheme of construction of 4 isogenic biosensor strains. It was a pyramiding process during which the phenotypes of bacterial reporter developed previously in our project were combined, in order to implement strains with different mercury sensitivity. (E) BBa_J23103, BBa_J23101 and BBa_J23117 belong to a constitutive promoter library from partsregistry, among which BBa_J23103 is a very weak one, BBa_J23117 is medium and BBa_J23101 is the second strongest in the library. (A)Expression of MerR driven by weak constitutive promoter BBa_J23103 on low copy number plasmid backbone pSB3K3 was pyramided with wild type PmerT which is the most mercury-sensitive promoter combined with LacZ alpha fragment as the reporter gene on plasmid backbone pSB1A3. It is an extreme to confer the bioreporter the most sensitivity, based on our previous results. (B) Strong promoter BBa_J23101 drive the high expression intensity of MerR on plasmid backbone pSB1A2, while PmerT 88 on pSB3K3 is the most insensitive mercury-response promoter developed before. Reporter gene is still lacZ alpha fragment. This is the other extreme of MerR expression intensity, aiming to endow the bacteria the most insensitivity. (C) Promoter BBa_J23117 is medium compared with other 2 constitutive promoters, and the same with PmerT 03 which was screened out previously. This mercury sensing device is expected to be more sensitive than (A) and less than (B). (D) This device is similar to (A), except the reporter gene was replaced by LacZ full length gene. As mentioned in the context, when acting as the reporter gene, full length LacZ represents a significantly leakage expression, giving output regardless of the input, of which we took the advantage to regard it as the positive control in traffic light bioassay. '''<br><br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/85/Pkure1.png"><img src="https://static.igem.org/mediawiki/2010/8/85/Pkure1.png" width=650 ></a></html><br><br />
'''Fig 4. The primary result of traffic light bioassay, which was performed in the 96-well plate. The response of whole-cell bioreporter incubated with simulated mercury containing polluted water was recorded by digital image at 10h, 15h, 20h and 30h. 3 replicates of 1 biosensor strain behaved very similarly with respect to indicating the mercury concentration range in a wide time window. Surprisingly, the biosensor strain we selected was able to response to 7*10^-9M mercury (II) with repeatability and the color contrast of mercury concentration near the threshold seemed to be good. '''<br />
<br />
<br />
Further work to obtain results demonstrating that the bioreporter system using combinations of these biosensor strains to define mercury concentration ranges is still under progressing. However, as data obtained in Fig 4, the strain exploited in the proof of concept has already been sufficient to discriminate mercury concentration range that fits very well with the current permissive (e.g. World Health Organization) levels of mercury in common aquatic environment, such as drinking water (10^-8M) . <br />
<br />
==Tri-Node Response System for Accurate Measurement==<br />
When heavy metal emerges, a tri-node response will be switched on in our biosensor (Fig 5). Different strains with parameter variations between the nodes will have different response threshold to heavy metal ions, such as mercury, according to the result of our modeling. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png" width=650 ></a></html><br><br />
'''Fig 5. Structure of Tri-node response system. According to the results of modeling, we designed the specific genetic circuit to realize the linear response function. Node A is a generator of MerR. For Node B, the gene is the activator which can activate the psid promoter. Node C is GFP whose expression was driven by Psid (activated by activator) and PmerT (activated by MerR). '''<br />
<br />
To get a linear response curve of bioreporter in a wide concentration range, we constructed parameter spectrums. The first one was X1, which represents the concentration of MerR. We constructed the spectrum by prefixing different constitutive promoter to MerR. The second was to change K13 which denotes the affinity between MerR and the PmerT promoter. We exploited random mutagenesis to construct a libarary of PmerT with different MerR binding sequences. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png"><img src="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png" width=650 ></a></html><br><br />
'''Fig 6. Spectrum construction of parameters which are critical to the robustness of our genetic circuit design predicted by our modeling.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png"><img src="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png" width=650 ></a></html><br><br />
'''Fig 7. Our bioreporter with tri-node response system will possess a linear transfer function (right) rather than the natural hill function (left). '''<br />
<br />
<br />
Before wiki freezing, data collecting of the final result (linear transfer function transformed from hill function) are still under progressing. Primary result demonstrated that it worked as expected, which will be shown at Jamboree. <br />
If the transfer function of bioreporter response represents linear, the working range of the bioreporter will be expanded, and the error rating will be reduced. This type of bioreporter will be excellent for in lab accurate measurement or heavy metal pollution assessment.<br />
<br />
==Reference==<br />
Anke Wackwitz, H.H., Antonis Chatzinotas, Uta Breuer, Christelle Vogne, Jan Roelof Van Der Meer (2008). Internal arsenite bioassay calibration using multiple bioreporter cell lines. Microbial Biotechnology 1, 149-157.<br>Chakraborty, T., Babu, P.G., Alam, A., and Chaudhari, A. (2008). GFP expressing bacterial biosensor to measure lead contamination in aquatic environment. Current Science 94, 800-805.<br>Hansen, L.H., and Sorensen, S.J. (2000). Versatile biosensor vectors for detection and quantification of mercury. FEMS Microbiol Lett 193, 123-127.<br>van der Meer, J.R., and Belkin, S. Where microbiology meets microengineering: design and applications of reporter bacteria. Nat Rev Microbiol 8, 511-522.<br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Biosensor/BioreporterTeam:Peking/Project/Biosensor/Bioreporter2010-10-27T23:48:19Z<p>Cathterry: /* Tri-Node Response System for Accurate Measurement */</p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Bioreporter</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Biosensor|Biosensor]] > [[Team:Peking/Project/Biosensor/Bioreporter|Bioreporter]]<html><br />
</div><br />
<div id="middlewhite"><br />
</html><br />
=Traffic-Light Bioassay For Application Ease=<br />
&nbsp;&nbsp;&nbsp;&nbsp;Traditional bioassays with biosensor bacteria are usually calibrated with analyte solutions of known concentrations that are analyzed along with the samples of interest (Chakraborty et al., 2008; Hansen and Sorensen, 2000). This is done as bioreporter output (fluorescence or colour) does not only depend on the target concentration, but also on the incubation time and physiological activity of the cells in the assay. Comparing the biosensor output with standardized colour tables in the field application seems rather difficult and error-prone. <br>&nbsp;&nbsp;&nbsp;&nbsp;To solve this hard truth, a new approach called ‘traffic light’ heavy metal bioassay was then developed. Previous work has shown that the “traffic light” bioassay could work independently of external calibration of the bioreporter output, thus to control assay variations and to improve application ease(Anke Wackwitz, 2008). Actually, an internal calibration based on the use of multiple isogenic bioreporter cell lines with the same output but drastically different sensitivity at a given heavy metal concentration is proceeded during this bioassy.<br><br />
<html><a href="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg"><img src="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg" width=650 ></a></html><br><br />
'''Fig 1. The traffic light bioassay uses, for example, four isogenic strains with the same reporter output but differing in the compound concentration threshold at which their reporter circuit is activated. The number of reporter strains reacting to a sample (rather than their reporter signal intensity per se) is then representative for the compound concentration range. Adapted from (van der Meer and Belkin)'''<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;Specially speaking, we pyramided the information collected during the Promoter Characterization, Operation Characterization and Modeling. It has been shown that the expression level of MerR and the binding affinity of MerR to the cognate promoter dyad sequence both significantly determinate the bacterial sensitivity to mercury — higher MerR expression intensity and lower binding affinity of MerR to DNA target would result in a less sensitive bacterial mercury sensor and vice versa. In order to verify this, we constructed a reporter system similar to the ones we used before, as shown in Fig 2C.(<html><a href="https://2010.igem.org/Team:Peking/Project/Biosensor/PromoterCharacterization">to read more…</a></html>). <br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" width=450></a></html><br><br />
'''Fig 2. Result of pyramiding. According to the information collected in promoter characterization and operation characterization, both the expression level of MerR and the semiconserved region of MerR binding site could determine the threshold of mercury sensitivity. (A) Each combination was carefully characterized. All of the dose response curves represented as a hill function. (B) When comparing these combinations, we can easily find that both of the factors worked as expected: for instance, BBa_J23101+Mutant 3 represents a higher threshold than that of BBa_J23101+Mutant 88 and BBa_J23103+Mutant 88 has a higher threshold than BBa_J23101+Mutant 88. (C) The genetic construction of the system used for characterization. '''<br />
<br><br><br />
'''Table 2 The parameters of Hill function fitting.'''<br />
<br />
[[Image:Pkutable2.png|center|650px]]<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Therefore, 4 isogenic biosensor strains with the same reporter output (beta-galactosidase) but differing in the mercury concentration threshold at which their reporter circuit is activated was constructed as is shown in Fig 3. <br><br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Interestingly, when we employed full length LacZ gene (BBa_I732017) as the reporter gene for design in Fig 3, a significant leakage expression emerged which was as high as we could not tell the difference in intensity of the beta-galactosidase activity between experimental group and the control. However, when using LacZ alpha fragment instead, we found that the leakage expression became negligible – Hg (II) induction would significantly activate the beta-galactosidase activity compared with the control and bacteria bearing the mercury sensing device behaved in a dose-response manner in response to mercury concentration gradient (Fig 4), which implied that when separated into 2 peptide fragments, the enzymatic activity of LacZ (beta-galactosidase) decreased remarkably and the decrement could be rescued by higher expression level of the alpha fragment. It was probably because the alpha-complementary process is mediated by intra-molecular non-covalent interactions. In comparison with the full length LacZ, alpha-complement forms the correct conformation for beta-galactosidase activity in lower possibility. Therefore, mercury sensing device exploiting full length LacZ as reporter gene can not actually sense the mercury. However, it may act as the positive control in the traffic light assay, which exhibits beta-galactosidase activity whether mercury is in presence or not (Fig 3). <br><br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg"><img src="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg" width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"><img src="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"><img src="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"><img src="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg"><img src="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg" ></a></html><br />
<br />
'''Fig 3. Scheme of construction of 4 isogenic biosensor strains. It was a pyramiding process during which the phenotypes of bacterial reporter developed previously in our project were combined, in order to implement strains with different mercury sensitivity. (E) BBa_J23103, BBa_J23101 and BBa_J23117 belong to a constitutive promoter library from partsregistry, among which BBa_J23103 is a very weak one, BBa_J23117 is medium and BBa_J23101 is the second strongest in the library. (A)Expression of MerR driven by weak constitutive promoter BBa_J23103 on low copy number plasmid backbone pSB3K3 was pyramided with wild type PmerT which is the most mercury-sensitive promoter combined with LacZ alpha fragment as the reporter gene on plasmid backbone pSB1A3. It is an extreme to confer the bioreporter the most sensitivity, based on our previous results. (B) Strong promoter BBa_J23101 drive the high expression intensity of MerR on plasmid backbone pSB1A2, while PmerT 88 on pSB3K3 is the most insensitive mercury-response promoter developed before. Reporter gene is still lacZ alpha fragment. This is the other extreme of MerR expression intensity, aiming to endow the bacteria the most insensitivity. (C) Promoter BBa_J23117 is medium compared with other 2 constitutive promoters, and the same with PmerT 03 which was screened out previously. This mercury sensing device is expected to be more sensitive than (A) and less than (B). (D) This device is similar to (A), except the reporter gene was replaced by LacZ full length gene. As mentioned in the context, when acting as the reporter gene, full length LacZ represents a significantly leakage expression, giving output regardless of the input, of which we took the advantage to regard it as the positive control in traffic light bioassay. '''<br><br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/85/Pkure1.png"><img src="https://static.igem.org/mediawiki/2010/8/85/Pkure1.png" width=650 ></a></html><br><br />
'''Fig 4. The primary result of traffic light bioassay, which was performed in the 96-well plate. The response of whole-cell bioreporter incubated with simulated mercury containing polluted water was recorded by digital image at 10h, 15h, 20h and 30h. 3 replicates of 1 biosensor strain behaved very similarly with respect to indicating the mercury concentration range in a wide time window. Surprisingly, the biosensor strain we selected was able to response to 7*10^-9M mercury (II) with repeatability and the color contrast of mercury concentration near the threshold seemed to be good. '''<br />
<br />
<br />
Further work to obtain results demonstrating that the bioreporter system using combinations of these biosensor strains to define mercury concentration ranges is still under progressing. However, as data obtained in Fig 4, the strain exploited in the proof of concept has already been sufficient to discriminate mercury concentration range that fits very well with the current permissive (e.g. World Health Organization) levels of mercury in common aquatic environment, such as drinking water (10^-8M) . <br />
<br />
=Tri-Node Response System for Accurate Measurement=<br />
When heavy metal emerges, a tri-node response will be switched on in our biosensor (Fig 5). Different strains with parameter variations between the nodes will have different response threshold to heavy metal ions, such as mercury, according to the result of our modeling. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png" width=650 ></a></html><br><br />
'''Fig 5. Structure of Tri-node response system. According to the results of modeling, we designed the specific genetic circuit to realize the linear response function. Node A is a generator of MerR. For Node B, the gene is the activator which can activate the psid promoter. Node C is GFP whose expression was driven by Psid (activated by activator) and PmerT (activated by MerR). '''<br />
<br />
To get a linear response curve of bioreporter in a wide concentration range, we constructed parameter spectrums. The first one was X1, which represents the concentration of MerR. We constructed the spectrum by prefixing different constitutive promoter to MerR. The second was to change K13 which denotes the affinity between MerR and the PmerT promoter. We exploited random mutagenesis to construct a libarary of PmerT with different MerR binding sequences. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png"><img src="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png" width=650 ></a></html><br><br />
'''Fig 6. Spectrum construction of parameters which are critical to the robustness of our genetic circuit design predicted by our modeling.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png"><img src="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png" width=650 ></a></html><br><br />
'''Fig 7. Our bioreporter with tri-node response system will possess a linear transfer function (right) rather than the natural hill function (left). '''<br />
<br />
<br />
Before wiki freezing, data collecting of the final result (linear transfer function transformed from hill function) are still under progressing. Primary result demonstrated that it worked as expected, which will be shown at Jamboree. <br />
If the transfer function of bioreporter response represents linear, the working range of the bioreporter will be expanded, and the error rating will be reduced. This type of bioreporter will be excellent for in lab accurate measurement or heavy metal pollution assessment.<br />
<br />
==Reference==<br />
Anke Wackwitz, H.H., Antonis Chatzinotas, Uta Breuer, Christelle Vogne, Jan Roelof Van Der Meer (2008). Internal arsenite bioassay calibration using multiple bioreporter cell lines. Microbial Biotechnology 1, 149-157.<br>Chakraborty, T., Babu, P.G., Alam, A., and Chaudhari, A. (2008). GFP expressing bacterial biosensor to measure lead contamination in aquatic environment. Current Science 94, 800-805.<br>Hansen, L.H., and Sorensen, S.J. (2000). Versatile biosensor vectors for detection and quantification of mercury. FEMS Microbiol Lett 193, 123-127.<br>van der Meer, J.R., and Belkin, S. Where microbiology meets microengineering: design and applications of reporter bacteria. Nat Rev Microbiol 8, 511-522.<br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Biosensor/BioreporterTeam:Peking/Project/Biosensor/Bioreporter2010-10-27T23:47:41Z<p>Cathterry: /* Tri-Node Response System for Accurate Measurement */</p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Bioreporter</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Biosensor|Biosensor]] > [[Team:Peking/Project/Biosensor/Bioreporter|Bioreporter]]<html><br />
</div><br />
<div id="middlewhite"><br />
</html><br />
=Traffic-Light Bioassay For Application Ease=<br />
&nbsp;&nbsp;&nbsp;&nbsp;Traditional bioassays with biosensor bacteria are usually calibrated with analyte solutions of known concentrations that are analyzed along with the samples of interest (Chakraborty et al., 2008; Hansen and Sorensen, 2000). This is done as bioreporter output (fluorescence or colour) does not only depend on the target concentration, but also on the incubation time and physiological activity of the cells in the assay. Comparing the biosensor output with standardized colour tables in the field application seems rather difficult and error-prone. <br>&nbsp;&nbsp;&nbsp;&nbsp;To solve this hard truth, a new approach called ‘traffic light’ heavy metal bioassay was then developed. Previous work has shown that the “traffic light” bioassay could work independently of external calibration of the bioreporter output, thus to control assay variations and to improve application ease(Anke Wackwitz, 2008). Actually, an internal calibration based on the use of multiple isogenic bioreporter cell lines with the same output but drastically different sensitivity at a given heavy metal concentration is proceeded during this bioassy.<br><br />
<html><a href="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg"><img src="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg" width=650 ></a></html><br><br />
'''Fig 1. The traffic light bioassay uses, for example, four isogenic strains with the same reporter output but differing in the compound concentration threshold at which their reporter circuit is activated. The number of reporter strains reacting to a sample (rather than their reporter signal intensity per se) is then representative for the compound concentration range. Adapted from (van der Meer and Belkin)'''<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;Specially speaking, we pyramided the information collected during the Promoter Characterization, Operation Characterization and Modeling. It has been shown that the expression level of MerR and the binding affinity of MerR to the cognate promoter dyad sequence both significantly determinate the bacterial sensitivity to mercury — higher MerR expression intensity and lower binding affinity of MerR to DNA target would result in a less sensitive bacterial mercury sensor and vice versa. In order to verify this, we constructed a reporter system similar to the ones we used before, as shown in Fig 2C.(<html><a href="https://2010.igem.org/Team:Peking/Project/Biosensor/PromoterCharacterization">to read more…</a></html>). <br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" width=450></a></html><br><br />
'''Fig 2. Result of pyramiding. According to the information collected in promoter characterization and operation characterization, both the expression level of MerR and the semiconserved region of MerR binding site could determine the threshold of mercury sensitivity. (A) Each combination was carefully characterized. All of the dose response curves represented as a hill function. (B) When comparing these combinations, we can easily find that both of the factors worked as expected: for instance, BBa_J23101+Mutant 3 represents a higher threshold than that of BBa_J23101+Mutant 88 and BBa_J23103+Mutant 88 has a higher threshold than BBa_J23101+Mutant 88. (C) The genetic construction of the system used for characterization. '''<br />
<br><br><br />
'''Table 2 The parameters of Hill function fitting.'''<br />
<br />
[[Image:Pkutable2.png|center|650px]]<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Therefore, 4 isogenic biosensor strains with the same reporter output (beta-galactosidase) but differing in the mercury concentration threshold at which their reporter circuit is activated was constructed as is shown in Fig 3. <br><br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Interestingly, when we employed full length LacZ gene (BBa_I732017) as the reporter gene for design in Fig 3, a significant leakage expression emerged which was as high as we could not tell the difference in intensity of the beta-galactosidase activity between experimental group and the control. However, when using LacZ alpha fragment instead, we found that the leakage expression became negligible – Hg (II) induction would significantly activate the beta-galactosidase activity compared with the control and bacteria bearing the mercury sensing device behaved in a dose-response manner in response to mercury concentration gradient (Fig 4), which implied that when separated into 2 peptide fragments, the enzymatic activity of LacZ (beta-galactosidase) decreased remarkably and the decrement could be rescued by higher expression level of the alpha fragment. It was probably because the alpha-complementary process is mediated by intra-molecular non-covalent interactions. In comparison with the full length LacZ, alpha-complement forms the correct conformation for beta-galactosidase activity in lower possibility. Therefore, mercury sensing device exploiting full length LacZ as reporter gene can not actually sense the mercury. However, it may act as the positive control in the traffic light assay, which exhibits beta-galactosidase activity whether mercury is in presence or not (Fig 3). <br><br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg"><img src="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg" width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"><img src="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"><img src="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"><img src="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg"><img src="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg" ></a></html><br />
<br />
'''Fig 3. Scheme of construction of 4 isogenic biosensor strains. It was a pyramiding process during which the phenotypes of bacterial reporter developed previously in our project were combined, in order to implement strains with different mercury sensitivity. (E) BBa_J23103, BBa_J23101 and BBa_J23117 belong to a constitutive promoter library from partsregistry, among which BBa_J23103 is a very weak one, BBa_J23117 is medium and BBa_J23101 is the second strongest in the library. (A)Expression of MerR driven by weak constitutive promoter BBa_J23103 on low copy number plasmid backbone pSB3K3 was pyramided with wild type PmerT which is the most mercury-sensitive promoter combined with LacZ alpha fragment as the reporter gene on plasmid backbone pSB1A3. It is an extreme to confer the bioreporter the most sensitivity, based on our previous results. (B) Strong promoter BBa_J23101 drive the high expression intensity of MerR on plasmid backbone pSB1A2, while PmerT 88 on pSB3K3 is the most insensitive mercury-response promoter developed before. Reporter gene is still lacZ alpha fragment. This is the other extreme of MerR expression intensity, aiming to endow the bacteria the most insensitivity. (C) Promoter BBa_J23117 is medium compared with other 2 constitutive promoters, and the same with PmerT 03 which was screened out previously. This mercury sensing device is expected to be more sensitive than (A) and less than (B). (D) This device is similar to (A), except the reporter gene was replaced by LacZ full length gene. As mentioned in the context, when acting as the reporter gene, full length LacZ represents a significantly leakage expression, giving output regardless of the input, of which we took the advantage to regard it as the positive control in traffic light bioassay. '''<br><br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/85/Pkure1.png"><img src="https://static.igem.org/mediawiki/2010/8/85/Pkure1.png" width=650 ></a></html><br><br />
'''Fig 4. The primary result of traffic light bioassay, which was performed in the 96-well plate. The response of whole-cell bioreporter incubated with simulated mercury containing polluted water was recorded by digital image at 10h, 15h, 20h and 30h. 3 replicates of 1 biosensor strain behaved very similarly with respect to indicating the mercury concentration range in a wide time window. Surprisingly, the biosensor strain we selected was able to response to 7*10^-9M mercury (II) with repeatability and the color contrast of mercury concentration near the threshold seemed to be good. '''<br />
<br />
<br />
Further work to obtain results demonstrating that the bioreporter system using combinations of these biosensor strains to define mercury concentration ranges is still under progressing. However, as data obtained in Fig 4, the strain exploited in the proof of concept has already been sufficient to discriminate mercury concentration range that fits very well with the current permissive (e.g. World Health Organization) levels of mercury in common aquatic environment, such as drinking water (10^-8M) . <br />
<br />
==Tri-Node Response System for Accurate Measurement==<br />
When heavy metal emerges, a tri-node response will be switched on in our biosensor (Fig 5). Different strains with parameter variations between the nodes will have different response threshold to heavy metal ions, such as mercury, according to the result of our modeling. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png" width=650 ></a></html><br><br />
'''Fig 5. Structure of Tri-node response system. According to the results of modeling, we designed the specific genetic circuit to realize the linear response function. Node A is a generator of MerR. For Node B, the gene is the activator which can activate the psid promoter. Node C is GFP whose expression was driven by Psid (activated by activator) and PmerT (activated by MerR). '''<br />
<br />
To get a linear response curve of bioreporter in a wide concentration range, we constructed parameter spectrums. The first one was X1, which represents the concentration of MerR. We constructed the spectrum by prefixing different constitutive promoter to MerR. The second was to change K13 which denotes the affinity between MerR and the PmerT promoter. We exploited random mutagenesis to construct a libarary of PmerT with different MerR binding sequences. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png"><img src="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png" width=650 ></a></html><br><br />
'''Fig 6. Spectrum construction of parameters which are critical to the robustness of our genetic circuit design predicted by our modeling.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png"><img src="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png" width=650 ></a></html><br><br />
'''Fig 7. Our bioreporter with tri-node response system will possess a linear transfer function (right) rather than the natural hill function (left). '''<br />
<br />
<br />
Before wiki freezing, data collecting of the final result (linear transfer function transformed from hill function) are still under progressing. Primary result demonstrated that it worked as expected, which will be shown at Jamboree. <br />
If the transfer function of bioreporter response represents linear, the working range of the bioreporter will be expanded, and the error rating will be reduced. This type of bioreporter will be excellent for in lab accurate measurement or heavy metal pollution assessment.<br />
<br />
==Reference==<br />
Anke Wackwitz, H.H., Antonis Chatzinotas, Uta Breuer, Christelle Vogne, Jan Roelof Van Der Meer (2008). Internal arsenite bioassay calibration using multiple bioreporter cell lines. Microbial Biotechnology 1, 149-157.<br>Chakraborty, T., Babu, P.G., Alam, A., and Chaudhari, A. (2008). GFP expressing bacterial biosensor to measure lead contamination in aquatic environment. Current Science 94, 800-805.<br>Hansen, L.H., and Sorensen, S.J. (2000). Versatile biosensor vectors for detection and quantification of mercury. FEMS Microbiol Lett 193, 123-127.<br>van der Meer, J.R., and Belkin, S. Where microbiology meets microengineering: design and applications of reporter bacteria. Nat Rev Microbiol 8, 511-522.<br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Biosensor/BioreporterTeam:Peking/Project/Biosensor/Bioreporter2010-10-27T23:46:04Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Bioreporter</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Biosensor|Biosensor]] > [[Team:Peking/Project/Biosensor/Bioreporter|Bioreporter]]<html><br />
</div><br />
<div id="middlewhite"><br />
</html><br />
=Traffic-Light Bioassay For Application Ease=<br />
&nbsp;&nbsp;&nbsp;&nbsp;Traditional bioassays with biosensor bacteria are usually calibrated with analyte solutions of known concentrations that are analyzed along with the samples of interest (Chakraborty et al., 2008; Hansen and Sorensen, 2000). This is done as bioreporter output (fluorescence or colour) does not only depend on the target concentration, but also on the incubation time and physiological activity of the cells in the assay. Comparing the biosensor output with standardized colour tables in the field application seems rather difficult and error-prone. <br>&nbsp;&nbsp;&nbsp;&nbsp;To solve this hard truth, a new approach called ‘traffic light’ heavy metal bioassay was then developed. Previous work has shown that the “traffic light” bioassay could work independently of external calibration of the bioreporter output, thus to control assay variations and to improve application ease(Anke Wackwitz, 2008). Actually, an internal calibration based on the use of multiple isogenic bioreporter cell lines with the same output but drastically different sensitivity at a given heavy metal concentration is proceeded during this bioassy.<br><br />
<html><a href="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg"><img src="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg" width=650 ></a></html><br><br />
'''Fig 1. The traffic light bioassay uses, for example, four isogenic strains with the same reporter output but differing in the compound concentration threshold at which their reporter circuit is activated. The number of reporter strains reacting to a sample (rather than their reporter signal intensity per se) is then representative for the compound concentration range. Adapted from (van der Meer and Belkin)'''<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;Specially speaking, we pyramided the information collected during the Promoter Characterization, Operation Characterization and Modeling. It has been shown that the expression level of MerR and the binding affinity of MerR to the cognate promoter dyad sequence both significantly determinate the bacterial sensitivity to mercury — higher MerR expression intensity and lower binding affinity of MerR to DNA target would result in a less sensitive bacterial mercury sensor and vice versa. In order to verify this, we constructed a reporter system similar to the ones we used before, as shown in Fig 2C.(<html><a href="https://2010.igem.org/Team:Peking/Project/Biosensor/PromoterCharacterization">to read more…</a></html>). <br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" width=450></a></html><br><br />
'''Fig 2. Result of pyramiding. According to the information collected in promoter characterization and operation characterization, both the expression level of MerR and the semiconserved region of MerR binding site could determine the threshold of mercury sensitivity. (A) Each combination was carefully characterized. All of the dose response curves represented as a hill function. (B) When comparing these combinations, we can easily find that both of the factors worked as expected: for instance, BBa_J23101+Mutant 3 represents a higher threshold than that of BBa_J23101+Mutant 88 and BBa_J23103+Mutant 88 has a higher threshold than BBa_J23101+Mutant 88. (C) The genetic construction of the system used for characterization. '''<br />
<br><br><br />
'''Table 2 The parameters of Hill function fitting.'''<br />
<br />
[[Image:Pkutable2.png|center|650px]]<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Therefore, 4 isogenic biosensor strains with the same reporter output (beta-galactosidase) but differing in the mercury concentration threshold at which their reporter circuit is activated was constructed as is shown in Fig 3. <br><br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Interestingly, when we employed full length LacZ gene (BBa_I732017) as the reporter gene for design in Fig 3, a significant leakage expression emerged which was as high as we could not tell the difference in intensity of the beta-galactosidase activity between experimental group and the control. However, when using LacZ alpha fragment instead, we found that the leakage expression became negligible – Hg (II) induction would significantly activate the beta-galactosidase activity compared with the control and bacteria bearing the mercury sensing device behaved in a dose-response manner in response to mercury concentration gradient (Fig 4), which implied that when separated into 2 peptide fragments, the enzymatic activity of LacZ (beta-galactosidase) decreased remarkably and the decrement could be rescued by higher expression level of the alpha fragment. It was probably because the alpha-complementary process is mediated by intra-molecular non-covalent interactions. In comparison with the full length LacZ, alpha-complement forms the correct conformation for beta-galactosidase activity in lower possibility. Therefore, mercury sensing device exploiting full length LacZ as reporter gene can not actually sense the mercury. However, it may act as the positive control in the traffic light assay, which exhibits beta-galactosidase activity whether mercury is in presence or not (Fig 3). <br><br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg"><img src="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg" width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"><img src="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"><img src="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"><img src="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg"><img src="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg" ></a></html><br />
<br />
'''Fig 3. Scheme of construction of 4 isogenic biosensor strains. It was a pyramiding process during which the phenotypes of bacterial reporter developed previously in our project were combined, in order to implement strains with different mercury sensitivity. (E) BBa_J23103, BBa_J23101 and BBa_J23117 belong to a constitutive promoter library from partsregistry, among which BBa_J23103 is a very weak one, BBa_J23117 is medium and BBa_J23101 is the second strongest in the library. (A)Expression of MerR driven by weak constitutive promoter BBa_J23103 on low copy number plasmid backbone pSB3K3 was pyramided with wild type PmerT which is the most mercury-sensitive promoter combined with LacZ alpha fragment as the reporter gene on plasmid backbone pSB1A3. It is an extreme to confer the bioreporter the most sensitivity, based on our previous results. (B) Strong promoter BBa_J23101 drive the high expression intensity of MerR on plasmid backbone pSB1A2, while PmerT 88 on pSB3K3 is the most insensitive mercury-response promoter developed before. Reporter gene is still lacZ alpha fragment. This is the other extreme of MerR expression intensity, aiming to endow the bacteria the most insensitivity. (C) Promoter BBa_J23117 is medium compared with other 2 constitutive promoters, and the same with PmerT 03 which was screened out previously. This mercury sensing device is expected to be more sensitive than (A) and less than (B). (D) This device is similar to (A), except the reporter gene was replaced by LacZ full length gene. As mentioned in the context, when acting as the reporter gene, full length LacZ represents a significantly leakage expression, giving output regardless of the input, of which we took the advantage to regard it as the positive control in traffic light bioassay. '''<br><br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/85/Pkure1.png"><img src="https://static.igem.org/mediawiki/2010/8/85/Pkure1.png" width=650 ></a></html><br><br />
'''Fig 4. The primary result of traffic light bioassay, which was performed in the 96-well plate. The response of whole-cell bioreporter incubated with simulated mercury containing polluted water was recorded by digital image at 10h, 15h, 20h and 30h. 3 replicates of 1 biosensor strain behaved very similarly with respect to indicating the mercury concentration range in a wide time window. Surprisingly, the biosensor strain we selected was able to response to 7*10^-9M mercury (II) with repeatability and the color contrast of mercury concentration near the threshold seemed to be good. '''<br />
<br />
<br />
Further work to obtain results demonstrating that the bioreporter system using combinations of these biosensor strains to define mercury concentration ranges is still under progressing. However, as data obtained in Fig 4, the strain exploited in the proof of concept has already been sufficient to discriminate mercury concentration range that fits very well with the current permissive (e.g. World Health Organization) levels of mercury in common aquatic environment, such as drinking water (10^-8M) . <br />
<br />
===Tri-Node Response System for Accurate Measurement===<br />
When heavy metal emerges, a tri-node response will be switched on in our biosensor (Fig 5). Different strains with parameter variations between the nodes will have different response threshold to heavy metal ions, such as mercury, according to the result of our modeling. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png" width=650 ></a></html><br><br />
'''Fig 5. Structure of Tri-node response system. According to the results of modeling, we designed the specific genetic circuit to realize the linear response function. Node A is a generator of MerR. For Node B, the gene is the activator which can activate the psid promoter. Node C is GFP whose expression was driven by Psid (activated by activator) and PmerT (activated by MerR). '''<br />
<br />
To get a linear response curve of bioreporter in a wide concentration range, we constructed parameter spectrums. The first one was X1, which represents the concentration of MerR. We constructed the spectrum by prefixing different constitutive promoter to MerR. The second was to change K13 which denotes the affinity between MerR and the PmerT promoter. We exploited random mutagenesis to construct a libarary of PmerT with different MerR binding sequences. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png"><img src="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png" width=650 ></a></html><br><br />
'''Fig 6. Spectrum construction of parameters which are critical to the robustness of our genetic circuit design predicted by our modeling.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png"><img src="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png" width=650 ></a></html><br><br />
'''Fig 7. Our bioreporter with tri-node response system will possess a linear transfer function (right) rather than the natural hill function (left). '''<br />
<br />
<br />
Before wiki freezing, data collecting of the final result (linear transfer function transformed from hill function) are still under progressing. Primary result demonstrated that it worked as expected, which will be shown at Jamboree. <br />
If the transfer function of bioreporter response represents linear, the working range of the bioreporter will be expanded, and the error rating will be reduced. This type of bioreporter will be excellent for in lab accurate measurement or heavy metal pollution assessment. <br />
<br />
<br />
<br />
<br />
==Reference==<br />
Anke Wackwitz, H.H., Antonis Chatzinotas, Uta Breuer, Christelle Vogne, Jan Roelof Van Der Meer (2008). Internal arsenite bioassay calibration using multiple bioreporter cell lines. Microbial Biotechnology 1, 149-157.<br>Chakraborty, T., Babu, P.G., Alam, A., and Chaudhari, A. (2008). GFP expressing bacterial biosensor to measure lead contamination in aquatic environment. Current Science 94, 800-805.<br>Hansen, L.H., and Sorensen, S.J. (2000). Versatile biosensor vectors for detection and quantification of mercury. FEMS Microbiol Lett 193, 123-127.<br>van der Meer, J.R., and Belkin, S. Where microbiology meets microengineering: design and applications of reporter bacteria. Nat Rev Microbiol 8, 511-522.<br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Biosensor/BioreporterTeam:Peking/Project/Biosensor/Bioreporter2010-10-27T23:44:28Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Bioreporter</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Biosensor|Biosensor]] > [[Team:Peking/Project/Biosensor/Bioreporter|Bioreporter]]<html><br />
</div><br />
<div id="middlewhite"><br />
</html><br />
=Traffic-Light Bioassay For Application Ease=<br />
&nbsp;&nbsp;&nbsp;&nbsp;Traditional bioassays with biosensor bacteria are usually calibrated with analyte solutions of known concentrations that are analyzed along with the samples of interest (Chakraborty et al., 2008; Hansen and Sorensen, 2000). This is done as bioreporter output (fluorescence or colour) does not only depend on the target concentration, but also on the incubation time and physiological activity of the cells in the assay. Comparing the biosensor output with standardized colour tables in the field application seems rather difficult and error-prone. <br>&nbsp;&nbsp;&nbsp;&nbsp;To solve this hard truth, a new approach called ‘traffic light’ heavy metal bioassay was then developed. Previous work has shown that the “traffic light” bioassay could work independently of external calibration of the bioreporter output, thus to control assay variations and to improve application ease(Anke Wackwitz, 2008). Actually, an internal calibration based on the use of multiple isogenic bioreporter cell lines with the same output but drastically different sensitivity at a given heavy metal concentration is proceeded during this bioassy.<br><br />
<html><a href="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg"><img src="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg" width=650 ></a></html><br><br />
'''Fig 1. The traffic light bioassay uses, for example, four isogenic strains with the same reporter output but differing in the compound concentration threshold at which their reporter circuit is activated. The number of reporter strains reacting to a sample (rather than their reporter signal intensity per se) is then representative for the compound concentration range. Adapted from (van der Meer and Belkin)'''<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;Specially speaking, we pyramided the information collected during the Promoter Characterization, Operation Characterization and Modeling. It has been shown that the expression level of MerR and the binding affinity of MerR to the cognate promoter dyad sequence both significantly determinate the bacterial sensitivity to mercury — higher MerR expression intensity and lower binding affinity of MerR to DNA target would result in a less sensitive bacterial mercury sensor and vice versa. In order to verify this, we constructed a reporter system similar to the ones we used before, as shown in Fig 2C.(<html><a href="https://2010.igem.org/Team:Peking/Project/Biosensor/PromoterCharacterization">to read more…</a></html>). <br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" width=450></a></html><br><br />
'''Fig 2. Result of pyramiding. According to the information collected in promoter characterization and operation characterization, both the expression level of MerR and the semiconserved region of MerR binding site could determine the threshold of mercury sensitivity. (A) Each combination was carefully characterized. All of the dose response curves represented as a hill function. (B) When comparing these combinations, we can easily find that both of the factors worked as expected: for instance, BBa_J23101+Mutant 3 represents a higher threshold than that of BBa_J23101+Mutant 88 and BBa_J23103+Mutant 88 has a higher threshold than BBa_J23101+Mutant 88. (C) The genetic construction of the system used for characterization. '''<br />
<br><br><br />
'''Table 2 The parameters of Hill function fitting.'''<br />
<br />
[[Image:Pkutable2.png|center|650px]]<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Therefore, 4 isogenic biosensor strains with the same reporter output (beta-galactosidase) but differing in the mercury concentration threshold at which their reporter circuit is activated was constructed as is shown in Fig 3. <br><br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Interestingly, when we employed full length LacZ gene (BBa_I732017) as the reporter gene for design in Fig 3, a significant leakage expression emerged which was as high as we could not tell the difference in intensity of the beta-galactosidase activity between experimental group and the control. However, when using LacZ alpha fragment instead, we found that the leakage expression became negligible – Hg (II) induction would significantly activate the beta-galactosidase activity compared with the control and bacteria bearing the mercury sensing device behaved in a dose-response manner in response to mercury concentration gradient (Fig 4), which implied that when separated into 2 peptide fragments, the enzymatic activity of LacZ (beta-galactosidase) decreased remarkably and the decrement could be rescued by higher expression level of the alpha fragment. It was probably because the alpha-complementary process is mediated by intra-molecular non-covalent interactions. In comparison with the full length LacZ, alpha-complement forms the correct conformation for beta-galactosidase activity in lower possibility. Therefore, mercury sensing device exploiting full length LacZ as reporter gene can not actually sense the mercury. However, it may act as the positive control in the traffic light assay, which exhibits beta-galactosidase activity whether mercury is in presence or not (Fig 3). <br><br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg"><img src="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg" width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"><img src="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"><img src="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"><img src="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg"><img src="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg" ></a></html><br />
<br />
'''Fig 3. Scheme of construction of 4 isogenic biosensor strains. It was a pyramiding process during which the phenotypes of bacterial reporter developed previously in our project were combined, in order to implement strains with different mercury sensitivity. (E) BBa_J23103, BBa_J23101 and BBa_J23117 belong to a constitutive promoter library from partsregistry, among which BBa_J23103 is a very weak one, BBa_J23117 is medium and BBa_J23101 is the second strongest in the library. (A)Expression of MerR driven by weak constitutive promoter BBa_J23103 on low copy number plasmid backbone pSB3K3 was pyramided with wild type PmerT which is the most mercury-sensitive promoter combined with LacZ alpha fragment as the reporter gene on plasmid backbone pSB1A3. It is an extreme to confer the bioreporter the most sensitivity, based on our previous results. (B) Strong promoter BBa_J23101 drive the high expression intensity of MerR on plasmid backbone pSB1A2, while PmerT 88 on pSB3K3 is the most insensitive mercury-response promoter developed before. Reporter gene is still lacZ alpha fragment. This is the other extreme of MerR expression intensity, aiming to endow the bacteria the most insensitivity. (C) Promoter BBa_J23117 is medium compared with other 2 constitutive promoters, and the same with PmerT 03 which was screened out previously. This mercury sensing device is expected to be more sensitive than (A) and less than (B). (D) This device is similar to (A), except the reporter gene was replaced by LacZ full length gene. As mentioned in the context, when acting as the reporter gene, full length LacZ represents a significantly leakage expression, giving output regardless of the input, of which we took the advantage to regard it as the positive control in traffic light bioassay. '''<br><br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg"><img src="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg" width=650 ></a></html><br><br />
'''Fig 4. The primary result of traffic light bioassay, which was performed in the 96-well plate. The response of whole-cell bioreporter incubated with simulated mercury containing polluted water was recorded by digital image at 10h, 15h, 20h and 30h. 3 replicates of 1 biosensor strain behaved very similarly with respect to indicating the mercury concentration range in a wide time window. Surprisingly, the biosensor strain we selected was able to response to 7*10^-9M mercury (II) with repeatability and the color contrast of mercury concentration near the threshold seemed to be good. '''<br />
<br />
<br />
Further work to obtain results demonstrating that the bioreporter system using combinations of these biosensor strains to define mercury concentration ranges is still under progressing. However, as data obtained in Fig 4, the strain exploited in the proof of concept has already been sufficient to discriminate mercury concentration range that fits very well with the current permissive (e.g. World Health Organization) levels of mercury in common aquatic environment, such as drinking water (10^-8M) . <br />
<br />
===Tri-Node Response System for Accurate Measurement===<br />
When heavy metal emerges, a tri-node response will be switched on in our biosensor (Fig 5). Different strains with parameter variations between the nodes will have different response threshold to heavy metal ions, such as mercury, according to the result of our modeling. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png" width=650 ></a></html><br><br />
'''Fig 5. Structure of Tri-node response system. According to the results of modeling, we designed the specific genetic circuit to realize the linear response function. Node A is a generator of MerR. For Node B, the gene is the activator which can activate the psid promoter. Node C is GFP whose expression was driven by Psid (activated by activator) and PmerT (activated by MerR). '''<br />
<br />
To get a linear response curve of bioreporter in a wide concentration range, we constructed parameter spectrums. The first one was X1, which represents the concentration of MerR. We constructed the spectrum by prefixing different constitutive promoter to MerR. The second was to change K13 which denotes the affinity between MerR and the PmerT promoter. We exploited random mutagenesis to construct a libarary of PmerT with different MerR binding sequences. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png"><img src="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png" width=650 ></a></html><br><br />
'''Fig 6. Spectrum construction of parameters which are critical to the robustness of our genetic circuit design predicted by our modeling.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png"><img src="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png" width=650 ></a></html><br><br />
'''Fig 7. Our bioreporter with tri-node response system will possess a linear transfer function (right) rather than the natural hill function (left). '''<br />
<br />
<br />
Before wiki freezing, data collecting of the final result (linear transfer function transformed from hill function) are still under progressing. Primary result demonstrated that it worked as expected, which will be shown at Jamboree. <br />
If the transfer function of bioreporter response represents linear, the working range of the bioreporter will be expanded, and the error rating will be reduced. This type of bioreporter will be excellent for in lab accurate measurement or heavy metal pollution assessment. <br />
<br />
<br />
<br />
<br />
==Reference==<br />
Anke Wackwitz, H.H., Antonis Chatzinotas, Uta Breuer, Christelle Vogne, Jan Roelof Van Der Meer (2008). Internal arsenite bioassay calibration using multiple bioreporter cell lines. Microbial Biotechnology 1, 149-157.<br>Chakraborty, T., Babu, P.G., Alam, A., and Chaudhari, A. (2008). GFP expressing bacterial biosensor to measure lead contamination in aquatic environment. Current Science 94, 800-805.<br>Hansen, L.H., and Sorensen, S.J. (2000). Versatile biosensor vectors for detection and quantification of mercury. FEMS Microbiol Lett 193, 123-127.<br>van der Meer, J.R., and Belkin, S. Where microbiology meets microengineering: design and applications of reporter bacteria. Nat Rev Microbiol 8, 511-522.<br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Biosensor/BioreporterTeam:Peking/Project/Biosensor/Bioreporter2010-10-27T23:44:11Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Bioreporter</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Biosensor|Biosensor]] > [[Team:Peking/Project/Biosensor/Bioreporter|Bioreporter]]<html><br />
</div><br />
<div id="middlewhite"><br />
</html><br />
=Traffic-Light Bioassay For Application Ease=<br />
&nbsp;&nbsp;&nbsp;&nbsp;Traditional bioassays with biosensor bacteria are usually calibrated with analyte solutions of known concentrations that are analyzed along with the samples of interest (Chakraborty et al., 2008; Hansen and Sorensen, 2000). This is done as bioreporter output (fluorescence or colour) does not only depend on the target concentration, but also on the incubation time and physiological activity of the cells in the assay. Comparing the biosensor output with standardized colour tables in the field application seems rather difficult and error-prone. <br>&nbsp;&nbsp;&nbsp;&nbsp;To solve this hard truth, a new approach called ‘traffic light’ heavy metal bioassay was then developed. Previous work has shown that the “traffic light” bioassay could work independently of external calibration of the bioreporter output, thus to control assay variations and to improve application ease(Anke Wackwitz, 2008). Actually, an internal calibration based on the use of multiple isogenic bioreporter cell lines with the same output but drastically different sensitivity at a given heavy metal concentration is proceeded during this bioassy.<br><br />
<html><a href="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg"><img src="https://static.igem.org/mediawiki/2010/6/61/Introfig7.jpg" width=650 ></a></html><br><br />
'''Fig 1. The traffic light bioassay uses, for example, four isogenic strains with the same reporter output but differing in the compound concentration threshold at which their reporter circuit is activated. The number of reporter strains reacting to a sample (rather than their reporter signal intensity per se) is then representative for the compound concentration range. Adapted from (van der Meer and Belkin)'''<br><br><br />
&nbsp;&nbsp;&nbsp;&nbsp;Specially speaking, we pyramided the information collected during the Promoter Characterization, Operation Characterization and Modeling. It has been shown that the expression level of MerR and the binding affinity of MerR to the cognate promoter dyad sequence both significantly determinate the bacterial sensitivity to mercury — higher MerR expression intensity and lower binding affinity of MerR to DNA target would result in a less sensitive bacterial mercury sensor and vice versa. In order to verify this, we constructed a reporter system similar to the ones we used before, as shown in Fig 2C.(<html><a href="https://2010.igem.org/Team:Peking/Project/Biosensor/PromoterCharacterization">to read more…</a></html>). <br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/aa/Reporter2a.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/1/19/Reporter2b.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/a/a2/Reporter2c.png" width=450></a></html><br><br />
<html><a href="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" target="blank"><img src="https://static.igem.org/mediawiki/2010/2/2a/Reporter2d.png" width=450></a></html><br><br />
'''Fig 2. Result of pyramiding. According to the information collected in promoter characterization and operation characterization, both the expression level of MerR and the semiconserved region of MerR binding site could determine the threshold of mercury sensitivity. (A) Each combination was carefully characterized. All of the dose response curves represented as a hill function. (B) When comparing these combinations, we can easily find that both of the factors worked as expected: for instance, BBa_J23101+Mutant 3 represents a higher threshold than that of BBa_J23101+Mutant 88 and BBa_J23103+Mutant 88 has a higher threshold than BBa_J23101+Mutant 88. (C) The genetic construction of the system used for characterization. '''<br />
<br><br><br />
'''Table 2 The parameters of Hill function fitting.'''<br />
<br />
[[Image:Pkutable2.png|center|650px]]<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Therefore, 4 isogenic biosensor strains with the same reporter output (beta-galactosidase) but differing in the mercury concentration threshold at which their reporter circuit is activated was constructed as is shown in Fig 3. <br><br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Interestingly, when we employed full length LacZ gene (BBa_I732017) as the reporter gene for design in Fig 3, a significant leakage expression emerged which was as high as we could not tell the difference in intensity of the beta-galactosidase activity between experimental group and the control. However, when using LacZ alpha fragment instead, we found that the leakage expression became negligible – Hg (II) induction would significantly activate the beta-galactosidase activity compared with the control and bacteria bearing the mercury sensing device behaved in a dose-response manner in response to mercury concentration gradient (Fig 4), which implied that when separated into 2 peptide fragments, the enzymatic activity of LacZ (beta-galactosidase) decreased remarkably and the decrement could be rescued by higher expression level of the alpha fragment. It was probably because the alpha-complementary process is mediated by intra-molecular non-covalent interactions. In comparison with the full length LacZ, alpha-complement forms the correct conformation for beta-galactosidase activity in lower possibility. Therefore, mercury sensing device exploiting full length LacZ as reporter gene can not actually sense the mercury. However, it may act as the positive control in the traffic light assay, which exhibits beta-galactosidase activity whether mercury is in presence or not (Fig 3). <br><br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg"><img src="https://static.igem.org/mediawiki/2010/c/c1/3-1.jpg" width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"><img src="https://static.igem.org/mediawiki/2010/a/a1/3-2.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"><img src="https://static.igem.org/mediawiki/2010/4/4d/3-3.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"><img src="https://static.igem.org/mediawiki/2010/3/3c/3-4.jpg"width=45%height="200" ></a></html><br />
<html><a href="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg"><img src="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg" ></a></html><br />
<br />
'''Fig 3. Scheme of construction of 4 isogenic biosensor strains. It was a pyramiding process during which the phenotypes of bacterial reporter developed previously in our project were combined, in order to implement strains with different mercury sensitivity. (E) BBa_J23103, BBa_J23101 and BBa_J23117 belong to a constitutive promoter library from partsregistry, among which BBa_J23103 is a very weak one, BBa_J23117 is medium and BBa_J23101 is the second strongest in the library. (A)Expression of MerR driven by weak constitutive promoter BBa_J23103 on low copy number plasmid backbone pSB3K3 was pyramided with wild type PmerT which is the most mercury-sensitive promoter combined with LacZ alpha fragment as the reporter gene on plasmid backbone pSB1A3. It is an extreme to confer the bioreporter the most sensitivity, based on our previous results. (B) Strong promoter BBa_J23101 drive the high expression intensity of MerR on plasmid backbone pSB1A2, while PmerT 88 on pSB3K3 is the most insensitive mercury-response promoter developed before. Reporter gene is still lacZ alpha fragment. This is the other extreme of MerR expression intensity, aiming to endow the bacteria the most insensitivity. (C) Promoter BBa_J23117 is medium compared with other 2 constitutive promoters, and the same with PmerT 03 which was screened out previously. This mercury sensing device is expected to be more sensitive than (A) and less than (B). (D) This device is similar to (A), except the reporter gene was replaced by LacZ full length gene. As mentioned in the context, when acting as the reporter gene, full length LacZ represents a significantly leakage expression, giving output regardless of the input, of which we took the advantage to regard it as the positive control in traffic light bioassay. '''<br><br><br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg"><img src="https://static.igem.org/mediawiki/2010/7/76/3-5.jpg" width=650 ></a></html><br><br />
'''Fig 4. The primary result of traffic light bioassay, which was performed in the 96-well plate. The response of whole-cell bioreporter incubated with simulated mercury containing polluted water was recorded by digital image at 10h, 15h, 20h and 30h. 3 replicates of 1 biosensor strain behaved very similarly with respect to indicating the mercury concentration range in a wide time window. Surprisingly, the biosensor strain we selected was able to response to 7*10^-9M mercury (II) with repeatability and the color contrast of mercury concentration near the threshold seemed to be good. '''<br />
<br />
<br />
Further work to obtain results demonstrating that the bioreporter system using combinations of these biosensor strains to define mercury concentration ranges is still under progressing. However, as data obtained in Fig 4, the strain exploited in the proof of concept has already been sufficient to discriminate mercury concentration range that fits very well with the current permissive (e.g. World Health Organization) levels of mercury in common aquatic environment, such as drinking water (10^-8M) . <br />
<br />
===Tri-Node Response System for Accurate Measurement===<br />
When heavy metal emerges, a tri-node response will be switched on in our biosensor (Fig 5). Different strains with parameter variations between the nodes will have different response threshold to heavy metal ions, such as mercury, according to the result of our modeling. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png"><img src="https://static.igem.org/mediawiki/2010/b/ba/Pkure2.png" width=650 ></a></html><br><br />
'''Fig 5. Structure of Tri-node response system. According to the results of modeling, we designed the specific genetic circuit to realize the linear response function. Node A is a generator of MerR. For Node B, the gene is the activator which can activate the psid promoter. Node C is GFP whose expression was driven by Psid (activated by activator) and PmerT (activated by MerR). '''<br />
<br />
To get a linear response curve of bioreporter in a wide concentration range, we constructed parameter spectrums. The first one was X1, which represents the concentration of MerR. We constructed the spectrum by prefixing different constitutive promoter to MerR. The second was to change K13 which denotes the affinity between MerR and the PmerT promoter. We exploited random mutagenesis to construct a libarary of PmerT with different MerR binding sequences. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png"><img src="https://static.igem.org/mediawiki/2010/0/03/Pkure3.png" width=650 ></a></html><br><br />
'''Fig 6. Spectrum construction of parameters which are critical to the robustness of our genetic circuit design predicted by our modeling.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png"><img src="https://static.igem.org/mediawiki/2010/8/8d/Pkure4.png" width=650 ></a></html><br><br />
'''Fig 7. Our bioreporter with tri-node response system will possess a linear transfer function (right) rather than the natural hill function (left). '''<br />
<br />
<br />
Before wiki freezing, data collecting of the final result (linear transfer function transformed from hill function) are still under progressing. Primary result demonstrated that it worked as expected, which will be shown at Jamboree. <br />
If the transfer function of bioreporter response represents linear, the working range of the bioreporter will be expanded, and the error rating will be reduced. This type of bioreporter will be excellent for in lab accurate measurement or heavy metal pollution assessment. <br />
<br />
<br />
<br />
<br />
==Reference==<br />
Anke Wackwitz, H.H., Antonis Chatzinotas, Uta Breuer, Christelle Vogne, Jan Roelof Van Der Meer (2008). Internal arsenite bioassay calibration using multiple bioreporter cell lines. Microbial Biotechnology 1, 149-157.<br>Chakraborty, T., Babu, P.G., Alam, A., and Chaudhari, A. (2008). GFP expressing bacterial biosensor to measure lead contamination in aquatic environment. Current Science 94, 800-805.<br>Hansen, L.H., and Sorensen, S.J. (2000). Versatile biosensor vectors for detection and quantification of mercury. FEMS Microbiol Lett 193, 123-127.<br>van der Meer, J.R., and Belkin, S. Where microbiology meets microengineering: design and applications of reporter bacteria. Nat Rev Microbiol 8, 511-522.<br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomtrans"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/File:Pkure4.pngFile:Pkure4.png2010-10-27T23:42:58Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Pkure3.pngFile:Pkure3.png2010-10-27T23:42:15Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Pkure2.pngFile:Pkure2.png2010-10-27T23:41:08Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Pkure1.pngFile:Pkure1.png2010-10-27T23:40:22Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/Team:Peking/TeamTeam:Peking/Team2010-10-27T23:35:55Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=10><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;TEAM-HOME</font></font></font><br />
<br><br><br />
</div><br />
<div id="middleblue"><br />
<img src="https://static.igem.org/mediawiki/2010/0/09/Wholeteam.jpg" width="640" id="imgblue"><br />
</div><br />
<br />
<div id="titleblue"><br />
<br><br><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<font size=5><b><font color=#8181F7>Students</font></font></b><br />
<br />
</p><br />
</div><br />
<br />
<div id="middleblue"><br />
<br />
<br />
<a href="https://2010.igem.org/Team:Peking/Team/HQZhang"><img src="https://static.igem.org/mediawiki/2010/c/cc/Zhq11.jpg" width="82px" alt="Haoqian Zhang" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/XTeng"><img src="https://static.igem.org/mediawiki/2010/9/9c/TX11.jpg" width="82px" alt="Xin Teng" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/ALiu"><img src="https://static.igem.org/mediawiki/2010/7/70/La.jpg" width="82px" alt="Ao Liu" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/YHu"><img src="https://static.igem.org/mediawiki/2010/5/5c/Yjy.jpg" width="82px" alt="Yang Hu" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/YSheng"><img src="https://static.igem.org/mediawiki/2010/a/ad/SY.jpg" width="82px" alt="Ying Sheng"id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/MChen"><img src="https://static.igem.org/mediawiki/2010/d/de/Cm.jpg" width="82px" alt="Mei Chen" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/HPan"><img src="https://static.igem.org/mediawiki/2010/b/b5/PH.jpg" width="80px" alt="Heng Pan" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/MJing"><img src="https://static.igem.org/mediawiki/2010/a/af/JM.jpg" width="82px" alt="Miao Jing" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/QZWu"><img src="https://static.igem.org/mediawiki/2010/6/69/Wqz.jpg" width="82px" alt="Qianzhu Wu" id="imgblue"></a><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/e/e2/Blockblue.jpg" width="260px" height="100px" ><br />
<br />
<br />
<br />
<a href="https://2010.igem.org/Team:Peking/Team/DHLiang"><img src="https://static.igem.org/mediawiki/2010/4/4a/Ldh-1.jpg" width="82px" alt="Donghai Liang" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/JYJiao"><img src="https://static.igem.org/mediawiki/2010/1/1e/Jz.jpg" width="82px" alt="Junyi Jiao" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/TZZhu"><img src="https://static.igem.org/mediawiki/2010/7/76/Ztz.jpg" width="82px" alt="Tianze Zhu" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/BXZhao"><img src="https://static.igem.org/mediawiki/2010/5/58/ZBX.jpg" width="82px" alt="Boxuan Zhao" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/YWChen"><img src="https://static.igem.org/mediawiki/2010/a/a1/MM.jpg" width="82px" alt="Yiwei Chen" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/ZRLiu"><img src="https://static.igem.org/mediawiki/2010/a/af/Rr.jpg" width="82px" alt="Zairan Liu" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/WYWang"><img src="https://static.igem.org/mediawiki/2010/a/a9/Wwy.jpg" width="85px" alt="Weiye Wang" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/YHLu"><img src="https://static.igem.org/mediawiki/2010/2/2a/Lyh11.jpg" width="88px" alt="Yuheng Lu" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/ZZYin"><img src="https://static.igem.org/mediawiki/2010/a/ad/Yzz-1.jpg" width="88px" alt="Zhenzhen Yin" id="imgblue"></a><br />
</div><br />
<br />
<br />
<div id="titleblue"><br />
<br><br><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<font size=5><b><font color=#8181F7>Instructors</font></font></b><br />
<br />
</p><br />
</div><br />
<br />
<br />
<div id="middleblue"><br />
<br />
<a href="http://ctb.pku.edu.cn/main/en/people/people-faculty-ouyangqi.htm"><img src="https://static.igem.org/mediawiki/2010/5/5f/PKU_Ouyangqi.jpg" width="80px" alt="Qi Ouyang" id="imgblue"></a><br />
<a href="http://chemistry.uchicago.edu/faculty/faculty/person/member/chuan-he.html"target="_blank"><img src="https://static.igem.org/mediawiki/2010/9/90/Hechuan.jpg" width="80px" alt="Chuan He" id="imgblue"></a><br />
<a href="http://mdl.ipc.pku.edu.cn/"><img src="https://static.igem.org/mediawiki/2010/1/17/PKU_Luhua_Lai.jpg" width="80px" alt="Luhua Lai" id="imgblue"></a><br />
<a href="http://www.bio.pku.edu.cn/teachinfo/Biographical/wangyp.htm"><img src="https://static.igem.org/mediawiki/2010/6/64/PKU_Wang.jpg" width="80px" alt="Yiping Wang" id="imgblue"></a><br />
<br />
</div><br />
<br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Expansion/LeadBioabsorbentTeam:Peking/Project/Expansion/LeadBioabsorbent2010-10-27T23:31:48Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
{{:Team:Peking/boxesII}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;PbrR-based lead bioabsorbent</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Expansion|Expansion]] > [[Team:Peking/Project/Expansion/LeadBioabsorbent|LeadBioabsorbent]]<html><br />
</div><br />
<br />
<br />
<div id="middlewhite"><br />
</html><br />
&nbsp;&nbsp;&nbsp;&nbsp;After the completion of MerR-based mercury decontamination kit, we decided to take another example to verify the validness of our design for metal binding peptide. Based on the previous homology study of MerR family proteins, we took a lead-sensing protein, PbrR, as the second research target.<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Lead contamination is a serious threat to human health and the environment. Lead poisoning is still one of the most common environmentally caused diseases in the world today.[1] As the concentration of such toxic ions is generally low, which present a huge challenge for environmental engineers to both detect and to absorb the pollutant with traditional chemical methods. A revolutionary strategy was taken into consideration, which took the advantage of metalloregulatory proteins with capability of sensing and absorbing the Pb(II) ions.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg"target="_blank" ><img src="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg" alt="Sequence alignment of MerR and PbrR<br />
"></a></html><br />
<br>'''Figure 1 Sequence alignment of MerR and PbrR. MerR family TFs share a highly conserved homology at their metal binding domains (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioabsorbent engineering might be applicable to other cases of heavy metals.'''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Nature has evolved numerous such regulating proteins to control the concentrations of beneficial or toxic metal ions with extraordinary sensitivity and selectivity.[1] As is known, the MerR family is a group of transcriptional activators with similar N-terminal helix-turn-helix DNA binding regions and C-terminal effector binding regions that are specific to the effector recognized.[2] The majority of regulators in the family respond to environmental stimuli, such as oxidative stress, heavy metals or antibiotics. A subgroup of the family activates transcription in response to metal ions. This subgroup shows sequence similarity in the C-terminal effector binding region as well as in the N-terminal region. PbrR is a MerR family protein found in ''Ralstonia metallidurans CH34'', a bacterium specifically adapted to survive under toxic heavy metal environment. The PbrR protein is responsible for regulation of lead(II) efflux pumps involved in lead detoxification inside ''R. Metallidurans''. <br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Due to the highly conserved homology of protein MerR and PbrR (Fig.1), we were able to apply the strategy used for MerR engineering to the development of lead bioabsorbent. Based on the crystal structure study of MerR, the metal binding domain of PbrR was recognized by sequence alignment with MerR.(Fig 2) [3] Further, 3D structure was also conducted.(Fig3)<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg" alt="Pb binding domain predicted by sequence alignment."></a></html><br />
<br>'''Figure 2 Pb binding domain predicted by sequence alignment. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming a metal binding pocket.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"target="_blank"><embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"id="imggrey"></a></html><br />
<br>'''Figure 3 3D structure modeling of PbrR. Note that PbrR comprises 2 domains, a metal binding domain at the C terminal and a DNA binding domain at the N-terminal, joined together by a interface domain. '''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Then we designed PbrR metal binding peptide, with consisted of two tandem duplications of α-helix 5 linked by a flexible linker, SSG, and followed by a short peptide sequence.(Fig 4) These direct tandem α-helices fold back on each other into an antiparallel, coiled-coil hairpin. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming disulfide bonds within the engineered dimer.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"></a></html><br />
<br>'''Figure 4 Design of PbrR metal binding peptide and structure prediction. Within the engineered dimer, six Cys-residues centralize 2 metal binding pocket, each of which specifically binds Pb(II) ions by forming disulfide bonds . '''<br><br />
<br />
The principles were same when we considered the construction of PbrR metal binding peptide (MBP). It was accomplished by fusing two copies of alpha-helices 5 of PbrR in tandem with three nonnative amino acids, SSG, as a bridge. PbrR MBP was then constructed and cloned into pSB1C3 backbone as a standard part for function test and the pET21a backbone as the commercial plasmid for the western blotting, as is shown in Fig 5. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png" width=500></a></html><br />
<br />
'''Fig 5. Construction procedure of PbrR (lead) MBP. Top: Standard part; Bottom: Expression detection part.'''<br />
<br />
As proved previously, when the mercury MBP was fused to DsbA, it would be efficiently translocated to the periplasm and works comparable to those targeting to the cytosol. Therefore, we fused lead MBP using the same method as it was in mercury MBP construction (Fig 6). Particularly, the PstI restriction site inside DsbA was mutated synonymously. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png" width=500></a></html><br />
<br />
'''Fig 6. Procedure of DsbA-MBP construction. '''<br />
<br />
<br />
In order to standardize the module, with Nest PCR, RBS (BBa_B0034) and T7 promoter are prefixed with the DsbA-MBP fusion, as is shown in Fig 5. A His-tag was fused at the C-terminal for further western blotting. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png" width=500></a></html><br />
<br />
'''Fig 7. Standardization procedure of DsbA-MBP.'''<br />
DsbA and MBD gene was amplified by PCR from pET-39b (+)-DsbA-MBP, with the primer containing T7 promoter, RBS and SD restriction sites, as shown in Fig 6. The PCR product was digested with EcoR I / Pst I and then cloned into EcoR I / Pst I double digested pSB1K3, to achieve the goal of standardization of the fusion protein (Fig. 7). <br />
<br />
Like surface display of MerR MBP, Lpp-OmpA-MBP was designed as a fusion protein consisting of the signal sequence and first 9 amino acid of Lpp, residue 46~159 of OmpA and the PbrR metal binding peptide (MBP). The signal peptide of the N-termini of this fusion protein targets the protein to the membrane while the transmembrane domain of OmpA serves as an anchor. MBP is on the externally exposed loops of OmpA, which can be anchored to the outer membrane. As the method shown in mercury bioabsorbent construction, we directly fused the PbrR-MBP at the C-terminal of Lpp-OmpA protein through a flexible SG rich linker (Fig 8). <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/88/Ldpku11.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/Ldpku11.png" width=380></a></html><br />
<br />
'''Fig 8. Result of 3D modeling for our fusion protein construction. The transmembrane domain of OmpA serves as an anchor and MBP is on the externally exposed loops of OmpA.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png" width=500></a></html><br />
<br />
'''Fig 9. Procedures of the construction of standard plasmid with Lpp-OmpA-MBP as the insert. '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png" width=500></a></html><br />
<br />
'''Fig 10 Procedures of Construction of Commercial Plasmid. '''<br />
<br />
After the construction of the plasmid with the fusion protein gene Lpp-OmpA-MBP, We prefixed T7 promoter and BBa_B0030 upstream of Lpp-OmpA-MBP. Additionally, a strong terminator BBa_B0015 was suffixed. <br />
When the construction of three proteins was completed, T7 promoter+RBS and terminator were prefixed or suffixed to each protein coding sequence, respectively. T7 polymerase from T7 phage was designed to be constitutively expressed, thus to constitutively activate transcription at T7 promoter, in order to guarantee the expression of MBP regardless of the genetic background of bacteria strain. <br />
<br />
For the same reason as in Hg (II) MBP construction, we assembled the three modules [Fig. 11]: MBP, DsbA-MBP and Lpp-OmpA-MBP, which would translocate MBP to the cytoplasm, periplasmic space and on the outer membrane in pSB1C3 for further function test. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png" width=500></a></html><br />
<br />
<br />
Fig 11. The lead absorption device we designed to guarantee the maximum of Pb absorption. Top: The final overall structure of lead absorption device as an insert in pSB1C3. Middle and Bottom: The production of T7 RNA polymerase is constitutive. T7 polymerases will active high rating transcription at T7 promoters. Thus Hg (II) will be highly effectively accumulated by substantial amount of MBPs which are translocated to cytosol, periplasm and cell surface of the bacteria. All the components were assembled together and cloned into pSB3K3.<br />
<br />
<br />
==Protein Expression and Function Test==<br />
<br />
The cytoplasmic expression, periplasmic translocation and surface display of PbrR-MBP were verified by SDS-PAGE and Western Blotting. The specific band in western blotting for his-tag fused MBP of about 12 kD confirmed that the MBP was expressed as expected (Fig 12). Considerable amount of MBP expressed in cytosol can also be indicated from the result of SDS-PAGE. Overexpression band in SDS-PAGE result and specific band in the western blotting in size of expected molecular weight also indicated that the fusion proteins were translocated into periplasm and displayed on the surface as expected (Fig 13). Therefore, the bioabsorbent of lead employs same pathways to serve the decontamination goal as mecury bioabsorbent: to express MBP in the cytosol, in the periplasm and on the surface. Their expression was under the regulation of T7 promoter, driven by constitutively expressed T7 polymerase.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png" width=500></a></html><br />
<br />
<br />
'''Fig 12. The specific band in western blot for his-tag fused MBP of about 12 kD confirmed that the MBP is expressed as expected. Considerable amount of MBP expressed in cytosol can be indicated from the result of SDS-PAGE. '''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png" width=500></a></html><br />
<br />
<br />
'''Fig 13. There are overexpression band in SDS-PAGE result and specific band in the western result at the expected molecular weight, which indicate that the fusion proteins are translocated into periplasm as expected. <br />
Besides, we conducted 3D structure modeling to overview them and their localization (Fig 14). '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png" width=500></a></html><br />
<br />
'''Fig 14. Overview of various localization of MBP engineered from PbrR. '''<br />
<br />
After verifying that the PbrR-MBP could be expressed and translocated as expected, the function test was carried out with ICP-AES, using the method described at MBP Expression Page. The result was similar to that of mercury MBP. The lead binding capacity of MBP with different localization was indicated in Fig 15. The surface displayed MBP appeared to have highest binding capacity while the pyramiding of MBP expression did not function as expected. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png" width=500></a></html><br />
<br />
'''Fig 15 Different amount of lead absorbed by bacteria with MBP expressed in different subcellular compartments cultured for ~40h in 10-5 mol/L Pb (II) medium.'''<br />
<br />
<br />
<br />
==reference==<br />
[1] Peng Chen, Bill Greenberg, Safiyh Taghavi, Christine Romano, Daniel van der Lelie, and Chuan He, An exceptionally selective lead (II)-regulatory protein from Ralstonia metallidurans: development of a fluorescent lead (II) probe, Angew. Chem. 117, 2005, 2775 –2779.<br>[2] Nigel L. Brown, Jivko V. Stoyanov, Stephen P. Kidd, Jon L. Hobman, The MerR family of transcriptional regulators, FEMS Microbiology Reviews, 27, 2003, 145-163.<br>[3] Lingyun Song, Jonathan Caguiat, Zhongrui Li, Jacob Shokes, Robert A. Scott, Lynda Olliff, and Anne O. Summers, Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site, Journal of Bacteriology, 186(6), 2004, 1861–1868.<br>[4] Song, L., Caguiat, J., Li, Z., Shokes, J., Scott, R. A., Olliff, L. &Summers, A. O. (2004). Engineered single-chain, antiparallel,coiled coil mimics the MerR metal binding site. J Bacteriol 186,1861–1868.<br><br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Expansion/LeadBioabsorbentTeam:Peking/Project/Expansion/LeadBioabsorbent2010-10-27T23:26:53Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
{{:Team:Peking/boxesII}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;PbrR-based lead bioabsorbent</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Expansion|Expansion]] > [[Team:Peking/Project/Expansion/LeadBioabsorbent|LeadBioabsorbent]]<html><br />
</div><br />
<br />
<br />
<div id="middlewhite"><br />
</html><br />
&nbsp;&nbsp;&nbsp;&nbsp;After the completion of MerR-based mercury decontamination kit, we decided to take another example to verify the validness of our design for metal binding peptide. Based on the previous homology study of MerR family proteins, we took a lead-sensing protein, PbrR, as the second research target.<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Lead contamination is a serious threat to human health and the environment. Lead poisoning is still one of the most common environmentally caused diseases in the world today.[1] As the concentration of such toxic ions is generally low, which present a huge challenge for environmental engineers to both detect and to absorb the pollutant with traditional chemical methods. A revolutionary strategy was taken into consideration, which took the advantage of metalloregulatory proteins with capability of sensing and absorbing the Pb(II) ions.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg"target="_blank" ><img src="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg" alt="Sequence alignment of MerR and PbrR<br />
"></a></html><br />
<br>'''Figure 1 Sequence alignment of MerR and PbrR. MerR family TFs share a highly conserved homology at their metal binding domains (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioabsorbent engineering might be applicable to other cases of heavy metals.'''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Nature has evolved numerous such regulating proteins to control the concentrations of beneficial or toxic metal ions with extraordinary sensitivity and selectivity.[1] As is known, the MerR family is a group of transcriptional activators with similar N-terminal helix-turn-helix DNA binding regions and C-terminal effector binding regions that are specific to the effector recognized.[2] The majority of regulators in the family respond to environmental stimuli, such as oxidative stress, heavy metals or antibiotics. A subgroup of the family activates transcription in response to metal ions. This subgroup shows sequence similarity in the C-terminal effector binding region as well as in the N-terminal region. PbrR is a MerR family protein found in ''Ralstonia metallidurans CH34'', a bacterium specifically adapted to survive under toxic heavy metal environment. The PbrR protein is responsible for regulation of lead(II) efflux pumps involved in lead detoxification inside ''R. Metallidurans''. <br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Due to the highly conserved homology of protein MerR and PbrR (Fig.1), we were able to apply the strategy used for MerR engineering to the development of lead bioabsorbent. Based on the crystal structure study of MerR, the metal binding domain of PbrR was recognized by sequence alignment with MerR.(Fig 2) [3] Further, 3D structure was also conducted.(Fig3)<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg" alt="Pb binding domain predicted by sequence alignment."></a></html><br />
<br>'''Figure 2 Pb binding domain predicted by sequence alignment. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming a metal binding pocket.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"target="_blank"><embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"id="imggrey"></a></html><br />
<br>'''Figure 3 3D structure modeling of PbrR. Note that PbrR comprises 2 domains, a metal binding domain at the C terminal and a DNA binding domain at the N-terminal, joined together by a interface domain. '''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Then we designed PbrR metal binding peptide, with consisted of two tandem duplications of α-helix 5 linked by a flexible linker, SSG, and followed by a short peptide sequence.(Fig 4) These direct tandem α-helices fold back on each other into an antiparallel, coiled-coil hairpin. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming disulfide bonds within the engineered dimer.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"></a></html><br />
<br>'''Figure 4 Design of PbrR metal binding peptide and structure prediction. Within the engineered dimer, six Cys-residues centralize 2 metal binding pocket, each of which specifically binds Pb(II) ions by forming disulfide bonds . '''<br><br />
<br />
The principles were same when we considered the construction of PbrR metal binding peptide (MBP). It was accomplished by fusing two copies of alpha-helices 5 of PbrR in tandem with three nonnative amino acids, SSG, as a bridge. PbrR MBP was then constructed and cloned into pSB1C3 backbone as a standard part for function test and the pET21a backbone as the commercial plasmid for the western blotting, as is shown in Fig 5. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png" width=500></a></html><br />
<br />
'''Fig 5. Construction procedure of PbrR (lead) MBP. Top: Standard part; Bottom: Expression detection part.'''<br />
<br />
As proved previously, when the mercury MBP was fused to DsbA, it would be efficiently translocated to the periplasm and works comparable to those targeting to the cytosol. Therefore, we fused lead MBP using the same method as it was in mercury MBP construction (Fig 6). Particularly, the PstI restriction site inside DsbA was mutated synonymously. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png" width=500></a></html><br />
<br />
'''Fig 6. Procedure of DsbA-MBP construction. '''<br />
<br />
<br />
In order to standardize the module, with Nest PCR, RBS (BBa_B0034) and T7 promoter are prefixed with the DsbA-MBP fusion, as is shown in Fig 5. A His-tag was fused at the C-terminal for further western blotting. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png" width=500></a></html><br />
<br />
'''Fig 7. Standardization procedure of DsbA-MBP.'''<br />
DsbA and MBD gene was amplified by PCR from pET-39b (+)-DsbA-MBP, with the primer containing T7 promoter, RBS and SD restriction sites, as shown in Fig 6. The PCR product was digested with EcoR I / Pst I and then cloned into EcoR I / Pst I double digested pSB1K3, to achieve the goal of standardization of the fusion protein (Fig. 7). <br />
<br />
Like surface display of MerR MBP, Lpp-OmpA-MBP was designed as a fusion protein consisting of the signal sequence and first 9 amino acid of Lpp, residue 46~159 of OmpA and the PbrR metal binding peptide (MBP). The signal peptide of the N-termini of this fusion protein targets the protein to the membrane while the transmembrane domain of OmpA serves as an anchor. MBP is on the externally exposed loops of OmpA, which can be anchored to the outer membrane. As the method shown in mercury bioabsorbent construction, we directly fused the PbrR-MBP at the C-terminal of Lpp-OmpA protein through a flexible SG rich linker (Fig 8). <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/88/Ldpku11.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/Ldpku11.png" width=500></a></html><br />
<br />
'''Fig 8. Result of 3D modeling for our fusion protein construction. The transmembrane domain of OmpA serves as an anchor and MBP is on the externally exposed loops of OmpA.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png" width=500></a></html><br />
<br />
'''Fig 9. Procedures of the construction of standard plasmid with Lpp-OmpA-MBP as the insert. '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png" width=500></a></html><br />
<br />
'''Fig 10 Procedures of Construction of Commercial Plasmid. '''<br />
<br />
After the construction of the plasmid with the fusion protein gene Lpp-OmpA-MBP, We prefixed T7 promoter and BBa_B0030 upstream of Lpp-OmpA-MBP. Additionally, a strong terminator BBa_B0015 was suffixed. <br />
When the construction of three proteins was completed, T7 promoter+RBS and terminator were prefixed or suffixed to each protein coding sequence, respectively. T7 polymerase from T7 phage was designed to be constitutively expressed, thus to constitutively activate transcription at T7 promoter, in order to guarantee the expression of MBP regardless of the genetic background of bacteria strain. <br />
<br />
For the same reason as in Hg (II) MBP construction, we assembled the three modules [Fig. 11]: MBP, DsbA-MBP and Lpp-OmpA-MBP, which would translocate MBP to the cytoplasm, periplasmic space and on the outer membrane in pSB1C3 for further function test. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png" width=500></a></html><br />
<br />
<br />
Fig 11. The lead absorption device we designed to guarantee the maximum of Pb absorption. Top: The final overall structure of lead absorption device as an insert in pSB1C3. Middle and Bottom: The production of T7 RNA polymerase is constitutive. T7 polymerases will active high rating transcription at T7 promoters. Thus Hg (II) will be highly effectively accumulated by substantial amount of MBPs which are translocated to cytosol, periplasm and cell surface of the bacteria. All the components were assembled together and cloned into pSB3K3.<br />
<br />
<br />
==Protein Expression and Function Test==<br />
<br />
The cytoplasmic expression, periplasmic translocation and surface display of PbrR-MBP were verified by SDS-PAGE and Western Blotting. The specific band in western blotting for his-tag fused MBP of about 12 kD confirmed that the MBP was expressed as expected (Fig 12). Considerable amount of MBP expressed in cytosol can also be indicated from the result of SDS-PAGE. Overexpression band in SDS-PAGE result and specific band in the western blotting in size of expected molecular weight also indicated that the fusion proteins were translocated into periplasm and displayed on the surface as expected (Fig 13). Therefore, the bioabsorbent of lead employs same pathways to serve the decontamination goal as mecury bioabsorbent: to express MBP in the cytosol, in the periplasm and on the surface. Their expression was under the regulation of T7 promoter, driven by constitutively expressed T7 polymerase.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png" width=500></a></html><br />
<br />
<br />
'''Fig 12. The specific band in western blot for his-tag fused MBP of about 12 kD confirmed that the MBP is expressed as expected. Considerable amount of MBP expressed in cytosol can be indicated from the result of SDS-PAGE. '''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png" width=500></a></html><br />
<br />
<br />
'''Fig 13. There are overexpression band in SDS-PAGE result and specific band in the western result at the expected molecular weight, which indicate that the fusion proteins are translocated into periplasm as expected. <br />
Besides, we conducted 3D structure modeling to overview them and their localization (Fig 14). '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png" width=500></a></html><br />
<br />
'''Fig 14. Overview of various localization of MBP engineered from PbrR. '''<br />
<br />
After verifying that the PbrR-MBP could be expressed and translocated as expected, the function test was carried out with ICP-AES, using the method described at MBP Expression Page. The result was similar to that of mercury MBP. The lead binding capacity of MBP with different localization was indicated in Fig 15. The surface displayed MBP appeared to have highest binding capacity while the pyramiding of MBP expression did not function as expected. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png" width=500></a></html><br />
<br />
'''Fig 15 Different amount of lead absorbed by bacteria with MBP expressed in different subcellular compartments cultured for ~40h in 10-5 mol/L Pb (II) medium.'''<br />
<br />
<br />
<br />
==reference==<br />
[1] Peng Chen, Bill Greenberg, Safiyh Taghavi, Christine Romano, Daniel van der Lelie, and Chuan He, An exceptionally selective lead (II)-regulatory protein from Ralstonia metallidurans: development of a fluorescent lead (II) probe, Angew. Chem. 117, 2005, 2775 –2779.<br>[2] Nigel L. Brown, Jivko V. Stoyanov, Stephen P. Kidd, Jon L. Hobman, The MerR family of transcriptional regulators, FEMS Microbiology Reviews, 27, 2003, 145-163.<br>[3] Lingyun Song, Jonathan Caguiat, Zhongrui Li, Jacob Shokes, Robert A. Scott, Lynda Olliff, and Anne O. Summers, Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site, Journal of Bacteriology, 186(6), 2004, 1861–1868.<br><br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Expansion/LeadBioabsorbentTeam:Peking/Project/Expansion/LeadBioabsorbent2010-10-27T23:25:46Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
{{:Team:Peking/boxesII}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;PbrR-based lead bioabsorbent</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Expansion|Expansion]] > [[Team:Peking/Project/Expansion/LeadBioabsorbent|LeadBioabsorbent]]<html><br />
</div><br />
<br />
<br />
<div id="middlewhite"><br />
</html><br />
After the completion of MerR-based mercury decontamination kit, we decided to take another example to verify the validness of our design for metal binding peptide. Based on the previous homology study of MerR family proteins, we took a lead-sensing protein, PbrR, as the second research target.<br />
<br />
<br />
Lead contamination is a serious threat to human health and the environment. Lead poisoning is still one of the most common environmentally caused diseases in the world today.[1] As the concentration of such toxic ions is generally low, which present a huge challenge for environmental engineers to both detect and to absorb the pollutant with traditional chemical methods. A revolutionary strategy was taken into consideration, which took the advantage of metalloregulatory proteins with capability of sensing and absorbing the Pb(II) ions.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg"target="_blank" ><img src="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg" alt="Sequence alignment of MerR and PbrR<br />
"></a></html><br />
<br>'''Figure 1 Sequence alignment of MerR and PbrR. MerR family TFs share a highly conserved homology at their metal binding domains (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioabsorbent engineering might be applicable to other cases of heavy metals.'''<br />
<br />
<br />
Nature has evolved numerous such regulating proteins to control the concentrations of beneficial or toxic metal ions with extraordinary sensitivity and selectivity.[1] As is known, the MerR family is a group of transcriptional activators with similar N-terminal helix-turn-helix DNA binding regions and C-terminal effector binding regions that are specific to the effector recognized.[2] The majority of regulators in the family respond to environmental stimuli, such as oxidative stress, heavy metals or antibiotics. A subgroup of the family activates transcription in response to metal ions. This subgroup shows sequence similarity in the C-terminal effector binding region as well as in the N-terminal region. PbrR is a MerR family protein found in ''Ralstonia metallidurans CH34'', a bacterium specifically adapted to survive under toxic heavy metal environment. The PbrR protein is responsible for regulation of lead(II) efflux pumps involved in lead detoxification inside ''R. Metallidurans''. <br />
<br />
<br />
Due to the highly conserved homology of protein MerR and PbrR (Fig.1), we were able to apply the strategy used for MerR engineering to the development of lead bioabsorbent. Based on the crystal structure study of MerR, the metal binding domain of PbrR was recognized by sequence alignment with MerR.(Fig 2) [3] Further, 3D structure was also conducted.(Fig3)<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg" alt="Pb binding domain predicted by sequence alignment."></a></html><br />
<br>'''Figure 2 Pb binding domain predicted by sequence alignment. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming a metal binding pocket.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"target="_blank"><embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"id="imggrey"></a></html><br />
<br>'''Figure 3 3D structure modeling of PbrR. Note that PbrR comprises 2 domains, a metal binding domain at the C terminal and a DNA binding domain at the N-terminal, joined together by a interface domain. '''<br />
<br />
<br />
Then we designed PbrR metal binding peptide, with consisted of two tandem duplications of α-helix 5 linked by a flexible linker, SSG, and followed by a short peptide sequence.(Fig 4) These direct tandem α-helices fold back on each other into an antiparallel, coiled-coil hairpin. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming disulfide bonds within the engineered dimer.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"></a></html><br />
<br>'''Figure 4 Design of PbrR metal binding peptide and structure prediction. Within the engineered dimer, six Cys-residues centralize 2 metal binding pocket, each of which specifically binds Pb(II) ions by forming disulfide bonds . '''<br><br />
<br />
The principles were same when we considered the construction of PbrR metal binding peptide (MBP). It was accomplished by fusing two copies of alpha-helices 5 of PbrR in tandem with three nonnative amino acids, SSG, as a bridge. PbrR MBP was then constructed and cloned into pSB1C3 backbone as a standard part for function test and the pET21a backbone as the commercial plasmid for the western blotting, as is shown in Fig 5. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png" width=500></a></html><br />
<br />
'''Fig 5. Construction procedure of PbrR (lead) MBP. Top: Standard part; Bottom: Expression detection part.'''<br />
<br />
As proved previously, when the mercury MBP was fused to DsbA, it would be efficiently translocated to the periplasm and works comparable to those targeting to the cytosol. Therefore, we fused lead MBP using the same method as it was in mercury MBP construction (Fig 6). Particularly, the PstI restriction site inside DsbA was mutated synonymously. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png" width=500></a></html><br />
<br />
'''Fig 6. Procedure of DsbA-MBP construction. '''<br />
<br />
<br />
In order to standardize the module, with Nest PCR, RBS (BBa_B0034) and T7 promoter are prefixed with the DsbA-MBP fusion, as is shown in Fig 5. A His-tag was fused at the C-terminal for further western blotting. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png" width=500></a></html><br />
<br />
'''Fig 7. Standardization procedure of DsbA-MBP.'''<br />
<br />
DsbA and MBD gene was amplified by PCR from pET-39b (+)-DsbA-MBP, with the primer containing T7 promoter, RBS and SD restriction sites, as shown in Fig 6. The PCR product was digested with EcoR I / Pst I and then cloned into EcoR I / Pst I double digested pSB1K3, to achieve the goal of standardization of the fusion protein (Fig. 7). <br />
<br />
Like surface display of MerR MBP, Lpp-OmpA-MBP was designed as a fusion protein consisting of the signal sequence and first 9 amino acid of Lpp, residue 46~159 of OmpA and the PbrR metal binding peptide (MBP). The signal peptide of the N-termini of this fusion protein targets the protein to the membrane while the transmembrane domain of OmpA serves as an anchor. MBP is on the externally exposed loops of OmpA, which can be anchored to the outer membrane. As the method shown in mercury bioabsorbent construction, we directly fused the PbrR-MBP at the C-terminal of Lpp-OmpA protein through a flexible SG rich linker (Fig 8). <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/8/88/Ldpku11.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/Ldpku11.png" width=500></a></html><br />
<br />
'''Fig 8. Result of 3D modeling for our fusion protein construction. The transmembrane domain of OmpA serves as an anchor and MBP is on the externally exposed loops of OmpA.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png" width=500></a></html><br />
<br />
'''Fig 9. Procedures of the construction of standard plasmid with Lpp-OmpA-MBP as the insert. '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png" width=500></a></html><br />
<br />
'''Fig 10 Procedures of Construction of Commercial Plasmid. '''<br />
<br />
After the construction of the plasmid with the fusion protein gene Lpp-OmpA-MBP, We prefixed T7 promoter and BBa_B0030 upstream of Lpp-OmpA-MBP. Additionally, a strong terminator BBa_B0015 was suffixed. <br />
When the construction of three proteins was completed, T7 promoter+RBS and terminator were prefixed or suffixed to each protein coding sequence, respectively. T7 polymerase from T7 phage was designed to be constitutively expressed, thus to constitutively activate transcription at T7 promoter, in order to guarantee the expression of MBP regardless of the genetic background of bacteria strain. <br />
<br />
For the same reason as in Hg (II) MBP construction, we assembled the three modules [Fig. 11]: MBP, DsbA-MBP and Lpp-OmpA-MBP, which would translocate MBP to the cytoplasm, periplasmic space and on the outer membrane in pSB1C3 for further function test. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png" width=500></a></html><br />
<br />
<br />
'''Fig 11. The lead absorption device we designed to guarantee the maximum of Pb absorption. Top: The final overall structure of lead absorption device as an insert in pSB1C3. Middle and Bottom: The production of T7 RNA polymerase is constitutive. T7 polymerases will active high rating transcription at T7 promoters. Thus Hg (II) will be highly effectively accumulated by substantial amount of MBPs which are translocated to cytosol, periplasm and cell surface of the bacteria. All the components were assembled together and cloned into pSB3K3.'''<br />
<br />
<br />
==Protein Expression and Function Test==<br />
<br />
The cytoplasmic expression, periplasmic translocation and surface display of PbrR-MBP were verified by SDS-PAGE and Western Blotting. The specific band in western blotting for his-tag fused MBP of about 12 kD confirmed that the MBP was expressed as expected (Fig 12). Considerable amount of MBP expressed in cytosol can also be indicated from the result of SDS-PAGE. Overexpression band in SDS-PAGE result and specific band in the western blotting in size of expected molecular weight also indicated that the fusion proteins were translocated into periplasm and displayed on the surface as expected (Fig 13). Therefore, the bioabsorbent of lead employs same pathways to serve the decontamination goal as mecury bioabsorbent: to express MBP in the cytosol, in the periplasm and on the surface. Their expression was under the regulation of T7 promoter, driven by constitutively expressed T7 polymerase.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png" width=500></a></html><br />
<br />
<br />
'''Fig 12. The specific band in western blot for his-tag fused MBP of about 12 kD confirmed that the MBP is expressed as expected. Considerable amount of MBP expressed in cytosol can be indicated from the result of SDS-PAGE. '''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png" width=500></a></html><br />
<br />
<br />
'''Fig 13. There are overexpression band in SDS-PAGE result and specific band in the western result at the expected molecular weight, which indicate that the fusion proteins are translocated into periplasm as expected. <br />
<br />
Besides, we conducted 3D structure modeling to overview them and their localization (Fig 14). '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png" width=500></a></html><br />
<br />
'''Fig 14. Overview of various localization of MBP engineered from PbrR. '''<br />
<br />
After verifying that the PbrR-MBP could be expressed and translocated as expected, the function test was carried out with ICP-AES, using the method described at MBP Expression Page. The result was similar to that of mercury MBP. The lead binding capacity of MBP with different localization was indicated in Fig 15. The surface displayed MBP appeared to have highest binding capacity while the pyramiding of MBP expression did not function as expected. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png" width=500></a></html><br />
<br />
'''Fig 15 Different amount of lead absorbed by bacteria with MBP expressed in different subcellular compartments cultured for ~40h in 10-5 mol/L Pb (II) medium.'''<br />
<br />
<br />
<br />
==reference==<br />
[1] Peng Chen, Bill Greenberg, Safiyh Taghavi, Christine Romano, Daniel van der Lelie, and Chuan He, An exceptionally selective lead (II)-regulatory protein from Ralstonia metallidurans: development of a fluorescent lead (II) probe, Angew. Chem. 117, 2005, 2775 –2779.<br>[2] Nigel L. Brown, Jivko V. Stoyanov, Stephen P. Kidd, Jon L. Hobman, The MerR family of transcriptional regulators, FEMS Microbiology Reviews, 27, 2003, 145-163.<br>[3] Lingyun Song, Jonathan Caguiat, Zhongrui Li, Jacob Shokes, Robert A. Scott, Lynda Olliff, and Anne O. Summers, Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site, Journal of Bacteriology, 186(6), 2004, 1861–1868.<br><br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/File:Ldpku11.pngFile:Ldpku11.png2010-10-27T23:24:33Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Expansion/LeadBioabsorbentTeam:Peking/Project/Expansion/LeadBioabsorbent2010-10-27T23:17:30Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
{{:Team:Peking/boxesII}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;PbrR-based lead bioabsorbent</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Expansion|Expansion]] > [[Team:Peking/Project/Expansion/LeadBioabsorbent|LeadBioabsorbent]]<html><br />
</div><br />
<br />
<br />
<div id="middlewhite"><br />
</html><br />
&nbsp;&nbsp;&nbsp;&nbsp;After the completion of MerR-based mercury decontamination kit, we decided to take another example to verify the validness of our design for metal binding peptide. Based on the previous homology study of MerR family proteins, we took a lead-sensing protein, PbrR, as the second research target.<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Lead contamination is a serious threat to human health and the environment. Lead poisoning is still one of the most common environmentally caused diseases in the world today.[1] As the concentration of such toxic ions is generally low, which present a huge challenge for environmental engineers to both detect and to absorb the pollutant with traditional chemical methods. A revolutionary strategy was taken into consideration, which took the advantage of metalloregulatory proteins with capability of sensing and absorbing the Pb(II) ions.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg"target="_blank" ><img src="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg" alt="Sequence alignment of MerR and PbrR<br />
"></a></html><br />
<br>'''Figure 1 Sequence alignment of MerR and PbrR. MerR family TFs share a highly conserved homology at their metal binding domains (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioabsorbent engineering might be applicable to other cases of heavy metals.'''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Nature has evolved numerous such regulating proteins to control the concentrations of beneficial or toxic metal ions with extraordinary sensitivity and selectivity.[1] As is known, the MerR family is a group of transcriptional activators with similar N-terminal helix-turn-helix DNA binding regions and C-terminal effector binding regions that are specific to the effector recognized.[2] The majority of regulators in the family respond to environmental stimuli, such as oxidative stress, heavy metals or antibiotics. A subgroup of the family activates transcription in response to metal ions. This subgroup shows sequence similarity in the C-terminal effector binding region as well as in the N-terminal region. PbrR is a MerR family protein found in ''Ralstonia metallidurans CH34'', a bacterium specifically adapted to survive under toxic heavy metal environment. The PbrR protein is responsible for regulation of lead(II) efflux pumps involved in lead detoxification inside ''R. Metallidurans''. <br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Due to the highly conserved homology of protein MerR and PbrR (Fig.1), we were able to apply the strategy used for MerR engineering to the development of lead bioabsorbent. Based on the crystal structure study of MerR, the metal binding domain of PbrR was recognized by sequence alignment with MerR.(Fig 2) [3] Further, 3D structure was also conducted.(Fig3)<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg" alt="Pb binding domain predicted by sequence alignment."></a></html><br />
<br>'''Figure 2 Pb binding domain predicted by sequence alignment. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming a metal binding pocket.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"target="_blank"><embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"id="imggrey"></a></html><br />
<br>'''Figure 3 3D structure modeling of PbrR. Note that PbrR comprises 2 domains, a metal binding domain at the C terminal and a DNA binding domain at the N-terminal, joined together by a interface domain. '''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Then we designed PbrR metal binding peptide, with consisted of two tandem duplications of α-helix 5 linked by a flexible linker, SSG, and followed by a short peptide sequence.(Fig 4) These direct tandem α-helices fold back on each other into an antiparallel, coiled-coil hairpin. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming disulfide bonds within the engineered dimer.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"></a></html><br />
<br>'''Figure 4 Design of PbrR metal binding peptide and structure prediction. Within the engineered dimer, six Cys-residues centralize 2 metal binding pocket, each of which specifically binds Pb(II) ions by forming disulfide bonds . '''<br><br />
<br />
The principles were same when we considered the construction of PbrR metal binding peptide (MBP). It was accomplished by fusing two copies of alpha-helices 5 of PbrR in tandem with three nonnative amino acids, SSG, as a bridge. PbrR MBP was then constructed and cloned into pSB1C3 backbone as a standard part for function test and the pET21a backbone as the commercial plasmid for the western blotting, as is shown in Fig 5. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png" width=500></a></html><br />
<br />
'''Fig 5. Construction procedure of PbrR (lead) MBP. Top: Standard part; Bottom: Expression detection part.'''<br />
<br />
As proved previously, when the mercury MBP was fused to DsbA, it would be efficiently translocated to the periplasm and works comparable to those targeting to the cytosol. Therefore, we fused lead MBP using the same method as it was in mercury MBP construction (Fig 6). Particularly, the PstI restriction site inside DsbA was mutated synonymously. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png" width=500></a></html><br />
<br />
'''Fig 6. Procedure of DsbA-MBP construction. '''<br />
<br />
<br />
In order to standardize the module, with Nest PCR, RBS (BBa_B0034) and T7 promoter are prefixed with the DsbA-MBP fusion, as is shown in Fig 5. A His-tag was fused at the C-terminal for further western blotting. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png" width=500></a></html><br />
<br />
'''Fig 7. Standardization procedure of DsbA-MBP.'''<br />
DsbA and MBD gene was amplified by PCR from pET-39b (+)-DsbA-MBP, with the primer containing T7 promoter, RBS and SD restriction sites, as shown in Fig 6. The PCR product was digested with EcoR I / Pst I and then cloned into EcoR I / Pst I double digested pSB1K3, to achieve the goal of standardization of the fusion protein (Fig. 7). <br />
<br />
Like surface display of MerR MBP, Lpp-OmpA-MBP was designed as a fusion protein consisting of the signal sequence and first 9 amino acid of Lpp, residue 46~159 of OmpA and the PbrR metal binding peptide (MBP). The signal peptide of the N-termini of this fusion protein targets the protein to the membrane while the transmembrane domain of OmpA serves as an anchor. MBP is on the externally exposed loops of OmpA, which can be anchored to the outer membrane. As the method shown in mercury bioabsorbent construction, we directly fused the PbrR-MBP at the C-terminal of Lpp-OmpA protein through a flexible SG rich linker (Fig 8). <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png" width=500></a></html><br />
<br />
'''Fig 9. Procedures of the construction of standard plasmid with Lpp-OmpA-MBP as the insert. '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png" width=500></a></html><br />
<br />
'''Fig 10 Procedures of Construction of Commercial Plasmid. '''<br />
<br />
After the construction of the plasmid with the fusion protein gene Lpp-OmpA-MBP, We prefixed T7 promoter and BBa_B0030 upstream of Lpp-OmpA-MBP. Additionally, a strong terminator BBa_B0015 was suffixed. <br />
When the construction of three proteins was completed, T7 promoter+RBS and terminator were prefixed or suffixed to each protein coding sequence, respectively. T7 polymerase from T7 phage was designed to be constitutively expressed, thus to constitutively activate transcription at T7 promoter, in order to guarantee the expression of MBP regardless of the genetic background of bacteria strain. <br />
<br />
For the same reason as in Hg (II) MBP construction, we assembled the three modules [Fig. 11]: MBP, DsbA-MBP and Lpp-OmpA-MBP, which would translocate MBP to the cytoplasm, periplasmic space and on the outer membrane in pSB1C3 for further function test. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png" width=500></a></html><br />
<br />
<br />
Fig 11. The lead absorption device we designed to guarantee the maximum of Pb absorption. Top: The final overall structure of lead absorption device as an insert in pSB1C3. Middle and Bottom: The production of T7 RNA polymerase is constitutive. T7 polymerases will active high rating transcription at T7 promoters. Thus Hg (II) will be highly effectively accumulated by substantial amount of MBPs which are translocated to cytosol, periplasm and cell surface of the bacteria. All the components were assembled together and cloned into pSB3K3.<br />
<br />
<br />
==Protein Expression and Function Test==<br />
<br />
The cytoplasmic expression, periplasmic translocation and surface display of PbrR-MBP were verified by SDS-PAGE and Western Blotting. The specific band in western blotting for his-tag fused MBP of about 12 kD confirmed that the MBP was expressed as expected (Fig 12). Considerable amount of MBP expressed in cytosol can also be indicated from the result of SDS-PAGE. Overexpression band in SDS-PAGE result and specific band in the western blotting in size of expected molecular weight also indicated that the fusion proteins were translocated into periplasm and displayed on the surface as expected (Fig 13). Therefore, the bioabsorbent of lead employs same pathways to serve the decontamination goal as mecury bioabsorbent: to express MBP in the cytosol, in the periplasm and on the surface. Their expression was under the regulation of T7 promoter, driven by constitutively expressed T7 polymerase.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png" width=500></a></html><br />
<br />
<br />
'''Fig 12. The specific band in western blot for his-tag fused MBP of about 12 kD confirmed that the MBP is expressed as expected. Considerable amount of MBP expressed in cytosol can be indicated from the result of SDS-PAGE. '''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png" width=500></a></html><br />
<br />
<br />
'''Fig 13. There are overexpression band in SDS-PAGE result and specific band in the western result at the expected molecular weight, which indicate that the fusion proteins are translocated into periplasm as expected. <br />
Besides, we conducted 3D structure modeling to overview them and their localization (Fig 14). '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png" width=500></a></html><br />
<br />
'''Fig 14. Overview of various localization of MBP engineered from PbrR. '''<br />
<br />
After verifying that the PbrR-MBP could be expressed and translocated as expected, the function test was carried out with ICP-AES, using the method described at MBP Expression Page. The result was similar to that of mercury MBP. The lead binding capacity of MBP with different localization was indicated in Fig 15. The surface displayed MBP appeared to have highest binding capacity while the pyramiding of MBP expression did not function as expected. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png" width=500></a></html><br />
<br />
'''Fig 15 Different amount of lead absorbed by bacteria with MBP expressed in different subcellular compartments cultured for ~40h in 10-5 mol/L Pb (II) medium.'''<br />
<br />
<br />
<br />
==reference==<br />
[1] Peng Chen, Bill Greenberg, Safiyh Taghavi, Christine Romano, Daniel van der Lelie, and Chuan He, An exceptionally selective lead (II)-regulatory protein from Ralstonia metallidurans: development of a fluorescent lead (II) probe, Angew. Chem. 117, 2005, 2775 –2779.<br>[2] Nigel L. Brown, Jivko V. Stoyanov, Stephen P. Kidd, Jon L. Hobman, The MerR family of transcriptional regulators, FEMS Microbiology Reviews, 27, 2003, 145-163.<br>[3] Lingyun Song, Jonathan Caguiat, Zhongrui Li, Jacob Shokes, Robert A. Scott, Lynda Olliff, and Anne O. Summers, Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site, Journal of Bacteriology, 186(6), 2004, 1861–1868.<br><br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Expansion/LeadBioabsorbentTeam:Peking/Project/Expansion/LeadBioabsorbent2010-10-27T23:15:43Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
{{:Team:Peking/boxesII}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="twhite"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;PbrR-based lead bioabsorbent</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Expansion|Expansion]] > [[Team:Peking/Project/Expansion/LeadBioabsorbent|LeadBioabsorbent]]<html><br />
</div><br />
<br />
<br />
<div id="middlewhite"><br />
</html><br />
&nbsp;&nbsp;&nbsp;&nbsp;After the completion of MerR-based mercury decontamination kit, we decided to take another example to verify the validness of our design for metal binding peptide. Based on the previous homology study of MerR family proteins, we took a lead-sensing protein, PbrR, as the second research target.<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Lead contamination is a serious threat to human health and the environment. Lead poisoning is still one of the most common environmentally caused diseases in the world today.[1] As the concentration of such toxic ions is generally low, which present a huge challenge for environmental engineers to both detect and to absorb the pollutant with traditional chemical methods. A revolutionary strategy was taken into consideration, which took the advantage of metalloregulatory proteins with capability of sensing and absorbing the Pb(II) ions.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg"target="_blank" ><img src="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg" alt="Sequence alignment of MerR and PbrR<br />
"id="imggrey"></a></html><br />
<br>'''Figure 1 Sequence alignment of MerR and PbrR. MerR family TFs share a highly conserved homology at their metal binding domains (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioabsorbent engineering might be applicable to other cases of heavy metals.'''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Nature has evolved numerous such regulating proteins to control the concentrations of beneficial or toxic metal ions with extraordinary sensitivity and selectivity.[1] As is known, the MerR family is a group of transcriptional activators with similar N-terminal helix-turn-helix DNA binding regions and C-terminal effector binding regions that are specific to the effector recognized.[2] The majority of regulators in the family respond to environmental stimuli, such as oxidative stress, heavy metals or antibiotics. A subgroup of the family activates transcription in response to metal ions. This subgroup shows sequence similarity in the C-terminal effector binding region as well as in the N-terminal region. PbrR is a MerR family protein found in ''Ralstonia metallidurans CH34'', a bacterium specifically adapted to survive under toxic heavy metal environment. The PbrR protein is responsible for regulation of lead(II) efflux pumps involved in lead detoxification inside ''R. Metallidurans''. <br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Due to the highly conserved homology of protein MerR and PbrR (Fig.1), we were able to apply the strategy used for MerR engineering to the development of lead bioabsorbent. Based on the crystal structure study of MerR, the metal binding domain of PbrR was recognized by sequence alignment with MerR.(Fig 2) [3] Further, 3D structure was also conducted.(Fig3)<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg" alt="Pb binding domain predicted by sequence alignment."id="imggrey"></a></html><br />
<br>'''Figure 2 Pb binding domain predicted by sequence alignment. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming a metal binding pocket.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"target="_blank"><embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"id="imggrey"></a></html><br />
<br>'''Figure 3 3D structure modeling of PbrR. Note that PbrR comprises 2 domains, a metal binding domain at the C terminal and a DNA binding domain at the N-terminal, joined together by a interface domain. '''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Then we designed PbrR metal binding peptide, with consisted of two tandem duplications of α-helix 5 linked by a flexible linker, SSG, and followed by a short peptide sequence.(Fig 4) These direct tandem α-helices fold back on each other into an antiparallel, coiled-coil hairpin. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming disulfide bonds within the engineered dimer.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"id="imggrey"></a></html><br />
<br>'''Figure 4 Design of PbrR metal binding peptide and structure prediction. Within the engineered dimer, six Cys-residues centralize 2 metal binding pocket, each of which specifically binds Pb(II) ions by forming disulfide bonds . '''<br><br />
<br />
The principles were same when we considered the construction of PbrR metal binding peptide (MBP). It was accomplished by fusing two copies of alpha-helices 5 of PbrR in tandem with three nonnative amino acids, SSG, as a bridge. PbrR MBP was then constructed and cloned into pSB1C3 backbone as a standard part for function test and the pET21a backbone as the commercial plasmid for the western blotting, as is shown in Fig 5. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png" id="imggrey"width=500></a></html><br />
<br />
'''Fig 5. Construction procedure of PbrR (lead) MBP. Top: Standard part; Bottom: Expression detection part.'''<br />
<br />
As proved previously, when the mercury MBP was fused to DsbA, it would be efficiently translocated to the periplasm and works comparable to those targeting to the cytosol. Therefore, we fused lead MBP using the same method as it was in mercury MBP construction (Fig 6). Particularly, the PstI restriction site inside DsbA was mutated synonymously. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png" id="imggrey"width=500></a></html><br />
<br />
'''Fig 6. Procedure of DsbA-MBP construction. '''<br />
<br />
<br />
In order to standardize the module, with Nest PCR, RBS (BBa_B0034) and T7 promoter are prefixed with the DsbA-MBP fusion, as is shown in Fig 5. A His-tag was fused at the C-terminal for further western blotting. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png" width=500></a></html><br />
<br />
'''Fig 7. Standardization procedure of DsbA-MBP.'''<br />
DsbA and MBD gene was amplified by PCR from pET-39b (+)-DsbA-MBP, with the primer containing T7 promoter, RBS and SD restriction sites, as shown in Fig 6. The PCR product was digested with EcoR I / Pst I and then cloned into EcoR I / Pst I double digested pSB1K3, to achieve the goal of standardization of the fusion protein (Fig. 7). <br />
<br />
Like surface display of MerR MBP, Lpp-OmpA-MBP was designed as a fusion protein consisting of the signal sequence and first 9 amino acid of Lpp, residue 46~159 of OmpA and the PbrR metal binding peptide (MBP). The signal peptide of the N-termini of this fusion protein targets the protein to the membrane while the transmembrane domain of OmpA serves as an anchor. MBP is on the externally exposed loops of OmpA, which can be anchored to the outer membrane. As the method shown in mercury bioabsorbent construction, we directly fused the PbrR-MBP at the C-terminal of Lpp-OmpA protein through a flexible SG rich linker (Fig 8). <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png" id="imggrey"width=500></a></html><br />
<br />
'''Fig 9. Procedures of the construction of standard plasmid with Lpp-OmpA-MBP as the insert. '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png" width=500></a></html><br />
<br />
'''Fig 10 Procedures of Construction of Commercial Plasmid. '''<br />
<br />
After the construction of the plasmid with the fusion protein gene Lpp-OmpA-MBP, We prefixed T7 promoter and BBa_B0030 upstream of Lpp-OmpA-MBP. Additionally, a strong terminator BBa_B0015 was suffixed. <br />
When the construction of three proteins was completed, T7 promoter+RBS and terminator were prefixed or suffixed to each protein coding sequence, respectively. T7 polymerase from T7 phage was designed to be constitutively expressed, thus to constitutively activate transcription at T7 promoter, in order to guarantee the expression of MBP regardless of the genetic background of bacteria strain. <br />
<br />
For the same reason as in Hg (II) MBP construction, we assembled the three modules [Fig. 11]: MBP, DsbA-MBP and Lpp-OmpA-MBP, which would translocate MBP to the cytoplasm, periplasmic space and on the outer membrane in pSB1C3 for further function test. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png" width=500></a></html><br />
<br />
<br />
Fig 11. The lead absorption device we designed to guarantee the maximum of Pb absorption. Top: The final overall structure of lead absorption device as an insert in pSB1C3. Middle and Bottom: The production of T7 RNA polymerase is constitutive. T7 polymerases will active high rating transcription at T7 promoters. Thus Hg (II) will be highly effectively accumulated by substantial amount of MBPs which are translocated to cytosol, periplasm and cell surface of the bacteria. All the components were assembled together and cloned into pSB3K3.<br />
<br />
<br />
==Protein Expression and Function Test==<br />
<br />
The cytoplasmic expression, periplasmic translocation and surface display of PbrR-MBP were verified by SDS-PAGE and Western Blotting. The specific band in western blotting for his-tag fused MBP of about 12 kD confirmed that the MBP was expressed as expected (Fig 12). Considerable amount of MBP expressed in cytosol can also be indicated from the result of SDS-PAGE. Overexpression band in SDS-PAGE result and specific band in the western blotting in size of expected molecular weight also indicated that the fusion proteins were translocated into periplasm and displayed on the surface as expected (Fig 13). Therefore, the bioabsorbent of lead employs same pathways to serve the decontamination goal as mecury bioabsorbent: to express MBP in the cytosol, in the periplasm and on the surface. Their expression was under the regulation of T7 promoter, driven by constitutively expressed T7 polymerase.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png" width=500></a></html><br />
<br />
<br />
'''Fig 12. The specific band in western blot for his-tag fused MBP of about 12 kD confirmed that the MBP is expressed as expected. Considerable amount of MBP expressed in cytosol can be indicated from the result of SDS-PAGE. '''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png" width=500></a></html><br />
<br />
<br />
'''Fig 13. There are overexpression band in SDS-PAGE result and specific band in the western result at the expected molecular weight, which indicate that the fusion proteins are translocated into periplasm as expected. <br />
Besides, we conducted 3D structure modeling to overview them and their localization (Fig 14). '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png" width=500></a></html><br />
<br />
'''Fig 14. Overview of various localization of MBP engineered from PbrR. '''<br />
<br />
After verifying that the PbrR-MBP could be expressed and translocated as expected, the function test was carried out with ICP-AES, using the method described at MBP Expression Page. The result was similar to that of mercury MBP. The lead binding capacity of MBP with different localization was indicated in Fig 15. The surface displayed MBP appeared to have highest binding capacity while the pyramiding of MBP expression did not function as expected. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png" width=500></a></html><br />
<br />
'''Fig 15 Different amount of lead absorbed by bacteria with MBP expressed in different subcellular compartments cultured for ~40h in 10-5 mol/L Pb (II) medium.'''<br />
<br />
<br />
<br />
==reference==<br />
[1] Peng Chen, Bill Greenberg, Safiyh Taghavi, Christine Romano, Daniel van der Lelie, and Chuan He, An exceptionally selective lead (II)-regulatory protein from Ralstonia metallidurans: development of a fluorescent lead (II) probe, Angew. Chem. 117, 2005, 2775 –2779.<br>[2] Nigel L. Brown, Jivko V. Stoyanov, Stephen P. Kidd, Jon L. Hobman, The MerR family of transcriptional regulators, FEMS Microbiology Reviews, 27, 2003, 145-163.<br>[3] Lingyun Song, Jonathan Caguiat, Zhongrui Li, Jacob Shokes, Robert A. Scott, Lynda Olliff, and Anne O. Summers, Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site, Journal of Bacteriology, 186(6), 2004, 1861–1868.<br><br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomwhite"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Expansion/LeadBioabsorbentTeam:Peking/Project/Expansion/LeadBioabsorbent2010-10-27T23:14:43Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
{{:Team:Peking/boxesII}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="ttrans"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;PbrR-based lead bioabsorbent</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Expansion|Expansion]] > [[Team:Peking/Project/Expansion/LeadBioabsorbent|LeadBioabsorbent]]<html><br />
</div><br />
<br />
<br />
<div id="middletrans"><br />
</html><br />
&nbsp;&nbsp;&nbsp;&nbsp;After the completion of MerR-based mercury decontamination kit, we decided to take another example to verify the validness of our design for metal binding peptide. Based on the previous homology study of MerR family proteins, we took a lead-sensing protein, PbrR, as the second research target.<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Lead contamination is a serious threat to human health and the environment. Lead poisoning is still one of the most common environmentally caused diseases in the world today.[1] As the concentration of such toxic ions is generally low, which present a huge challenge for environmental engineers to both detect and to absorb the pollutant with traditional chemical methods. A revolutionary strategy was taken into consideration, which took the advantage of metalloregulatory proteins with capability of sensing and absorbing the Pb(II) ions.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg"target="_blank" ><img src="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg" alt="Sequence alignment of MerR and PbrR<br />
"id="imggrey"></a></html><br />
<br>'''Figure 1 Sequence alignment of MerR and PbrR. MerR family TFs share a highly conserved homology at their metal binding domains (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioabsorbent engineering might be applicable to other cases of heavy metals.'''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Nature has evolved numerous such regulating proteins to control the concentrations of beneficial or toxic metal ions with extraordinary sensitivity and selectivity.[1] As is known, the MerR family is a group of transcriptional activators with similar N-terminal helix-turn-helix DNA binding regions and C-terminal effector binding regions that are specific to the effector recognized.[2] The majority of regulators in the family respond to environmental stimuli, such as oxidative stress, heavy metals or antibiotics. A subgroup of the family activates transcription in response to metal ions. This subgroup shows sequence similarity in the C-terminal effector binding region as well as in the N-terminal region. PbrR is a MerR family protein found in ''Ralstonia metallidurans CH34'', a bacterium specifically adapted to survive under toxic heavy metal environment. The PbrR protein is responsible for regulation of lead(II) efflux pumps involved in lead detoxification inside ''R. Metallidurans''. <br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Due to the highly conserved homology of protein MerR and PbrR (Fig.1), we were able to apply the strategy used for MerR engineering to the development of lead bioabsorbent. Based on the crystal structure study of MerR, the metal binding domain of PbrR was recognized by sequence alignment with MerR.(Fig 2) [3] Further, 3D structure was also conducted.(Fig3)<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg" alt="Pb binding domain predicted by sequence alignment."id="imggrey"></a></html><br />
<br>'''Figure 2 Pb binding domain predicted by sequence alignment. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming a metal binding pocket.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"target="_blank"><embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"id="imggrey"></a></html><br />
<br>'''Figure 3 3D structure modeling of PbrR. Note that PbrR comprises 2 domains, a metal binding domain at the C terminal and a DNA binding domain at the N-terminal, joined together by a interface domain. '''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Then we designed PbrR metal binding peptide, with consisted of two tandem duplications of α-helix 5 linked by a flexible linker, SSG, and followed by a short peptide sequence.(Fig 4) These direct tandem α-helices fold back on each other into an antiparallel, coiled-coil hairpin. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming disulfide bonds within the engineered dimer.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"id="imggrey"></a></html><br />
<br>'''Figure 4 Design of PbrR metal binding peptide and structure prediction. Within the engineered dimer, six Cys-residues centralize 2 metal binding pocket, each of which specifically binds Pb(II) ions by forming disulfide bonds . '''<br><br />
<br />
The principles were same when we considered the construction of PbrR metal binding peptide (MBP). It was accomplished by fusing two copies of alpha-helices 5 of PbrR in tandem with three nonnative amino acids, SSG, as a bridge. PbrR MBP was then constructed and cloned into pSB1C3 backbone as a standard part for function test and the pET21a backbone as the commercial plasmid for the western blotting, as is shown in Fig 5. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/30/Ldpku1.png" id="imggrey"width=500></a></html><br />
<br />
'''Fig 5. Construction procedure of PbrR (lead) MBP. Top: Standard part; Bottom: Expression detection part.'''<br />
<br />
As proved previously, when the mercury MBP was fused to DsbA, it would be efficiently translocated to the periplasm and works comparable to those targeting to the cytosol. Therefore, we fused lead MBP using the same method as it was in mercury MBP construction (Fig 6). Particularly, the PstI restriction site inside DsbA was mutated synonymously. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/1/16/Ldpku2.png" id="imggrey"width=500></a></html><br />
<br />
'''Fig 6. Procedure of DsbA-MBP construction. '''<br />
<br />
<br />
In order to standardize the module, with Nest PCR, RBS (BBa_B0034) and T7 promoter are prefixed with the DsbA-MBP fusion, as is shown in Fig 5. A His-tag was fused at the C-terminal for further western blotting. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c7/Ldpku3.png" width=500></a></html><br />
<br />
'''Fig 7. Standardization procedure of DsbA-MBP.'''<br />
DsbA and MBD gene was amplified by PCR from pET-39b (+)-DsbA-MBP, with the primer containing T7 promoter, RBS and SD restriction sites, as shown in Fig 6. The PCR product was digested with EcoR I / Pst I and then cloned into EcoR I / Pst I double digested pSB1K3, to achieve the goal of standardization of the fusion protein (Fig. 7). <br />
<br />
Like surface display of MerR MBP, Lpp-OmpA-MBP was designed as a fusion protein consisting of the signal sequence and first 9 amino acid of Lpp, residue 46~159 of OmpA and the PbrR metal binding peptide (MBP). The signal peptide of the N-termini of this fusion protein targets the protein to the membrane while the transmembrane domain of OmpA serves as an anchor. MBP is on the externally exposed loops of OmpA, which can be anchored to the outer membrane. As the method shown in mercury bioabsorbent construction, we directly fused the PbrR-MBP at the C-terminal of Lpp-OmpA protein through a flexible SG rich linker (Fig 8). <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/35/Ldpku4.png" id="imggrey"width=500></a></html><br />
<br />
'''Fig 9. Procedures of the construction of standard plasmid with Lpp-OmpA-MBP as the insert. '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f1/Ldpku5.png" width=500></a></html><br />
<br />
'''Fig 10 Procedures of Construction of Commercial Plasmid. '''<br />
<br />
After the construction of the plasmid with the fusion protein gene Lpp-OmpA-MBP, We prefixed T7 promoter and BBa_B0030 upstream of Lpp-OmpA-MBP. Additionally, a strong terminator BBa_B0015 was suffixed. <br />
When the construction of three proteins was completed, T7 promoter+RBS and terminator were prefixed or suffixed to each protein coding sequence, respectively. T7 polymerase from T7 phage was designed to be constitutively expressed, thus to constitutively activate transcription at T7 promoter, in order to guarantee the expression of MBP regardless of the genetic background of bacteria strain. <br />
<br />
For the same reason as in Hg (II) MBP construction, we assembled the three modules [Fig. 11]: MBP, DsbA-MBP and Lpp-OmpA-MBP, which would translocate MBP to the cytoplasm, periplasmic space and on the outer membrane in pSB1C3 for further function test. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/0/02/Ldpku6.png" width=500></a></html><br />
<br />
<br />
Fig 11. The lead absorption device we designed to guarantee the maximum of Pb absorption. Top: The final overall structure of lead absorption device as an insert in pSB1C3. Middle and Bottom: The production of T7 RNA polymerase is constitutive. T7 polymerases will active high rating transcription at T7 promoters. Thus Hg (II) will be highly effectively accumulated by substantial amount of MBPs which are translocated to cytosol, periplasm and cell surface of the bacteria. All the components were assembled together and cloned into pSB3K3.<br />
<br />
<br />
==Protein Expression and Function Test==<br />
<br />
The cytoplasmic expression, periplasmic translocation and surface display of PbrR-MBP were verified by SDS-PAGE and Western Blotting. The specific band in western blotting for his-tag fused MBP of about 12 kD confirmed that the MBP was expressed as expected (Fig 12). Considerable amount of MBP expressed in cytosol can also be indicated from the result of SDS-PAGE. Overexpression band in SDS-PAGE result and specific band in the western blotting in size of expected molecular weight also indicated that the fusion proteins were translocated into periplasm and displayed on the surface as expected (Fig 13). Therefore, the bioabsorbent of lead employs same pathways to serve the decontamination goal as mecury bioabsorbent: to express MBP in the cytosol, in the periplasm and on the surface. Their expression was under the regulation of T7 promoter, driven by constitutively expressed T7 polymerase.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/c/c3/Ldpku7.png" width=500></a></html><br />
<br />
<br />
'''Fig 12. The specific band in western blot for his-tag fused MBP of about 12 kD confirmed that the MBP is expressed as expected. Considerable amount of MBP expressed in cytosol can be indicated from the result of SDS-PAGE. '''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/dd/Ldpku8.png" width=500></a></html><br />
<br />
<br />
'''Fig 13. There are overexpression band in SDS-PAGE result and specific band in the western result at the expected molecular weight, which indicate that the fusion proteins are translocated into periplasm as expected. <br />
Besides, we conducted 3D structure modeling to overview them and their localization (Fig 14). '''<br />
<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/e/e1/Ldpku9.png" width=500></a></html><br />
<br />
'''Fig 14. Overview of various localization of MBP engineered from PbrR. '''<br />
<br />
After verifying that the PbrR-MBP could be expressed and translocated as expected, the function test was carried out with ICP-AES, using the method described at MBP Expression Page. The result was similar to that of mercury MBP. The lead binding capacity of MBP with different localization was indicated in Fig 15. The surface displayed MBP appeared to have highest binding capacity while the pyramiding of MBP expression did not function as expected. <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png"target="_blank"><img src="https://static.igem.org/mediawiki/2010/3/32/Ldpku10.png" width=500></a></html><br />
<br />
'''Fig 15 Different amount of lead absorbed by bacteria with MBP expressed in different subcellular compartments cultured for ~40h in 10-5 mol/L Pb (II) medium.'''<br />
<br />
<br />
<br />
==reference==<br />
[1] Peng Chen, Bill Greenberg, Safiyh Taghavi, Christine Romano, Daniel van der Lelie, and Chuan He, An exceptionally selective lead (II)-regulatory protein from Ralstonia metallidurans: development of a fluorescent lead (II) probe, Angew. Chem. 117, 2005, 2775 –2779.<br>[2] Nigel L. Brown, Jivko V. Stoyanov, Stephen P. Kidd, Jon L. Hobman, The MerR family of transcriptional regulators, FEMS Microbiology Reviews, 27, 2003, 145-163.<br>[3] Lingyun Song, Jonathan Caguiat, Zhongrui Li, Jacob Shokes, Robert A. Scott, Lynda Olliff, and Anne O. Summers, Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site, Journal of Bacteriology, 186(6), 2004, 1861–1868.<br><br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomtrans"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/File:Ldpku10.pngFile:Ldpku10.png2010-10-27T23:13:30Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Ldpku9.pngFile:Ldpku9.png2010-10-27T23:12:19Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Ldpku8.pngFile:Ldpku8.png2010-10-27T23:10:21Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Ldpku7.pngFile:Ldpku7.png2010-10-27T23:08:45Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Ldpku6.pngFile:Ldpku6.png2010-10-27T23:07:10Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Ldpku5.pngFile:Ldpku5.png2010-10-27T23:05:47Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Ldpku4.pngFile:Ldpku4.png2010-10-27T23:04:59Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Ldpku3.pngFile:Ldpku3.png2010-10-27T23:03:05Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Ldpku2.pngFile:Ldpku2.png2010-10-27T23:02:36Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/File:Ldpku1.pngFile:Ldpku1.png2010-10-27T23:00:15Z<p>Cathterry: </p>
<hr />
<div></div>Cathterryhttp://2010.igem.org/Team:Peking/Project/Expansion/LeadBioabsorbentTeam:Peking/Project/Expansion/LeadBioabsorbent2010-10-27T23:00:04Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerpro}}<br />
{{:Team:Peking/boxes}}<br />
{{:Team:Peking/boxesII}}<br />
<html><br />
<br />
</div><br />
<br />
<html><br />
<div id="ttrans"><br />
<br><br><br />
<font size=5><font color=000><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;PbrR-based lead bioabsorbent</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Project|Project]] > [[Team:Peking/Project/Expansion|Expansion]] > [[Team:Peking/Project/Expansion/LeadBioabsorbent|LeadBioabsorbent]]<html><br />
</div><br />
<br />
<br />
<div id="middletrans"><br />
</html><br />
&nbsp;&nbsp;&nbsp;&nbsp;After the completion of MerR-based mercury decontamination kit, we decided to take another example to verify the validness of our design for metal binding peptide. Based on the previous homology study of MerR family proteins, we took a lead-sensing protein, PbrR, as the second research target.<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Lead contamination is a serious threat to human health and the environment. Lead poisoning is still one of the most common environmentally caused diseases in the world today.[1] As the concentration of such toxic ions is generally low, which present a huge challenge for environmental engineers to both detect and to absorb the pollutant with traditional chemical methods. A revolutionary strategy was taken into consideration, which took the advantage of metalloregulatory proteins with capability of sensing and absorbing the Pb(II) ions.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg"target="_blank" ><img src="https://static.igem.org/mediawiki/2010/4/4d/LeadintroFig1.jpg" alt="Sequence alignment of MerR and PbrR<br />
"id="imggrey"></a></html><br />
<br>'''Figure 1 Sequence alignment of MerR and PbrR. MerR family TFs share a highly conserved homology at their metal binding domains (Brown et al., 2003; Hobman, 2007), which implies that our strategies of bioabsorbent engineering might be applicable to other cases of heavy metals.'''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Nature has evolved numerous such regulating proteins to control the concentrations of beneficial or toxic metal ions with extraordinary sensitivity and selectivity.[1] As is known, the MerR family is a group of transcriptional activators with similar N-terminal helix-turn-helix DNA binding regions and C-terminal effector binding regions that are specific to the effector recognized.[2] The majority of regulators in the family respond to environmental stimuli, such as oxidative stress, heavy metals or antibiotics. A subgroup of the family activates transcription in response to metal ions. This subgroup shows sequence similarity in the C-terminal effector binding region as well as in the N-terminal region. PbrR is a MerR family protein found in ''Ralstonia metallidurans CH34'', a bacterium specifically adapted to survive under toxic heavy metal environment. The PbrR protein is responsible for regulation of lead(II) efflux pumps involved in lead detoxification inside ''R. Metallidurans''. <br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Due to the highly conserved homology of protein MerR and PbrR (Fig.1), we were able to apply the strategy used for MerR engineering to the development of lead bioabsorbent. Based on the crystal structure study of MerR, the metal binding domain of PbrR was recognized by sequence alignment with MerR.(Fig 2) [3] Further, 3D structure was also conducted.(Fig3)<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/d/d3/LeadintroFig2.jpg" alt="Pb binding domain predicted by sequence alignment."id="imggrey"></a></html><br />
<br>'''Figure 2 Pb binding domain predicted by sequence alignment. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming a metal binding pocket.'''<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"target="_blank"><embed src="https://static.igem.org/mediawiki/2010/6/64/PbrR.swf"id="imggrey"></a></html><br />
<br>'''Figure 3 3D structure modeling of PbrR. Note that PbrR comprises 2 domains, a metal binding domain at the C terminal and a DNA binding domain at the N-terminal, joined together by a interface domain. '''<br />
<br />
<br />
&nbsp;&nbsp;&nbsp;&nbsp;Then we designed PbrR metal binding peptide, with consisted of two tandem duplications of α-helix 5 linked by a flexible linker, SSG, and followed by a short peptide sequence.(Fig 4) These direct tandem α-helices fold back on each other into an antiparallel, coiled-coil hairpin. Three Cys-residues located at 79,114,123 specifically binds Pb(II) ions by forming disulfide bonds within the engineered dimer.<br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"id="imggrey"></a></html><br />
<br>'''Figure 4 Design of PbrR metal binding peptide and structure prediction. Within the engineered dimer, six Cys-residues centralize 2 metal binding pocket, each of which specifically binds Pb(II) ions by forming disulfide bonds . '''<br><br />
<br />
The principles were same when we considered the construction of PbrR metal binding peptide (MBP). It was accomplished by fusing two copies of alpha-helices 5 of PbrR in tandem with three nonnative amino acids, SSG, as a bridge. PbrR MBP was then constructed and cloned into pSB1C3 backbone as a standard part for function test and the pET21a backbone as the commercial plasmid for the western blotting, as is shown in Fig 5. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"id="imggrey"></a></html><br />
<br />
'''Fig 5. Construction procedure of PbrR (lead) MBP. Top: Standard part; Bottom: Expression detection part.'''<br />
<br />
As proved previously, when the mercury MBP was fused to DsbA, it would be efficiently translocated to the periplasm and works comparable to those targeting to the cytosol. Therefore, we fused lead MBP using the same method as it was in mercury MBP construction (Fig 6). Particularly, the PstI restriction site inside DsbA was mutated synonymously. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"id="imggrey"></a></html><br />
<br />
'''Fig 6. Procedure of DsbA-MBP construction. '''<br />
<br />
<br />
In order to standardize the module, with Nest PCR, RBS (BBa_B0034) and T7 promoter are prefixed with the DsbA-MBP fusion, as is shown in Fig 5. A His-tag was fused at the C-terminal for further western blotting. <br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"id="imggrey"></a></html><br />
<br />
'''Fig 7. Standardization procedure of DsbA-MBP.'''<br />
DsbA and MBD gene was amplified by PCR from pET-39b (+)-DsbA-MBP, with the primer containing T7 promoter, RBS and SD restriction sites, as shown in Fig 6. The PCR product was digested with EcoR I / Pst I and then cloned into EcoR I / Pst I double digested pSB1K3, to achieve the goal of standardization of the fusion protein (Fig. 7). <br />
<br />
Like surface display of MerR MBP, Lpp-OmpA-MBP was designed as a fusion protein consisting of the signal sequence and first 9 amino acid of Lpp, residue 46~159 of OmpA and the PbrR metal binding peptide (MBP). The signal peptide of the N-termini of this fusion protein targets the protein to the membrane while the transmembrane domain of OmpA serves as an anchor. MBP is on the externally exposed loops of OmpA, which can be anchored to the outer membrane. As the method shown in mercury bioabsorbent construction, we directly fused the PbrR-MBP at the C-terminal of Lpp-OmpA protein through a flexible SG rich linker (Fig 8). <br />
<br />
<br />
<html><a href="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg"target="_blank"><img src="https://static.igem.org/mediawiki/2010/f/f7/LeadintroFig3.jpg" alt="Design of PbrR metal binding peptide and structure prediction"id="imggrey"></a></html><br />
<br />
'''Fig 9. Procedures of the construction of standard plasmid with Lpp-OmpA-MBP as the insert. '''<br />
<br />
'''Fig 10 Procedures of Construction of Commercial Plasmid. '''<br />
<br />
After the construction of the plasmid with the fusion protein gene Lpp-OmpA-MBP, We prefixed T7 promoter and BBa_B0030 upstream of Lpp-OmpA-MBP. Additionally, a strong terminator BBa_B0015 was suffixed. <br />
When the construction of three proteins was completed, T7 promoter+RBS and terminator were prefixed or suffixed to each protein coding sequence, respectively. T7 polymerase from T7 phage was designed to be constitutively expressed, thus to constitutively activate transcription at T7 promoter, in order to guarantee the expression of MBP regardless of the genetic background of bacteria strain. <br />
<br />
For the same reason as in Hg (II) MBP construction, we assembled the three modules [Fig. 11]: MBP, DsbA-MBP and Lpp-OmpA-MBP, which would translocate MBP to the cytoplasm, periplasmic space and on the outer membrane in pSB1C3 for further function test. <br />
<br />
<br />
<br />
Fig 11. The lead absorption device we designed to guarantee the maximum of Pb absorption. Top: The final overall structure of lead absorption device as an insert in pSB1C3. Middle and Bottom: The production of T7 RNA polymerase is constitutive. T7 polymerases will active high rating transcription at T7 promoters. Thus Hg (II) will be highly effectively accumulated by substantial amount of MBPs which are translocated to cytosol, periplasm and cell surface of the bacteria. All the components were assembled together and cloned into pSB3K3.<br />
<br />
<br />
==Protein Expression and Function Test==<br />
<br />
The cytoplasmic expression, periplasmic translocation and surface display of PbrR-MBP were verified by SDS-PAGE and Western Blotting. The specific band in western blotting for his-tag fused MBP of about 12 kD confirmed that the MBP was expressed as expected (Fig 12). Considerable amount of MBP expressed in cytosol can also be indicated from the result of SDS-PAGE. Overexpression band in SDS-PAGE result and specific band in the western blotting in size of expected molecular weight also indicated that the fusion proteins were translocated into periplasm and displayed on the surface as expected (Fig 13). Therefore, the bioabsorbent of lead employs same pathways to serve the decontamination goal as mecury bioabsorbent: to express MBP in the cytosol, in the periplasm and on the surface. Their expression was under the regulation of T7 promoter, driven by constitutively expressed T7 polymerase.<br />
<br />
'''Fig 12. The specific band in western blot for his-tag fused MBP of about 12 kD confirmed that the MBP is expressed as expected. Considerable amount of MBP expressed in cytosol can be indicated from the result of SDS-PAGE. '''<br />
<br />
<br />
'''Fig 13. There are overexpression band in SDS-PAGE result and specific band in the western result at the expected molecular weight, which indicate that the fusion proteins are translocated into periplasm as expected. <br />
Besides, we conducted 3D structure modeling to overview them and their localization (Fig 14). '''<br />
<br />
'''Fig 14. Overview of various localization of MBP engineered from PbrR. '''<br />
<br />
After verifying that the PbrR-MBP could be expressed and translocated as expected, the function test was carried out with ICP-AES, using the method described at MBP Expression Page. The result was similar to that of mercury MBP. The lead binding capacity of MBP with different localization was indicated in Fig 15. The surface displayed MBP appeared to have highest binding capacity while the pyramiding of MBP expression did not function as expected. <br />
<br />
'''Fig 15 Different amount of lead absorbed by bacteria with MBP expressed in different subcellular compartments cultured for ~40h in 10-5 mol/L Pb (II) medium.'''<br />
<br />
<br />
<br />
==reference==<br />
[1] Peng Chen, Bill Greenberg, Safiyh Taghavi, Christine Romano, Daniel van der Lelie, and Chuan He, An exceptionally selective lead (II)-regulatory protein from Ralstonia metallidurans: development of a fluorescent lead (II) probe, Angew. Chem. 117, 2005, 2775 –2779.<br>[2] Nigel L. Brown, Jivko V. Stoyanov, Stephen P. Kidd, Jon L. Hobman, The MerR family of transcriptional regulators, FEMS Microbiology Reviews, 27, 2003, 145-163.<br>[3] Lingyun Song, Jonathan Caguiat, Zhongrui Li, Jacob Shokes, Robert A. Scott, Lynda Olliff, and Anne O. Summers, Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site, Journal of Bacteriology, 186(6), 2004, 1861–1868.<br><br><br />
<html><br />
</div><br />
<br />
<br />
<div id="bottomtrans"><br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
</div></div>Cathterryhttp://2010.igem.org/Team:Peking/Team/GalleryTeam:Peking/Team/Gallery2010-10-27T22:26:12Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Best Memories</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] <html><br />
</div><br />
<br />
<div id="middleblue"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:left;<br />
}<br />
</style><br />
<a href="https://2010.igem.org/Team:Peking/Gallery/SP" target="blank">ENJOY A WONDERFUL SUMMER</a><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/PKU_IGEM20102.gif" width="650px" alt="the whole team" id="imgblue"><br />
<p><font color="#ffffff"> Photos taken in the summer...a complete mess =__=|||...</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2f/%E5%9B%BE%E5%83%8F0201.jpg" width="650px" alt="Balloon on the experiment table" id="imgblue"><br />
<p><font color="#ffffff"> Balloon on the experiment table. Somebody said it surprisingly resembled Haoqian Zhang in looks.o( ><)o[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Rats.gif" width="300px" alt="Team's mascot~" id="imgblue"><br />
<p><font color="#ffffff"> &nbsp;&nbsp;The hamster couple are our team's mascots. Their names are &nbsp;&nbsp;Chaochao & Baobao, which means "gorgeously stylish" in &nbsp;&nbsp;Chinese.(=v=)[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg<br />
" width="650px" alt="Our Laboratory" id="imgblue"></a><br />
<p><font color="#ffffff"> &nbsp;&nbsp;Team members of the wet lab were working in the laboratory.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg<br />
" width="660px" alt="Birthday Party" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;At Ao Liu and Ying Shen's birthday party, we enjoyed a wonderful buffet.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" width="660px" alt="Weekly Meeting" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;We had meeting every Sunday in the Center for Theoretical Biology.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" width=50% alt="Team Pyjama-front" ></a><br />
<a href="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" width=50% alt="Team Pyjama-back" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Our Team's pyjama~~with project's illustration and team's logo on it.</font></p><br />
<br><br><br />
<br />
<a href="http://https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" width="660px" alt="Puzzle" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Eastsea【team's photographer】: Beautiful Pics shot by Eastsea, our stylish photographer = w =<br />
<br><br><br />
&nbsp;&nbsp;Cathterry【team's illustrator】: ..........U incurable narcissist...=_______=|||<br></font></p><br />
<br />
</div><br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="150px" height="100px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Team/GalleryTeam:Peking/Team/Gallery2010-10-27T22:25:39Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Best Memories</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] <html><br />
</div><br />
<br />
<div id="middleblue"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:left;<br />
}<br />
</style><br />
<a href="https://2010.igem.org/Team:Peking/Gallery/SP" target="blank">ENJOY A WONDERFUL SUMMER</a><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/PKU_IGEM20102.gif" width="650px" alt="the whole team" id="imgblue"><br />
<p><font color="#ffffff"> Photos taken in the summer...a complete mess =__=|||...</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2f/%E5%9B%BE%E5%83%8F0201.jpg" width="650px" alt="Balloon on the experiment table" id="imgblue"><br />
<p><font color="#ffffff"> Balloon on the experiment table. Somebody said it surprisingly resembled Haoqian Zhang in looks.o( ><)o[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Rats.gif" width="300px" alt="Team's mascot~" id="imgblue"><br />
<p><font color="#ffffff"> &nbsp;&nbsp;The hamster couple are our team's mascots. Their names are &nbsp;&nbsp;Chaochao & Baobao, which means "gorgeously stylish" in &nbsp;&nbsp;Chinese.(=v=)[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg<br />
" width="650px" alt="Our Laboratory" id="imgblue"></a><br />
<p><font color="#ffffff"> &nbsp;&nbsp;Team members of the wet lab were working in the laboratory.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg<br />
" width="660px" alt="Birthday Party" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;At Ao Liu and Ying Shen's birthday party, we enjoyed a wonderful buffet.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" width="660px" alt="Weekly Meeting" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;We had meeting every Sunday in the Center for Theoretical Biology.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" width=50% alt="Team Pyjama-front" ></a><br />
<a href="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" width=50% alt="Team Pyjama-back" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Our Team's pyjama~~with project's illustration and team's logo on it.</font></p><br />
<br><br><br />
<br />
<a href="http://https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" width="660px" alt="Puzzle" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Eastsea【team's photographer】: Beautiful Pics shot by Eastsea, our stylish photographer =,,=<br />
<br><br><br />
&nbsp;&nbsp;Cathterry【team's illustrator】: ..........U incurable narcissist...=_______=|||<br></font></p><br />
<br />
</div><br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="150px" height="100px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Team/GalleryTeam:Peking/Team/Gallery2010-10-27T22:25:09Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Best Memories</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] <html><br />
</div><br />
<br />
<div id="middleblue"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:left;<br />
}<br />
</style><br />
<a href="https://2010.igem.org/Team:Peking/Gallery/SP" target="blank">ENJOY A WONDERFUL SUMMER</a><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/PKU_IGEM20102.gif" width="650px" alt="the whole team" id="imgblue"><br />
<p><font color="#ffffff"> Photos taken in the summer...a complete mess =__=|||...</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2f/%E5%9B%BE%E5%83%8F0201.jpg" width="650px" alt="Balloon on the experiment table" id="imgblue"><br />
<p><font color="#ffffff"> Balloon on the experiment table. Somebody said it surprisingly resembled Haoqian Zhang in looks.o( ><)o[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Rats.gif" width="300px" alt="Team's mascot~" id="imgblue"><br />
<p><font color="#ffffff"> &nbsp;&nbsp;The hamster couple are our team's mascots. Their names are &nbsp;&nbsp;Chaochao & Baobao, which means "gorgeously stylish" in &nbsp;&nbsp;Chinese.(=v=)[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg<br />
" width="650px" alt="Our Laboratory" id="imgblue"></a><br />
<p><font color="#ffffff"> &nbsp;&nbsp;Team members of the wet lab were working in the laboratory.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg<br />
" width="660px" alt="Birthday Party" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;At Ao Liu and Ying Shen's birthday party, we enjoyed a wonderful buffet.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" width="660px" alt="Weekly Meeting" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;We had meeting every Sunday in the Center for Theoretical Biology.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" width=50% alt="Team Pyjama-front" ></a><br />
<a href="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" width=50% alt="Team Pyjama-back" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Our Team's pyjama~~with project's illustration and team's logo on it.</font></p><br />
<br><br><br />
<br />
<a href="http://https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" width="660px" alt="Puzzle" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Eastsea【team's photographer】: Beautiful Pics shot by Eastsea, our stylish photographer <br />
<br><br><br />
&nbsp;&nbsp;Cathterry【team's illustrator】: ..........U incurable narcissist...=_______=|||<br></font></p><br />
<br />
</div><br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="150px" height="100px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Team/GalleryTeam:Peking/Team/Gallery2010-10-27T22:22:27Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Best Memories</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] <html><br />
</div><br />
<br />
<div id="middleblue"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:left;<br />
}<br />
</style><br />
<a href="https://2010.igem.org/Team:Peking/Gallery/SP" target="blank">ENJOY A WONDERFUL SUMMER</a><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/PKU_IGEM20102.gif" width="650px" alt="the whole team" id="imgblue"><br />
<p><font color="#ffffff"> Photos taken in the summer...a complete mess =__=|||...</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2f/%E5%9B%BE%E5%83%8F0201.jpg" width="650px" alt="Balloon on the experiment table" id="imgblue"><br />
<p><font color="#ffffff"> Balloon on the experiment table. Somebody said it surprisingly resembled Haoqian Zhang in looks.o( ><)o[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Rats.gif" width="300px" alt="Team's mascot~" id="imgblue"><br />
<p><font color="#ffffff"> &nbsp;&nbsp;The hamster couple are our team's mascots. Their names are &nbsp;&nbsp;Chaochao & Baobao, which means "gorgeously stylish" in &nbsp;&nbsp;Chinese.(=v=)[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg<br />
" width="650px" alt="Our Laboratory" id="imgblue"></a><br />
<p><font color="#ffffff"> &nbsp;&nbsp;Team members of the wet lab were working in the laboratory.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg<br />
" width="660px" alt="Birthday Party" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;At Ao Liu and Ying Shen's birthday party, we enjoyed a wonderful buffet.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" width="660px" alt="Weekly Meeting" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;We had meeting every Sunday in the Center for Theoretical Biology.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" width=50% alt="Team Pyjama-front" ></a><br />
<a href="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" width=50% alt="Team Pyjama-back" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Our Team's pyjama~~with project's illustration and team's logo on it.</font></p><br />
<br><br><br />
<br />
<a href="http://https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" width="660px" alt="Puzzle" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Eastsea: Beautiful Pics shot by Eastsea, our stylish photographer <br />
<br><br><br />
&nbsp;&nbsp;Cathterry: ..........U incurable narcissist...=_______=|||<br></font></p><br />
<br />
</div><br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="150px" height="100px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Team/GalleryTeam:Peking/Team/Gallery2010-10-27T22:20:32Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Best Memories</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] <html><br />
</div><br />
<br />
<div id="middleblue"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:left;<br />
}<br />
</style><br />
<a href="https://2010.igem.org/Team:Peking/Gallery/SP" target="blank">ENJOY A WONDERFUL SUMMER</a><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/PKU_IGEM20102.gif" width="650px" alt="the whole team" id="imgblue"><br />
<p><font color="#ffffff"> Photos taken in the summer...a complete mess =__=|||...</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2f/%E5%9B%BE%E5%83%8F0201.jpg" width="650px" alt="Balloon on the experiment table" id="imgblue"><br />
<p><font color="#ffffff"> Balloon on the experiment table. Somebody said it surprisingly resembled Haoqian Zhang in looks.o( ><)o[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Rats.gif" width="300px" alt="Team's mascot~" id="imgblue"><br />
<p><font color="#ffffff"> &nbsp;&nbsp;The hamster couple are our team's mascots. Their names are &nbsp;&nbsp;Chaochao & Baobao, which means "gorgeously stylish" in &nbsp;&nbsp;Chinese.(=v=)[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg<br />
" width="650px" alt="Our Laboratory" id="imgblue"></a><br />
<p><font color="#ffffff"> &nbsp;&nbsp;Team members of the wet lab were working in the laboratory.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg<br />
" width="660px" alt="Birthday Party" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;At Ao Liu and Ying Shen's birthday party, we enjoyed a wonderful buffet.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" width="660px" alt="Weekly Meeting" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;We had meeting every Sunday in the Center for Theoretical Biology.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" width=50% alt="Team Pyjama-front" ></a><br />
<a href="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" width=50% alt="Team Pyjama-back" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Our Team's pyjama~~with project's illustration and team's logo on it.</font></p><br />
<br><br><br />
<br />
<a href="http://https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" width="660px" alt="Puzzle" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Eastsea: Beautiful Pics shot by Eastsea, our stylish photographer <br />
<br><br><br />
&nbsp;&nbsp;Cathterry: ..........An incurable narcissist...=_______=|||<br></font></p><br />
<br />
</div><br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="150px" height="100px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Team/GalleryTeam:Peking/Team/Gallery2010-10-27T22:19:33Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Best Memories</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] <html><br />
</div><br />
<br />
<div id="middleblue"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:left;<br />
}<br />
</style><br />
<a href="https://2010.igem.org/Team:Peking/Gallery/SP" target="blank">ENJOY A WONDERFUL SUMMER</a><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/PKU_IGEM20102.gif" width="650px" alt="the whole team" id="imgblue"><br />
<p><font color="#ffffff"> Photos taken in the summer...a complete mess =__=|||...</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2f/%E5%9B%BE%E5%83%8F0201.jpg" width="650px" alt="Balloon on the experiment table" id="imgblue"><br />
<p><font color="#ffffff"> Balloon on the experiment table. Somebody said it surprisingly resembled Haoqian Zhang in looks.o( ><)o[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Rats.gif" width="300px" alt="Team's mascot~" id="imgblue"><br />
<p><font color="#ffffff"> &nbsp;&nbsp;The hamster couple are our team's mascots. Their names are &nbsp;&nbsp;Chaochao & Baobao, which means "gorgeously stylish" in &nbsp;&nbsp;Chinese.(=v=)[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg<br />
" width="650px" alt="Our Laboratory" id="imgblue"></a><br />
<p><font color="#ffffff"> &nbsp;&nbsp;Team members of the wet lab were working in the laboratory.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg<br />
" width="660px" alt="Birthday Party" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;At Ao Liu and Ying Shen's birthday party, we enjoyed a wonderful buffet.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" width="660px" alt="Weekly Meeting" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;We had meeting every Sunday in the Center for Theoretical Biology.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" width=50% alt="Team Pyjama-front" ></a><br />
<a href="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" width=50% alt="Team Pyjama-back" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Our Team's pyjama~~with project's illustration and team's logo on it.</font></p><br />
<br><br><br />
<br />
<a href="http://https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" width="660px" alt="Puzzle" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Eastsea: Beautiful Pics shot by Eastsea, our stylish photographer <br />
<br><br><br />
&nbsp;&nbsp;Cathterry: ..........An incurable narcissism...=_______=|||<br></font></p><br />
<br />
</div><br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="150px" height="100px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Team/GalleryTeam:Peking/Team/Gallery2010-10-27T22:18:21Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Best Memories</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] <html><br />
</div><br />
<br />
<div id="middleblue"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:left;<br />
}<br />
</style><br />
<a href="https://2010.igem.org/Team:Peking/Gallery/SP" target="blank">ENJOY A WONDERFUL SUMMER</a><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/PKU_IGEM20102.gif" width="650px" alt="the whole team" id="imgblue"><br />
<p><font color="#ffffff"> Photos taken in the summer...a complete mess =__=|||...</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2f/%E5%9B%BE%E5%83%8F0201.jpg" width="650px" alt="Balloon on the experiment table" id="imgblue"><br />
<p><font color="#ffffff"> Balloon on the experiment table. Somebody said it surprisingly resembled Haoqian Zhang in looks.o( ><)o[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Rats.gif" width="300px" alt="Team's mascot~" id="imgblue"><br />
<p><font color="#ffffff"> &nbsp;&nbsp;The hamster couple are our team's mascots. Their names are &nbsp;&nbsp;Chaochao & Baobao, which means "gorgeously stylish" in &nbsp;&nbsp;Chinese.(=v=)[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg<br />
" width="650px" alt="Our Laboratory" id="imgblue"></a><br />
<p><font color="#ffffff"> &nbsp;&nbsp;Team members of the wet lab were working in the laboratory.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg<br />
" width="660px" alt="Birthday Party" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;At Ao Liu and Ying Shen's birthday party, we enjoyed a wonderful buffet.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" width="660px" alt="Weekly Meeting" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;We had meeting every Sunday in the Center for Theoretical Biology.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" width=50% alt="Team Pyjama-front" ></a><br />
<a href="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" width=50% alt="Team Pyjama-back" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Our Team's pyjama~~with project's illustration and team's logo on it.</font></p><br />
<br><br><br />
<br />
<a href="http://https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" width="660px" alt="Puzzle" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Eastsea: Beautiful Pics shot by Eastsea, our stylish photographer <br />
<br><br><br />
&nbsp;&nbsp;——An incurable narcissism...=_______=|||<br></font></p><br />
<br />
</div><br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="150px" height="100px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Team/GalleryTeam:Peking/Team/Gallery2010-10-27T22:17:44Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Best Memories</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] <html><br />
</div><br />
<br />
<div id="middleblue"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:left;<br />
}<br />
</style><br />
<a href="https://2010.igem.org/Team:Peking/Gallery/SP" target="blank">ENJOY A WONDERFUL SUMMER</a><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/PKU_IGEM20102.gif" width="650px" alt="the whole team" id="imgblue"><br />
<p><font color="#ffffff"> Photos taken in the summer...a complete mess =__=|||...</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2f/%E5%9B%BE%E5%83%8F0201.jpg" width="650px" alt="Balloon on the experiment table" id="imgblue"><br />
<p><font color="#ffffff"> Balloon on the experiment table. Somebody said it surprisingly resembled Haoqian Zhang in looks.o( ><)o[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Rats.gif" width="300px" alt="Team's mascot~" id="imgblue"><br />
<p><font color="#ffffff"> &nbsp;&nbsp;The hamster couple are our team's mascots. Their names are &nbsp;&nbsp;Chaochao & Baobao, which means "gorgeously stylish" in &nbsp;&nbsp;Chinese.(=v=)[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg<br />
" width="650px" alt="Our Laboratory" id="imgblue"></a><br />
<p><font color="#ffffff"> &nbsp;&nbsp;Team members of the wet lab were working in the laboratory.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg<br />
" width="660px" alt="Birthday Party" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;At Ao Liu and Ying Shen's birthday party, we enjoyed a wonderful buffet.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" width="660px" alt="Weekly Meeting" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;We had meeting every Sunday in the Center for Theoretical Biology.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" width=50% alt="Team Pyjama-front" ></a><br />
<a href="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" width=50% alt="Team Pyjama-back" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Our Team's pyjama~~with project's illustration and team's logo on it.</font></p><br />
<br><br><br />
<br />
<a href="http://https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" width="660px" alt="Puzzle" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Eastsea: Beautiful Pics shot by Eastsea, our stylish photographer <br />
<br><br><br />
&nbsp;&nbsp;——An incurable narcissism...<br></font></p><br />
<br />
</div><br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="150px" height="100px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Team/GalleryTeam:Peking/Team/Gallery2010-10-27T22:17:19Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Best Memories</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] <html><br />
</div><br />
<br />
<div id="middleblue"><br />
<style type="text/css"><br />
body{line-height:200%}<br />
img {<br />
float:left;<br />
}<br />
</style><br />
<a href="https://2010.igem.org/Team:Peking/Gallery/SP" target="blank">ENJOY A WONDERFUL SUMMER</a><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2d/PKU_IGEM20102.gif" width="650px" alt="the whole team" id="imgblue"><br />
<p><font color="#ffffff"> Photos taken in the summer...a complete mess =__=|||...</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/2/2f/%E5%9B%BE%E5%83%8F0201.jpg" width="650px" alt="Balloon on the experiment table" id="imgblue"><br />
<p><font color="#ffffff"> Balloon on the experiment table. Somebody said it surprisingly resembled Haoqian Zhang in looks.o( ><)o[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/0/03/Rats.gif" width="300px" alt="Team's mascot~" id="imgblue"><br />
<p><font color="#ffffff"> &nbsp;&nbsp;The hamster couple are our team's mascots. Their names are &nbsp;&nbsp;Chaochao & Baobao, which means "gorgeously stylish" in &nbsp;&nbsp;Chinese.(=v=)[[User:Cathterry|Cathterry]]</font></p><br />
<br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/4/46/Assembled.jpg<br />
" width="650px" alt="Our Laboratory" id="imgblue"></a><br />
<p><font color="#ffffff"> &nbsp;&nbsp;Team members of the wet lab were working in the laboratory.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg" target="_blank"><img src="https://static.igem.org/mediawiki/2010/8/88/P_large_oReI_3ff9000598fc2d11.jpg<br />
" width="660px" alt="Birthday Party" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;At Ao Liu and Ying Shen's birthday party, we enjoyed a wonderful buffet.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/1/1c/P_large_MA7H_33dd00001e802d0b.jpg" width="660px" alt="Weekly Meeting" id="imgblue"></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;We had meeting every Sunday in the Center for Theoretical Biology.</font></p><br />
<br><br><br />
<br />
<a href="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/f/f0/PKUpyjama1.png" width=50% alt="Team Pyjama-front" ></a><br />
<a href="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/5/56/PKUpyjama2.png" width=50% alt="Team Pyjama-back" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Our Team's pyjama~~with project's illustration and team's logo on it.</font></p><br />
<br><br><br />
<br />
<a href="http://https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" target="_blank"><br />
<img src="https://static.igem.org/mediawiki/2010/a/ab/Pkupuzzle521.jpg" width="660px" alt="Puzzle" ></a><br />
<p><font color="#ffffff"> <br>&nbsp;&nbsp;Eastsea: Beautiful Pics shot by Eastsea, our stylish photographer <br />
<br><br><br />
&nbsp;&nbsp;——incurable narcissism...<br></font></p><br />
<br />
</div><br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="150px" height="100px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/TeamTeam:Peking/Team2010-10-27T22:14:31Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=10><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;TEAM-HOME</font></font></font><br />
<br><br><br />
</div><br />
<div id="middleblue"><br />
<img src="https://static.igem.org/mediawiki/2010/0/09/Wholeteam.jpg" width="640" id="imgblue"><br />
</div><br />
<br />
<div id="titleblue"><br />
<br><br><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<font size=5><b><font color=#8181F7>Students</font></font></b><br />
<br />
</p><br />
</div><br />
<br />
<div id="middleblue"><br />
<br />
<br />
<a href="https://2010.igem.org/Team:Peking/Team/HQZhang"><img src="https://static.igem.org/mediawiki/2010/c/cc/Zhq11.jpg" width="82px" alt="Haoqian Zhang" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/XTeng"><img src="https://static.igem.org/mediawiki/2010/9/9c/TX11.jpg" width="82px" alt="Xin Teng" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/ALiu"><img src="https://static.igem.org/mediawiki/2010/7/70/La.jpg" width="82px" alt="Ao Liu" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/YHu"><img src="https://static.igem.org/mediawiki/2010/5/5c/Yjy.jpg" width="82px" alt="Yang Hu" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/YSheng"><img src="https://static.igem.org/mediawiki/2010/a/ad/SY.jpg" width="82px" alt="Ying Sheng"id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/MChen"><img src="https://static.igem.org/mediawiki/2010/d/de/Cm.jpg" width="82px" alt="Mei Chen" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/HPan"><img src="https://static.igem.org/mediawiki/2010/b/b5/PH.jpg" width="80px" alt="Heng Pan" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/MJing"><img src="https://static.igem.org/mediawiki/2010/a/af/JM.jpg" width="82px" alt="Miao Jing" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/QZWu"><img src="https://static.igem.org/mediawiki/2010/6/69/Wqz.jpg" width="82px" alt="Qianzhu Wu" id="imgblue"></a><br />
<br />
<img src="https://static.igem.org/mediawiki/2010/e/e2/Blockblue.jpg" width="260px" height="100px" ><br />
<br />
<br />
<br />
<a href="https://2010.igem.org/Team:Peking/Team/DHLiang"><img src="https://static.igem.org/mediawiki/2010/4/4a/Ldh-1.jpg" width="82px" alt="Donghai Liang" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/JYJiao"><img src="https://static.igem.org/mediawiki/2010/1/1e/Jz.jpg" width="82px" alt="Junyi Jiao" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/TZZhu"><img src="https://static.igem.org/mediawiki/2010/7/76/Ztz.jpg" width="82px" alt="Tianze Zhu" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/BXZhao"><img src="https://static.igem.org/mediawiki/2010/5/58/ZBX.jpg" width="82px" alt="Boxuan Zhao" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/YWChen"><img src="https://static.igem.org/mediawiki/2010/a/a1/MM.jpg" width="82px" alt="Yiwei Chen" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/ZRLiu"><img src="https://static.igem.org/mediawiki/2010/a/af/Rr.jpg" width="82px" alt="Zairan Liu" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/WYWang"><img src="https://static.igem.org/mediawiki/2010/a/a9/Wwy.jpg" width="88px" alt="Weiye Wang" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/YHLu"><img src="https://static.igem.org/mediawiki/2010/2/2a/Lyh11.jpg" width="88px" alt="Yuheng Lu" id="imgblue"></a><br />
<a href="https://2010.igem.org/Team:Peking/Team/ZZYin"><img src="https://static.igem.org/mediawiki/2010/a/ad/Yzz-1.jpg" width="88px" alt="Zhenzhen Yin" id="imgblue"></a><br />
</div><br />
<br />
<br />
<div id="titleblue"><br />
<br><br><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<font size=5><b><font color=#8181F7>Instructors</font></font></b><br />
<br />
</p><br />
</div><br />
<br />
<br />
<div id="middleblue"><br />
<br />
<a href="http://ctb.pku.edu.cn/main/en/people/people-faculty-ouyangqi.htm"><img src="https://static.igem.org/mediawiki/2010/5/5f/PKU_Ouyangqi.jpg" width="80px" alt="Qi Ouyang" id="imgblue"></a><br />
<a href="http://chemistry.uchicago.edu/faculty/faculty/person/member/chuan-he.html"target="_blank"><img src="https://static.igem.org/mediawiki/2010/9/90/Hechuan.jpg" width="80px" alt="Chuan He" id="imgblue"></a><br />
<a href="http://mdl.ipc.pku.edu.cn/"><img src="https://static.igem.org/mediawiki/2010/1/17/PKU_Luhua_Lai.jpg" width="80px" alt="Luhua Lai" id="imgblue"></a><br />
<a href="http://www.bio.pku.edu.cn/teachinfo/Biographical/wangyp.htm"><img src="https://static.igem.org/mediawiki/2010/6/64/PKU_Wang.jpg" width="80px" alt="Yiping Wang" id="imgblue"></a><br />
<br />
</div><br />
<br />
<br />
<div id="bottomblue"><br />
<br><br />
<a href="https://igem.org/Team.cgi?id=346"><font color=#FFFFFF>==Contact Us==</font></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<br />
<br />
</div><br />
<br />
<a href="#top"><img src="https://static.igem.org/mediawiki/2010/8/87/Top.png" width="100px" height="75px"alt="go back to top"></a><br />
<br />
</html></div>Cathterryhttp://2010.igem.org/Team:Peking/Gallery/SPTeam:Peking/Gallery/SP2010-10-27T22:00:45Z<p>Cathterry: </p>
<hr />
<div>{{:Team:Peking/Headerteam}}<br />
{{:Team:Peking/boxes}}<br />
<br />
<html><br />
<div id="tblue"><br />
<br><br><br />
<font size=6><font color=#585858><font face="Franklin Gothic Demi Cond">&nbsp;&nbsp;&nbsp;Special Memory</font></font></font><br />
<br><br><br>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
[[Team:Peking/Team|Team]] > [[Team:Peking/Team/Gallery|Gallery]] > [[Team:Peking/Gallery/SP|Special Memory]]<html><br />
</div><br />
<br />
<div id="middleblue"><br />
</html><br />
=Dear 2010 PKU iGEMers, I love U forever=<br />
<html><br />
<embed src="https://static.igem.org/mediawiki/igem.org/8/81/PKU_SP.swf" width=650 height=400 name="I LOVE U FOREVER" align="justify" ></html><br />
<html><br />
</div><br />
<br />
<div id="bottomblue"><br />
</div><br />
</html></div>Cathterry