http://2010.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=JohanNordholm&year=&month=2010.igem.org - User contributions [en]2024-03-29T02:36:54ZFrom 2010.igem.orgMediaWiki 1.16.5http://2010.igem.org/Team:Stockholm/general_pageTeam:Stockholm/general page2010-10-28T02:44:04Z<p>JohanNordholm: /* iGEM Stockholm 2010 */</p>
<hr />
<div><br><br />
{| <br />
| <html><br><img src="https://static.igem.org/mediawiki/2010/4/47/Hand2.png"></html><br />
| <html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html><br />
|<br />
== iGEM Stockholm 2010 ==<br />
<html><div style="text-align: justify; text-justify: newspaper">We are a small group of undergraduate students studying life science with professors as mentors at Stockholm University. This is our website about our work and effort in representing our school as Team Stockholm in the International Genetically Engineered Machines (iGEM) competition against other teams from all over the world.<br />
<p><br />
iGEM is an international research competition focused on synthetic biology. Each team is given a kit containing biological parts for practical work, which takes place at each teams' university. The use of these biological parts in combination with self-designed parts, will lay the ground for building innovative and useful new biological systems and operate them in living cells.<br />
<p><br />
This competition opens for students to think “out of the box” when engineering living organisms to be applied as tools for solving problems in healthcare, bioenergy, chemical and material production and bioremediation, to name a few.<br />
<p><br />
The principles in the field of synthetic biology is to combine science and engineering in order to genetically design and build living cells with novel biological roles and systems, aimed at overcoming the obstacles in modern life.<br />
<p><br />
Stay tuned for daily updates in the run up to the finals at Massachusetts Institute of Technology (MIT)!</div></html><br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Team/MembersTeam:Stockholm/Team/Members2010-10-28T02:38:13Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Team}}<br />
__NOTOC__ <br />
<br><br />
[[image:SU_Team_Icon.gif|400px|center]]<br />
<br />
{|<br />
|<br />
===Students===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Nina.jpg|100px|center]]<center><br />'''Nina Schiller'''<br />[mailto:nina@igem.se nina@igem.se]</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
I am one of the team-members of Team Stockholm, my name is Nina Schiller and I am a master student in molecular biology at Stockholm University. It is the endless possibilities and opportunities in the field of synthetic biology that has caught my attention to put together our iGEM team: Team Stockholm. To me, this field of research and iGEM competition drives science researchers and students to gain better insight and take advantage of the diverse and powerful characters of living organisms. This summer, I will together with my team mates work our hardest to combine biology, chemistry and engineering in order to understand, harness and imitate the complex phenomena of biological life and finally build innovative and useful biological systems.<br />
<br />
My goal with iGEM is to challenge myself to think “out of the box” and seek for ways to put together bits and pieces in science in order to design organisms that would prove useful in the obstacles in modern life. I look forward to build up my science knowledge and laboratory experience. Of course, with a great idea in our luggage, both my and the whole teams goal is to win the iGEM competition! <br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:2.jpg|100px|center]]<center><br />'''Andreas Constantinou'''<br />andreas (at) igem.se</center><br />
|width="590" border="0" align="justify"|I first came in contact with synthetic biology in 2008, when I heard about attempts to create a petroleum-producing bacterium to be used as an alternative energy source. Immediately fascinated by this idea and the synthetic biology concept and methodology, my aim has been to study this interesting field ever since. This has now led to the founding of a Stockholm-based team in the 2010 iGEM competition.<br />
<br />
What fascinates me most about synthetic biology is that it links biology and engineering together. With a great interest in both, I see iGEM as a unique opportunity for me to combine my creativity and knowledge in molecular biology to design and build a biological machine that can be used in every-day life.<br />
<br />
With a revolutionary idea, dedicated and hard-working team-members and a large portion of self-confidence, Team Stockholm is ready to fight for the 2010 iGEM Gold Medal!<br />
<br />
See you at the jamboree at MIT in November!<br />
|}<br />
<br /> <br />
<br />
{|<br />
|width="200"|[[Image:J.jpg|100px|center]]<center><br />'''Johan Nordholm'''<br />[mailto:johan@igem.se johan@igem.se]</center><br />
|width="590" border="0" align="justify"|Greetings!<br />
<br />
Synthetic biology is all about putting engineering into biology. And I think there is a small engineer hidden in each and every one of us. As with the ever-increasing understanding of how the building blocks of the cell function and are put together, so is our capacity to redesign the building blocks and the way they are put together. This has immense potential, I guarantee it can change our society as much as the computer industry has the last decades. This summer, I will do my best to apply existing biological knowledge to hopefully solve a scientific problem, if even a very small one. I am currently in my third and last year in the bachelor program of molecular biology at Stockholm University. As I have not yet undergone any research traineeship or degree project, my time spent in the lab is limited. I therefore find this project as a tremendous opportunity to change that. What makes this even more fun is that my teammates are some of my best friends.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Mim.jpg|100px|center]]<center><br />'''Emmelie Lidh'''</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
My name is Mimmi, right now I’m finishing my bachelor in molecular biology. <br />
<br />
I have always been fascinated by the origin of life. By how the genetic code can produce so many different life forms and make the organisms adapt to so many different niches and environments. Now, this competition is about using different traits nature invented and put them together to create new useful functions in an organism. I think this is an amazing way to study and learn more about the complex network of genes and at the same time produce a helpful organism.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Hassan.jpg|100px|center]]<center><br />'''Hassan Foroughi Asl'''<br />hassanfa (at) kth.se</center><br />
|width="590" border="0" align="justify"|Hi,<br />
<br />
I'm a Masters student in Computational and Systems Biology at Royal Institute of Technology (KTH) and a member of the Stockholm University team for iGEM competition. My first contact with iGEM and synthetic biology wasn't so long time ago. I got introduced to iGEM competitions in 2009. Then Synthetic biology attracted my attention and it became more interesting to me when I started to study about biological circuits and how these circuits are chosen by evolution. Here I will offer all my knowledge and effort to bring our ideas and plans into reality and solve the problem with a great success.<br />
|}<br />
<br /><br />
<br />
===Mentors===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Eli.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br/ >'''Prof. Elisabeth Hagg&aring;rd'''<br />Department of Genetics, Microbiology and Toxicology, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:gunnar_pic1.png|100px|center]]<br />
|width="590" border="0" align="justify"|<br>'''Prof. Gunnar von Heijne'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:Rob_Pick.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br />'''Assistant Prof. Robert Daniels'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
<br />
<br /><br><br><br />
{|<br />
|width="200"|<br />
|width="590" border="0" align="justify"|'''Co-advisors at Stockholm University:''' Prof. Lars Wieslander, Prof. Marie &Ouml;hman, Prof. Neus Visa and Prof. Roger Karlsson.<br />
<br />
===Acknowledgements===<br />
More people helped us in the lab and helped us shape and develop our idea for the modelling part. Among these, we would like to take this opportunity to show our gratitude to the following people:<br />
<br />
'''Sergey Surkov, Jaroslav Belotserkovsky, Sridhar Mandali and Richard Odegrip.'''<br />
<br />
<h3>Contributions</h3><br />
<br />
The idea was fully created and shaped by the students. All lab work was performed by the students. Invaluable help and support was given especially from the mentors, for that we are very grateful.<br />
|}<br />
<br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Team/MembersTeam:Stockholm/Team/Members2010-10-28T02:33:00Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Team}}<br />
<br><br />
[[image:SU_Team_Icon.gif|400px|center]]<br />
<br />
{|<br />
|<br />
===Students===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Nina.jpg|100px|center]]<center><br />'''Nina Schiller'''<br />[mailto:nina@igem.se nina@igem.se]</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
I am one of the team-members of Team Stockholm, my name is Nina Schiller and I am a master student in molecular biology at Stockholm University. It is the endless possibilities and opportunities in the field of synthetic biology that has caught my attention to put together our iGEM team: Team Stockholm. To me, this field of research and iGEM competition drives science researchers and students to gain better insight and take advantage of the diverse and powerful characters of living organisms. This summer, I will together with my team mates work our hardest to combine biology, chemistry and engineering in order to understand, harness and imitate the complex phenomena of biological life and finally build innovative and useful biological systems.<br />
<br />
My goal with iGEM is to challenge myself to think “out of the box” and seek for ways to put together bits and pieces in science in order to design organisms that would prove useful in the obstacles in modern life. I look forward to build up my science knowledge and laboratory experience. Of course, with a great idea in our luggage, both my and the whole teams goal is to win the iGEM competition! <br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:2.jpg|100px|center]]<center><br />'''Andreas Constantinou'''<br />andreas (at) igem.se</center><br />
|width="590" border="0" align="justify"|I first came in contact with synthetic biology in 2008, when I heard about attempts to create a petroleum-producing bacterium to be used as an alternative energy source. Immediately fascinated by this idea and the synthetic biology concept and methodology, my aim has been to study this interesting field ever since. This has now led to the founding of a Stockholm-based team in the 2010 iGEM competition.<br />
<br />
What fascinates me most about synthetic biology is that it links biology and engineering together. With a great interest in both, I see iGEM as a unique opportunity for me to combine my creativity and knowledge in molecular biology to design and build a biological machine that can be used in every-day life.<br />
<br />
With a revolutionary idea, dedicated and hard-working team-members and a large portion of self-confidence, Team Stockholm is ready to fight for the 2010 iGEM Gold Medal!<br />
<br />
See you at the jamboree at MIT in November!<br />
|}<br />
<br /> <br />
<br />
{|<br />
|width="200"|[[Image:J.jpg|100px|center]]<center><br />'''Johan Nordholm'''<br />[mailto:johan@igem.se johan@igem.se]</center><br />
|width="590" border="0" align="justify"|Greetings!<br />
<br />
Synthetic biology is all about putting engineering into biology. And I think there is a small engineer hidden in each and every one of us. As with the ever-increasing understanding of how the building blocks of the cell function and are put together, so is our capacity to redesign the building blocks and the way they are put together. This has immense potential, I guarantee it can change our society as much as the computer industry has the last decades. This summer, I will do my best to apply existing biological knowledge to hopefully solve a scientific problem, if even a very small one. I am currently in my third and last year in the bachelor program of molecular biology at Stockholm University. As I have not yet undergone any research traineeship or degree project, my time spent in the lab is limited. I therefore find this project as a tremendous opportunity to change that. What makes this even more fun is that my teammates are some of my best friends.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Mim.jpg|100px|center]]<center><br />'''Emmelie Lidh'''</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
My name is Mimmi, right now I’m finishing my bachelor in molecular biology. <br />
<br />
I have always been fascinated by the origin of life. By how the genetic code can produce so many different life forms and make the organisms adapt to so many different niches and environments. Now, this competition is about using different traits nature invented and put them together to create new useful functions in an organism. I think this is an amazing way to study and learn more about the complex network of genes and at the same time produce a helpful organism.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Hassan.jpg|100px|center]]<center><br />'''Hassan Foroughi Asl'''<br />hassanfa (at) kth.se</center><br />
|width="590" border="0" align="justify"|Hi,<br />
<br />
I'm a Masters student in Computational and Systems Biology at Royal Institute of Technology (KTH) and a member of the Stockholm University team for iGEM competition. My first contact with iGEM and synthetic biology wasn't so long time ago. I got introduced to iGEM competitions in 2009. Then Synthetic biology attracted my attention and it became more interesting to me when I started to study about biological circuits and how these circuits are chosen by evolution. Here I will offer all my knowledge and effort to bring our ideas and plans into reality and solve the problem with a great success.<br />
|}<br />
<br /><br />
<br />
===Mentors===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Eli.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br/ >'''Prof. Elisabeth Hagg&aring;rd'''<br />Department of Genetics, Microbiology and Toxicology, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:gunnar_pic1.png|100px|center]]<br />
|width="590" border="0" align="justify"|<br>'''Prof. Gunnar von Heijne'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:Rob_Pick.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br />'''Assistant Prof. Robert Daniels'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
<br />
<br /><br />
{|<br />
|width="200"|<br />
|width="590" border="0" align="justify"|'''Co-advisors at Stockholm University:''' Prof. Lars Wieslander, Prof. Marie &Ouml;hman, Prof. Neus Visa and Prof. Roger Karlsson.<br />
<br />
===Acknowledgements===<br />
More people helped us in the lab and helped us shape and develop our idea for the modelling part. Among these, we would like to take this opportunity to show our gratitude to the following people:<br />
<br />
'''Sergey Surkov, Jaroslav Belotserkovsky, Sridhar Mandali and Richard Odegrip.'''<br />
<br />
<br />
<br />
<h3>Contributions</h3><br />
<br />
The idea was fully created and shaped by the students. All lab work was performed by the students. Invaluable help and support was given especially from the mentors, for that we are very grateful.<br />
|}<br />
<br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Team/MembersTeam:Stockholm/Team/Members2010-10-28T02:23:43Z<p>JohanNordholm: /* Acknowledgements */</p>
<hr />
<div>{{Stockholm/Team}}<br />
<br><br />
[[image:SU_Team_Icon.gif|400px|center]]<br />
<br />
{|<br />
|<br />
===Students===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Nina.jpg|100px|center]]<center><br />'''Nina Schiller'''<br />[mailto:nina@igem.se nina@igem.se]</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
I am one of the team-members of Team Stockholm, my name is Nina Schiller and I am a master student in molecular biology at Stockholm University. It is the endless possibilities and opportunities in the field of synthetic biology that has caught my attention to put together our iGEM team: Team Stockholm. To me, this field of research and iGEM competition drives science researchers and students to gain better insight and take advantage of the diverse and powerful characters of living organisms. This summer, I will together with my team mates work our hardest to combine biology, chemistry and engineering in order to understand, harness and imitate the complex phenomena of biological life and finally build innovative and useful biological systems.<br />
<br />
My goal with iGEM is to challenge myself to think “out of the box” and seek for ways to put together bits and pieces in science in order to design organisms that would prove useful in the obstacles in modern life. I look forward to build up my science knowledge and laboratory experience. Of course, with a great idea in our luggage, both my and the whole teams goal is to win the iGEM competition! <br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:2.jpg|100px|center]]<center><br />'''Andreas Constantinou'''<br />andreas (at) igem.se</center><br />
|width="590" border="0" align="justify"|I first came in contact with synthetic biology in 2008, when I heard about attempts to create a petroleum-producing bacterium to be used as an alternative energy source. Immediately fascinated by this idea and the synthetic biology concept and methodology, my aim has been to study this interesting field ever since. This has now led to the founding of a Stockholm-based team in the 2010 iGEM competition.<br />
<br />
What fascinates me most about synthetic biology is that it links biology and engineering together. With a great interest in both, I see iGEM as a unique opportunity for me to combine my creativity and knowledge in molecular biology to design and build a biological machine that can be used in every-day life.<br />
<br />
With a revolutionary idea, dedicated and hard-working team-members and a large portion of self-confidence, Team Stockholm is ready to fight for the 2010 iGEM Gold Medal!<br />
<br />
See you at the jamboree at MIT in November!<br />
|}<br />
<br /> <br />
<br />
{|<br />
|width="200"|[[Image:J.jpg|100px|center]]<center><br />'''Johan Nordholm'''<br />[mailto:johan@igem.se johan@igem.se]</center><br />
|width="590" border="0" align="justify"|Greetings!<br />
<br />
Synthetic biology is all about putting engineering into biology. And I think there is a small engineer hidden in each and every one of us. As with the ever-increasing understanding of how the building blocks of the cell function and are put together, so is our capacity to redesign the building blocks and the way they are put together. This has immense potential, I guarantee it can change our society as much as the computer industry has the last decades. This summer, I will do my best to apply existing biological knowledge to hopefully solve a scientific problem, if even a very small one. I am currently in my third and last year in the bachelor program of molecular biology at Stockholm University. As I have not yet undergone any research traineeship or degree project, my time spent in the lab is limited. I therefore find this project as a tremendous opportunity to change that. What makes this even more fun is that my teammates are some of my best friends.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Mim.jpg|100px|center]]<center><br />'''Emmelie Lidh'''</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
My name is Mimmi, right now I’m finishing my bachelor in molecular biology. <br />
<br />
I have always been fascinated by the origin of life. By how the genetic code can produce so many different life forms and make the organisms adapt to so many different niches and environments. Now, this competition is about using different traits nature invented and put them together to create new useful functions in an organism. I think this is an amazing way to study and learn more about the complex network of genes and at the same time produce a helpful organism.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Hassan.jpg|100px|center]]<center><br />'''Hassan Foroughi Asl'''<br />hassanfa (at) kth.se</center><br />
|width="590" border="0" align="justify"|Hi,<br />
<br />
I'm a Masters student in Computational and Systems Biology at Royal Institute of Technology (KTH) and a member of the Stockholm University team for iGEM competition. My first contact with iGEM and synthetic biology wasn't so long time ago. I got introduced to iGEM competitions in 2009. Then Synthetic biology attracted my attention and it became more interesting to me when I started to study about biological circuits and how these circuits are chosen by evolution. Here I will offer all my knowledge and effort to bring our ideas and plans into reality and solve the problem with a great success.<br />
|}<br />
<br /><br />
<br />
===Mentors===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Eli.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br/ >'''Prof. Elisabeth Hagg&aring;rd'''<br />Department of Genetics, Microbiology and Toxicology, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:gunnar_pic1.png|100px|center]]<br />
|width="590" border="0" align="justify"|<br>'''Prof. Gunnar von Heijne'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:Rob_Pick.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br />'''Assistant Prof. Robert Daniels'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
<br />
<br /><br />
{|<br />
|width="200"|<br />
|width="590" border="0" align="justify"|'''Co-advisors at Stockholm University:''' Prof. Lars Wieslander, Prof. Marie &Ouml;hman, Prof. Neus Visa and Prof. Roger Karlsson.<br />
<br />
===Acknowledgements===<br />
Other than valuable help from our mentors, many more people helped us both in the lab, but also helped us shape and develop our idea for the modelling part. Among these, we would like to take this opportunity to show our gratitude to the following people:<br />
<br />
'''Sergey Surkov, Jaroslav Belotserkovsky, Sridhar Mandali and Richard Odegrip.'''<br />
<br />
<br />
----<br />
<br />
<br />
The idea was fully created and shaped by the students. All lab work was performed by the students. Invaluable help and support was given from mentors and advisors, in particular Rob Daniels Elisabeth & Hagg&aring;rd, for that we are very grateful.<br />
|}<br />
<br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Modelling/ModelTeam:Stockholm/Modelling/Model2010-10-28T02:19:14Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/modelling}}<br />
<br />
{|<br />
|[[image:SU_modelling_Icon.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px" align="justify"|<br />
=== Which model? ===<br />
<br />
Here we will introduce the model proposed by [http://www.ncbi.nlm.nih.gov/pubmed/12719218 Yildirim N et al 2002] a brief introduction to their model, then we will try to simplify it, declare some of our assumptions, apply our assumptions and continue with our gene expression model in bacteria as final stage.<br />
<br />
=== Yildirim N et al model ===<br />
<br />
In a series of 5 equations, They proposed dynamics for mRNA production, <VAR>&beta;</VAR>-galactosidase production, allolactose, lactose for Lac operon. In their model they also considered transcriptional and translational delays (ie. <VAR>&beta;</VAR>-galactosidase and <VAR>&beta;</VAR>-galactoside permease production from mRNA is not instant and takes time).<br />
<br />
<html><br />
<img src="https://static.igem.org/mediawiki/2010/f/f8/SU_yildirim_equations.png" alt="http://www.ncbi.nlm.nih.gov/pubmed/12719218 Yildirim N et al 2002" /><br />
</html><br />
<br />
Here, eq. (2) is the dynamics for mRNA, eq. (3) is dynamics for <VAR>&beta;</VAR>-galactosidase, eq. 4 is dynamics of allolactose, eq. (5) is dynamics of Lactose, and finally eq. (6) is the equation for premease. For more detailed explanation for the terms look in: [http://www.ncbi.nlm.nih.gov/pubmed/12719218 Yildirim N et al 2002].<br />
Until this point we have the same assumption as [http://www.ncbi.nlm.nih.gov/pubmed/12719218 Yildirim N et al 2002].<br />
<br />
=== Simplified model ===<br />
<br />
<br />
This model can be simplified. Ahmadzadeh et al. 2005 proposed a simplified model of [http://www.ncbi.nlm.nih.gov/pubmed/12719218 Yildirim N et al 2002], where they ignored time delays for transcription and translation. For more simplification they also assumed that β-galactosidase and β-galactoside permease reach their steady state values instantly, ending up with 3 equations just for mRNA, lactose and allolactose dynamics. Full description of the assumptions behind this simplification can be found at Ahmadzadeh et al. 2005 .<br />
<br />
[[image:Su_team_simplified_equation_sets.png|580px]]<br />
<br />
|}<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Modelling/Suitable_modelTeam:Stockholm/Modelling/Suitable model2010-10-28T02:15:37Z<p>JohanNordholm: /* Choosing proper model for LacI/allolactose dynamics */</p>
<hr />
<div>{{Stockholm/modelling}}<br />
__NOTOC__<br />
{|<br />
|[[image:SU_modelling_Icon.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
=== Choosing a proper model for LacI/allolactose dynamics ===<br />
<br />
<div align="justify">With the details mentioned in the introduction, the first step should be to prepare a proper model for allolactose/lactose dynamics. The reason for this is that binding of allolactose to LacI inhibits it from binding to the ''lac'' operator, which will result in gene expression. [http://www.ncbi.nlm.nih.gov/pubmed/12719218 Yildirim N ''et al.'' (2002)] proposed a mathematical model for lac operon induction in ''E. coli''. The details that they considered in their model are what we are looking for: external lactose, internal lactose, conversion of lactose to allolactose and glucose, interaction of allolactose with LacI and mRNA. Since LacI also acts as a repressor in our plasmid expression vector, it is reasonable to use the same model as [http://www.ncbi.nlm.nih.gov/pubmed/12719218 Yildirim N ''et al.'' (2002)].<br />
<br />
We start by a short reminder about the ''lac'' operon in ''E. coli''. The ''lac'' operon is responsible for transport and metabolism of lactose in ''E. coli''. It has a promoter site and three structural genes (''lacZ'', ''lacY'' and ''lacA''). Availability of external lactose and glucose regulates this operon. In the absence of lactose the ''lacI'' gene, which is always expressed, codes for the LacI repressor and represses the expression the of ''lac'' operon. When lactose is available again for the bacteria in the absence of glucose, allolactose (a β-galactosidase side reaction) binds to the repressor and prevents the repressor from binding to the ''lac'' operon operator. This will result in production of high levels of LacZ (β-galactosidase), LacY (β-galactoside permease) and LacA; the latter is not interesting in our case. LacZ and LacY expression will lead to more production of Allolactose (a metabolite of lactose).<br />
</div><br />
|}<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/23_August_2010Team:Stockholm/23 August 20102010-10-28T02:01:32Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Nina==<br />
<br />
===Sequencing of fusion protein===<br />
<br />
I prepared one tube of the fusion protein made up by protein A and IgG protease:<br />
<br />
15 ul plasmid from a mini-prep and 1.5 ul (10uM) primer VF2 of the bank vectors (C) verification primers.<br />
<br />
*ASB0045 B00<br />
<br />
===Ligation of protein A in peX=== <br />
<br />
I performed a ligation of protein A with the peX vector in order to induce the protein with IPTG o be able to see that the protein can become overexpressed in BL21 cells. <br />
<br />
Ligation:<br />
<br />
I wanted 25 ng vector<br />
<br />
90 ng/ul / X = 25 ng/ul<br />
<br />
X = 3 which means a 1:3 dilution. 1 ul vector sample and 2 ul dH2O. This results in 30 ng vector which is OK. <br />
<br />
I wanted ~4 times more gene than vector. Usually it is enough with 3 times more gene than vector but since this gene is pretty small (180 bp) I prefer to have a 4X more gene. <br />
<br />
4 * 30 = 120 <br />
<br />
120 ng/ul / 30ng/ul = 4 times more gene than vector. <br />
<br />
*Vector peX: 1 ul<br />
*Gene protein A: 5 ul<br />
*Quick ligase: 1 ul<br />
*2X quick ligase buffer: 7 ul<br />
<br />
Tot Volume: 14 ul<br />
<br />
I incubated in RT for 15 min. <br />
<br />
===PCR of ligation product===<br />
<br />
I wanted to check if I had a correct ligation before I transformed it into BL21 cells. Therefore I performed a PCR on the ligation product with peX verification primers. <br />
<br />
PCR mix:<br />
<br />
*MgCl 1 ul<br />
*Buffer 5X 10 ul<br />
*dNTP 1 ul<br />
*primer peX forward 3 ul<br />
*primer peX reverse 3 ul<br />
*polymerase PjuX7 1 ul<br />
*H2O 30 ul<br />
*Template 1 ul<br />
<br />
PCR prgm:<br />
<br />
===Agarose gel on protein A=== <br />
<br />
I ran an agarose gel 1 % 100 V on the PCR product of protein A in the peX vector in order to verify that the ligation has occured properly.<br />
<br />
Ladder: FastRuler™ Low Range DNA Ladder, ready-to-use, 50-1500 bp Fermentas<br />
<br />
[[Image:Bild10.jpg|250px]] <br />
<br />
The gel results show that I have had a good ligation since I got a band just below 400 on the ladder which I expected. The protein A gene is 180 nt and the verification primers add 200 nt which give a 380 nt band. This allows for a transformation tomorrow of the ligation product into BL21 cells. <br />
<br />
----<br />
<br />
==Andreas==<br />
<br />
===Assembly of SOD/yCCS&sdot;His constructs into pSB1K3===<br />
''Continued from 21/8''<br />
====Plasmid prep====<br />
{|border="1" cellpadding="1" cellspacing="0" align="right"<br />
|+ align="bottom"|&dagger;Samples concentrated in vacuum evaporator<br />
!colspan="5"|DNA concentrations<br />
|-<br />
|width="130"|&nbsp;<br />
|colspan="2" align="center"|Before sample conc.<br />
|colspan="2" align="center"|After sample conc.<br />
|-<br />
!Sample<br />
!width="90"|Conc. [ng/&mu;l]<br />
!width="70"|A<sub>260</sub>/A<sub>280</sub><br />
!width="90"|Conc. [ng/&mu;l]<br />
!width="70"|A<sub>260</sub>/A<sub>280</sub><br />
|-<br />
|pSB1K3.SOD&sdot;His 1&dagger;<br />
|align="center"|61.50<br />
|align="center"|1.86<br />
|align="center"|100.9<br />
|align="center"|1.80<br />
|-<br />
|pSB1K3.SOD&sdot;His 2&dagger;<br />
|align="center"|76.45<br />
|align="center"|1.78<br />
|align="center"|126.1<br />
|align="center"|1.83<br />
|-<br />
|pSB1K3.yCCS&sdot;His 2<br />
|align="center"|171.5<br />
|align="center"|1.88<br />
|align="center"|&ndash;<br />
|align="center"|&ndash;<br />
|-<br />
|pSB1K3.yCSS&sdot;His 3&dagger;<br />
|align="center"|84.15<br />
|align="center"|1.88<br />
|align="center"|133.6<br />
|align="center"|1.84<br />
|-<br />
|}<br />
''From 21/8 cultures''<br />
*E.Z.N.A Plasmid Mini kit I<br />
*50 &mu;l elution volume<br />
<br />
=====Sequencing=====<br />
Samples prepared for sequencing:<br />
*15 &mu;l DNA (>100 ng/&mu;l)<br />
*1.5 &mu;l 10 &mu;M pSB-VR primer<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!Sample<br />
!Label<br />
!Seq #<br />
|-<br />
|width="130"|pSB1K3.SOD&sdot;His 1<br />
|width="50"|pK-SH1<br />
|width="45" align="center"|938<br />
|-<br />
|pSB1K3.SOD&sdot;His 2<br />
|pK-SH2<br />
|align="center"|939<br />
|-<br />
|pSB1K3.yCCS&sdot;His 2<br />
|pK-yH2<br />
|align="center"|940<br />
|-<br />
|pSB1K3.yCCS&sdot;His 3<br />
|pK-yH3<br />
|align="center"|941<br />
|}<br />
<br />
===Enzyme inactivation===<br />
Inactivated restriction enzymes in digestion samples from 19/8 and 20/8 in 80 &deg;C, 10 min.<br />
*Dig pEX X+P<br />
*Dig pC.RFP X+P<br />
*Dig His E+A<br />
*Dig m-yCCS N+P<br />
*Dig m-SOD N+P<br />
<br />
===Transfer of RFP coding device to pEX===<br />
<br />
====Colony restreaks====<br />
''Results from 21/8''<br />
<br />
All clones grew well on the Amp plate, but not on Km, indicating RFP has indeed been transfered from pSB1K3 to a target AmpR vector, and that pSB1K3 does not express AmpR.<br />
<br />
''I later realized that the transfer of RFP was not from pSB1K3, but from pSB1C3, making this restreak pointless.''<br />
<br />
====Gel verification of Dig pEX X+P and Dig pC.RFP X+P====<br />
[[image:Gelver_dig_pEX_pC.RFP_23aug.png|200px|thumb|right|'''Gel verification of digested pEX and pSB1C3.RFP samples from 19/8.'''<br />Loading vol.: 4 &mu;l &lambda;; 4 &mu;l sample.<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
Ran a gel of the digestion samples from 19/8 to verify the sizes of vectors and inserts.<br />
<br />
1 % agarose, 100 V, 1 h 20 min<br />
<br />
'''Expected bands'''<br /><br />
*Dig pEX X+P<br />
**4453 bp (vector)<br />
**1237 bp (insert)<br />
*Dig pC.RFP X+P<br />
**2054 bp (pSB1C3 vector)<br />
**1095 bp (RFP insert)<br />
<br />
=====Results=====<br />
The bands for "pC.RFP X+P" correspond well to what was expected. However, none of the "pEX X+P" bands do. It might be possible that this is actually a pMA vector, carrying a &asymp;800 bp insert (unclear what). This would explain why ligations and transformations from 19/8 resulted in red colonies, but colony PCR amplification with pEX primers doesn't result in any bands.<br />
<br />
====Digestion of new pEX vector====<br />
Used pEX vector prepared and verified 21/8 for new pEX digestion with XbaI and PstI.<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
|+ align="bottom"|[pEX] = 55.52 ng/&mu;l<br />
!colspan="3"|Digestion mix<br />
|-<br />
|width="110"|'''10X FD buffer'''<br />
|width="30" align="center"|3 &mu;l<br />
|width="110" rowspan="6"|[DNA] = 33.3 ng/&mu;l<br /><br />Inc.: 37 &deg;C, 30 min<br />
|-<br />
|'''dH<sub>2</sub>O'''<br />
|align="center"|7 &mu;l<br />
|-<br />
|'''1 &mu;g DNA (pEX)'''<br />
|align="center"|18 &mu;l<br />
|-<br />
|'''FD XbaI'''<br />
|align="center"|1 &mu;l<br />
|-<br />
|'''FD PstI'''<br />
|align="center"|1 &mu;l<br />
|-<br />
|&nbsp;<br />
|align="center"|'''30 &mu;l'''<br />
|}<br />
<br />
Enzyme inactivation (<ul>after</ul> ligation): 80 &deg;C, 5 min<br />
<br />
=====Gel verification=====<br />
[[image:Gelver_dig_new-pEX_23aug.png|200px|thumb|right|'''Gel verification of new pEX vector digestion.'''<br />Loading vol.: 4 &mu;l &lambda;; 4 &mu;l sample.<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
1 % agarose, 100 V, 35 min<br />
<br />
'''Results'''<br /><br />
pEX confirmed - bands correspond well.<br />
<br />
====Ligation====<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!colspan="4"|Ligation mix<br />
|-<br />
|'''100 ng vector (pEX)'''<br />
|align="center"|3 &mu;l<br />
|rowspan="2"|1/3<br />ratio<br />
|rowspan="6"|[Dig pEX X+P] = 33.3 ng/&mu;l (23/8)<br />[Dig pC.RFP X+P]=66.6 ng/&mu;l (19/8)<br /><br />Inc.: 22 &deg;C, 10 min<br />
|-<br />
|'''165 ng insert (RFP)'''<br />
|align="center"|2.5 &mu;l<br />
|-<br />
|'''5X Rapid Ligation buf.'''<br />
|align="center" colspan="2"|4 &mu;l<br />
|-<br />
|'''dH<sub>2</sub>O'''<br />
|align="center" colspan="2"|9.5 &mu;l<br />
|-<br />
|'''T4 DNA Ligase'''<br />
|align="center" colspan="2"|1 &mu;l<br />
|-<br />
|&nbsp;<br />
|align="center" colspan="2"|'''20 &mu;l'''<br />
|}<br />
<br />
====Transformation====<br />
Procedures based on quick transformation protocol:<br />
*1.5 &mu;l ligation mix. 15 min incubation on ice.<br />
*30 s heat-shock in 42 &deg;C<br />
Plating onto 100 Amp LB agar. 37 &deg;C ON.<br />
<br />
===ON cultures===<br />
Set ON cultures for preparation of glycerol stocks:<br />
*3 ml LB + Km 50:<br />
**pSB1K3.SOD&sdot;His 1<br />
**pSB1K3.SOD&sdot;His 2<br />
**pSB1K3.yCCS&sdot;His 2<br />
**pSB1K3.yCCS&sdot;His 3<br />
*3 ml LB + Amp 100:<br />
**pMA.His (Picked 19/8)<br />
*pEX (Picked 19/8)<br />
<br />
Inc. 30 &deg;C, ON.<br />
<br />
===Assembly of His&sdot;SOD/yCCS constructs===<br />
====Ligation====<br />
Used digestion samples from 20/8 for ligations. Ligation protocol identical to that from 20/8.<br />
<br />
====Transformation====<br />
Standard transformation protocol.<br />
*1 &mu;l ligation mix<br />
*Plating on Km 50.<br />
<br />
==Johan==<br />
<br />
* PCR of bFGF from original vector<br />
<br />
1 µl Pfu polymerase<br />
<br />
5 µl 10x Pfu buffer<br />
<br />
36 µl H2O<br />
<br />
1 µl DNA<br />
<br />
1 µl dNTP<br />
<br />
3 µl bFGF for primer<br />
<br />
3 µl bFGF rev primer<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/24_August_2010Team:Stockholm/24 August 20102010-10-28T01:58:58Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Nina==<br />
<br />
===Tranformation of protein A===<br />
<br />
I transformed 100 ul BL21 cells with both 1 and 3 ul of protein A inserted into the peX vector. This transformation is carried out in order to perform an IPTG induction on protein A in BL21 e.coli cells. <br />
<br />
The transformation procedure is described in protocols. However, in step 1 I thawed the cells in 15 min instead of 10 min. In step 2 I added 1 ul of DNA sample to 100 ul BL21 cells and 3 ul of DNA sample to an additional 100 ul BL21 cells. <br />
<br />
===Sequencing of tyrosinase===<br />
<br />
Since the last sequencing of the two tyrosinase samples did not turn out well, I send two new tyrosinase samples for sequencing. This time I mixed the sample with primers complementary to the bank vector iGEM send the gene in. I therefore mixed with the primer VR. I choose VR instead of VF2 because I wanted the primer to bind closer to the site where I performed a site directed mutagenesis. <br />
<br />
I prepared two tubes of tyrosinase:<br />
<br />
15 ul plasmid from a mini-prep and 1.5 ul (10uM) primer VR of the vectors verification primers.<br />
<br />
*Colony #4: ASB0045 B01<br />
<br />
*Colony #6: ASB0045 B02<br />
<br />
===PCR on N_CPP cluster===<br />
<br />
We obtained our N_CPP in a lysophilized form in an eppendorf tube, to which I added 24 ul of dH2O, vortexed and spann down by centrifuging ~10 seconds.<br />
<br />
I prepared a PCR mix with the N_CPP cluster as the DNA template. This PCR product will in following days become digested and ligated into both the pEX and shipping vector.<br />
<br />
PCR mix:<br />
<br />
#Buffer Pfu buffer + MgSO4 10X 4.33 ul<br />
#dNTP 10 uM 1 ul<br />
#primer VF2 10 uM 3 ul<br />
#primer pgex 10 uM 3 ul<br />
#polymerase Pfu 1 ul<br />
#DNA template 1 ul<br />
#H2O 30 ul <br />
<br />
I did a 1:5 dilution of primer pgex from 50 uM to 10 uM. 1 ul 50 uM primer and 4 ul dH2O.<br />
<br />
PCR prgm:<br />
<br />
==Andreas==<br />
===Glycerol stocks===<br />
''From 23/8 ON cultures''<br />
<br />
1600 &mu;l 100 % glycerol + 400 &mu;l cell culture.<br />
*pEX vector 24/8<br />
*pSB1K3.SOD&sdot;His 1<br />
*pSB1K3.SOD&sdot;His 2<br />
New cultures of the pSB1K3.yCCS&sdot;His will be set, as the current ones did not grow.<br />
<br />
===Assembly of SOD/yCCS&sdot;His into pSB1K3===<br />
====Transformation results====<br />
''From 23/8 transformations''<br />
<br />
*pSB1K3.His&sdot;SOD: Good colony yield<br />
*pSB1K3.His&sdot;yCCS: Good colony yield<br />
<br />
====Colony PCR====<br />
Picked four colonies from each plate for colony PCR, as follows:<br />
*pSB1K3.His&sdot;SOD: HS1, HS2, HS3, HS4<br />
*pSB1K3.His&sdot;yCCS: Hy1, Hy2, Hy3, Hy4<br />
*Positive control: PC (pSB1K3.RFP plasmid)<br />
<br />
Procedures according to colony PCR protocol.<br />
*Elongation time: 1:40<br />
<br />
====Gel verification====<br />
[[image:ColPCR_His.SOD-yCCS_24aug.png|200px|thumb|right|'''Gel verification of pSB1K3.His&sdot;SOD and pSB1K3.His&sdot;yCCS clones.'''<br />'''Loading volumes:''' 4 &mu;l &lambda;; 4 &mu;l sample.<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
1 % agarose, 100 V, 1 h<br />
<br />
'''Expected bands'''<br /><br />
*pSB1K3.His&sdot;SOD: 815 bp<br />
*pSB1K3.His&sdot;yCCS: 1100 bp<br />
*Positive control: 1385 bp<br />
<br />
=====Results=====<br />
*'''His&sdot;SOD:''' Well corresponding bands for samples HS1, HS3 and HS4, with HS1 possibly being slightly larger than the other two. This could also be an artifact from the gel.<br />
*'''His&sdot;yCCS:''' Well corresponding bands for samples Hy1 and Hy2.<br />
<br />
====ON cultures====<br />
Clones HS1, HS3, Hy1 and Hy2 were selected for verification by sequencing. ON cultures were set for plasmid and glycerol stock prep:<br />
*'''Plasmid prep'''<br />
**5 ml LB + 50 Km<br />
**37 &deg;C, 250 rpm<br />
*Glycerol stocks<br />
**3 ml LB + 50 Km.<br />
**30 &deg;C<br />
<br />
===MITF BioBrick construction===<br />
====New MITF primers====<br />
{|border="0" cellpadding="1" cellspacing="0" align="right"<br />
!MITF primers<br />
|-<br />
|<pre><br />
>pRc/CMV_VF (24 bp)<br />
AATACGACTCACTATAGGGAGACC<br />
<br />
>pRc/CMV_VR (20 bp)<br />
CGTTACTAGTGGATCCGAGC<br />
<br />
>MITF_F_18aug (32 bp)<br />
CTGGAAATGCTAGAATATAATCACTATCAGGT<br />
<br />
>MITF_R_18aug (20 bp)<br />
ACAAGTGTGCTCCGTCTCTT<br />
<br />
>MITF_FB-F_18aug (64 bp)<br />
GAAGAATTCGCGGCCGCTTCTAGATGGCCGGC<br />
CTGGAAATGCTAGAATATAATCACTATCAGGT<br />
<br />
>MITF_FB-R_18aug (53 bp)<br />
GAACTGCAGCGGCCGCTACTAGTATTAACCGG<br />
TACAAGTGTGCTCCGTCTCTT</pre><br />
|}<br />
New primers for MITF and pRc/CMV vector arrived.<br />
*pRc/CMV verification primers<br />
**pRc/CMV_VF<br />
**pRc/CMV_VR<br />
*MITF amplification primers<br />
**MITF_F_18aug<br />
**MITF_R_18aug<br />
*MITF amplification primers with 5' prefix/suffix primer extensions<br />
**MITF_FB-F_18aug<br />
**MITF_FB-R_18aug<br />
<br />
====PCR amplification====<br />
Ran PCR reactions using the three primer pairs and pRc/CMV.MITF plasmid DNA:<br />
#MITF VF (pRC/CMV verification primers)<br />
#MITF FR (MITF amplification primers)<br />
#MITF FB (MITF BioBrick primers)<br />
<br />
'''PCR tubes''' ''(25 &mu;l total volume)''<br /><br />
*illustra Ready-to-Go PCR tubes<br />
*Forward primer: 1 &mu;l<br />
*Reverse primer: 1 &mu;l<br />
*pRc/CMV MITF plasmid DNA (95 ng/&mu;l): 0.5 &mu;l<br />
*dH<sub>2</sub>O: 22.5 &mu;l<br />
#pRC/CMV verification<br />
<br />
'''PCR program'''<br /><br />
{|border="1" cellpadding="1" cellspacing="0" align="right"<br />
!colspan="3"|MITF FB PCR program<br />
|-<br />
|1)<br />
|colspan="2"|95 &deg;C - 10:00<br />
|-<br />
|2)<br />
|95 &deg;C - 00:30<br />
|rowspan="3"|x5<br />
|-<br />
|3)<br />
|55 &deg;C - 00:30<br />
|-<br />
|4)<br />
|72 &deg;C - 01:40<br />
|-<br />
|5)<br />
|95 &deg;C - 00:30<br />
|rowspan="3"|x25<br />
|-<br />
|6)<br />
|72 &deg;C - 00:30<br />
|-<br />
|7)<br />
|72 &deg;C - 01:40<br />
|-<br />
|8)<br />
|colspan="2"|72 &deg;C - 10:00<br />
|}<br />
<br />
#MITF VF: Same as colony PCR settings [[#Colony PCR|above]].<br />
#MITF VR: Same as colony PCR settings [[#Colony PCR|above]].<br />
#MITF FB: See table to the right.<br />
<br />
====Gel verification====<br />
[[image:MITF_PCR_24aug.png|200px|thumb|right|'''Gel verification of PCR amplified MITF with three different primer pairs'''<br />'''Loading volume:''' 4 &mu;l &lambda;; 4 &mu;l sample<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
1 % agarose, 100 V, 45 min<br />
<br />
'''Expected bands'''<br /><br />
*MITF VF: ?<br />
*MITF FR: 1254 bp<br />
*MITF FB: 1313 bp<br />
<br />
=====Results=====<br />
Bands for both MITF FR and MITF FB correspond to expected fragment sizes, indicating successful MITF amplification! No band for MITF VF, but if the MITF FB band is correct, the pRc/CMV verification primers are not needed.<br />
<br />
===Transfer of MITF to pSB1C3===<br />
====Digestion====<br />
Digested pSB1C3 vector (w/ RFP insert) as well as amplified MITF DNA with EcoRI and PstI.<br />
<br />
[pSB1C3.RFP] = 201 ng/&mu;l<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!colspan="3"|Digestion tubes<br />
|-<br />
|[&mu;l]<br />
!pSB1C3<br />
!MITF<br />
|-<br />
|10X FD buffer<br />
|3<br />
|3<br />
|-<br />
|DNA<br />
|10 (2 &mu;g)<br />
|10<br />
|-<br />
|dH<sub>2</sub>O<br />
|15<br />
|10<br />
|-<br />
|FD EcoRI<br />
|1<br />
|1<br />
|-<br />
|FD PstI<br />
|1<br />
|1<br />
|}<br />
<br />
Incubation: 37 &deg;C, 10 min<br /><br />
Enzyme inactivation: 80 &deg;C, 5 min<br />
<br />
====Ligation====<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!colspan="2"|Ligation tube<br />
|-<br />
|Vector DNA (pSB1C3)<br />
|width="40"|1.5 &mu;l<br />
|-<br />
|PCR DNA (MITF)<br />
|10 &mu;l<br />
|-<br />
|dH<sub>2</sub>O<br />
|3.5 &mu;l<br />
|-<br />
|5X Rapid Ligation buf.<br />
|4 &mu;l<br />
|-<br />
|T4 DNA Ligase<br />
|1 &mu;l<br />
|-<br />
|&nbsp;<br />
|'''20 &mu;l'''<br />
|}<br />
<br />
Incubation: 22 &deg;C, 10 min<br />
<br />
====Quick transformation====<br />
Procedures according to protocol<br />
*1.5 &mu;l ligation mix<br />
*Cm 25 LB agar plates<br />
<br />
===Tranfer of RFP to pEX===<br />
''Continued from 23/8''<br />
<br />
====Transformation results====<br />
Very few and small red colonies, difficult to pick. Decided to make a new ligation with a higher insert:vector ratio.<br />
<br />
====Ligation====<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!colspan="2"|Ligation tube<br />
|-<br />
|Vector DNA (pEX, 33.3 ng/&mu;l)<br />
|width="40"|1 &mu;l<br />
|-<br />
|Insert DNA (RFP, 66.6 ng/&mu;l)<br />
|5 &mu;l<br />
|-<br />
|dH<sub>2</sub>O<br />
|9 &mu;l<br />
|-<br />
|5X Rapid Ligation buf.<br />
|4 &mu;l<br />
|-<br />
|T4 DNA Ligase<br />
|1 &mu;l<br />
|-<br />
|&nbsp;<br />
|'''20 &mu;l'''<br />
|}<br />
<br />
Digested pEX and pSB1C3.RFP samples from 23/8 and 19/8, respectively.<br />
<br />
Incubation: 22 &deg;C, 10 min<br />
<br />
====Quick transformation====<br />
Procedures according to protocol<br />
*1.5 &mu;l ligation mix. 20 min incubation on ice.<br />
*Amp 100 LB agar plates<br />
<br />
==Johan==<br />
<br />
* Cut bFGF from original vector<br />
<br />
10 µl DNA<br />
<br />
2 µl 10x buffer<br />
<br />
1 µl XbaI<br />
<br />
1 µl AgeI<br />
<br />
16 µl H2O<br />
<br />
5 min 37 °C<br />
<br />
* 45 min gel 100V 1% of bFGF<br />
<br />
* Gel cleanup of bFGF<br />
<br />
<br />
* Cut C-vector (that has igg)<br />
<br />
14 µl H2O<br />
<br />
2 µl 10x buffer<br />
<br />
2 µl DNA<br />
<br />
1 µ XbaI<br />
<br />
1 µl AgeI<br />
<br />
5 min 37 °C<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/25_August_2010Team:Stockholm/25 August 20102010-10-28T01:52:32Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
<br />
===Transfer of MITF to pSB1C3===<br />
====Transformation results====<br />
''From 24/8''<br />
Due to late transformation 24/8, colonies didn't turn red until very late in the afternoon, revealing only two white colonies. These will be picked for colony PCR tomorrow.<br />
<br />
===Construction of His&sdot;SOD fusions===<br />
====Plasmid prep====<br />
''From 24/8 ON cultures''<br />
*E.Z.N.A. Plasmid Mini Prep kit<br />
*Elution volume: 50 &mu;l<br />
*Samples eluted twice to increase plasmid yield<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!colspan="5"|DNA concentrations<br />
|-<br />
|&nbsp;<br />
|colspan="2" align="center"|Original concentration<br />
|colspan="2" align="center"|Conc. after evaporation<br />
|-<br />
!Sample<br />
!ng/&mu;l<br />
!A<sub>260</sub>/A<sub>280</sub><br />
!ng/&mu;l<br />
!A<sub>260</sub>/A<sub>280</sub><br />
|-<br />
|pSB1K3.His&sdot;SOD 1<br />
|align="center"|52.52<br />
|align="center"|1.73<br />
|align="center"|127.1<br />
|align="center"|1.84<br />
|-<br />
|pSB1K3.His&sdot;SOD 3<br />
|align="center"|41.13<br />
|align="center"|1.74<br />
|align="center"|101.8<br />
|align="center"|1.84<br />
|-<br />
|pSB1K3.His&sdot;yCCS 1<br />
|align="center"|67.48<br />
|align="center"|1.79<br />
|align="center"|133.2<br />
|align="center"|1.86<br />
|-<br />
|pSB1K3.His&sdot;yCCS 2<br />
|align="center"|37.63<br />
|align="center"|1.87<br />
|align="center"|146.7<br />
|align="center"|1.88<br />
|}<br />
<br />
New ON cultures of pSB1K3.His&sdot;SOD 1 and pSB1K3.His&sdot;yCCS 2 were set for plasmid prep.<br />
*5 ml LB + Cm 25; 37 &deg;C, 250 rpm.<br />
<br />
====Glycerol stocks====<br />
*'''pMA.His:''' pMA.His 25/8<br />
*'''pSB1K3.yCCS&sdot;His 2:''' pK y&sdot;H2 25/8<br />
*'''pSB1K3.yCCS&sdot;His 3:''' pK y&sdot;H3 25/8<br />
*'''pSB1K3.His&sdot;SOD 1:''' pK H&sdot;S1 25/8<br />
*'''pSB1K3.His&sdot;SOD 3:''' pK H&sdot;S3 25/8<br />
*'''pSB1K3.His&sdot;yCCS 1:''' pK H&sdot;y1 25/8<br />
*'''pSB1K3.His&sdot;yCCS 2:''' pK H&sdot;y2 25/8<br />
<br />
====Sequencing====<br />
15 &mu;l DNA + 1.5 &mu;l 10 &mu;M pSB-VF2<br />
*'''pK.H.S1:''' ASB0045 979<br />
**pSB1K3.His&sdot;SOD 1<br />
*'''pK.H.S3:''' ASB0045 980<br />
**pSB1K3.His&sdot;SOD 3<br />
*'''pK.H.y1:''' ASB0045 981<br />
**pSB1K3.His&sdot;yCCS 1<br />
*'''pK.H.y2:''' ASB0045 982<br />
**pSB1K3.His&sdot;yCCS 2<br />
<br />
===Transfer of RFP cassette into pEX===<br />
====Transformation results====<br />
''From 24/8''<br />
<br />
Good colony yield but no red. Recalled that the RFP cassette is expressed from a LacI-sensitive promoter; since pEX expresses the LacI repressor, IPTG has to be added to induce expression of the RFP cassette.<br />
<br />
====Transformation====<br />
Plated an Amp 100 plate with 50 &mu;l 0.1 M IPTG. LB agar was then plated with quick-transformed cells, transformed with the 24/8 ligation mix.<br />
*1.5 &mu;l ligation mix<br />
<br />
==Johan==<br />
<br />
* Ligate cut bFGF into cut C-vector<br />
<br />
1 µl vector<br />
<br />
5 µl bFGF<br />
<br />
2 µl 10x buffer<br />
<br />
1 µl T4 ligase<br />
<br />
11 µl H2O<br />
<br />
20 min 22 °C<br />
<br />
Then heat-inactivation<br />
<br />
* Transformation of bFGF+C<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/16_September_2010Team:Stockholm/16 September 20102010-10-28T01:49:17Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
===Assembly of new parts===<br />
<br />
====Gel verification of part digestions====<br />
Ran gels of digestion samples in parallel with undigested samples to verify successful digestions and insert sizes.<br />
<br />
'''Gel 1'''<br /><br />
[[image:Gelver_diggel1_16sep.png|200px|thumb|right|'''Gel verification of digested samples, gel 1.''' <br />&4 &mu;l &lambda;; 3 &mu;l sample.<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
1 % agarose, 110 V<br />
<br />
'''Gel 2'''<br /><br />
[[image:Gelver_diggel2-3_16sep.png|200px|thumb|right|'''Gel verification of digested samples, gel 2.''' <br />&4 &mu;l &lambda;; 3 &mu;l sample.<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
1 % agarose, 110 V<br />
<br />
'''Results'''<br /><br />
Successful digestion with corresponding bands for all digested samples. N-TAT and N-Tra10 not verified, since gel was run too far, but plasmid linearization should indicate successful digestion.<br />
<br />
Most samples show somewhat incomplete digestion. For digestions with FastDigest enzymes, this may be an indication of old/inactive enzymes. Especially PstI should be analyzed for activity.<br />
<br />
====Colony PCR====<br />
Picked new colonies for colony PCR from 14/9 plates:<br />
*pSB1K3.N-TAT&sdot;SOD&sdot;His: TAT&sdot;SH 1-5<br />
*pSB1K3.N-Tra10&sdot;SOD&sdot;His: Tra10&sdot;SH 1-5<br />
*pEX.SOD 1-4<br />
<br />
Standard colony PCR settings.<br />
*Elongation: 1:30<br />
<br />
====Gel verification====<br />
[[image:ColPCR_TAT*SH_16sep.png|200px|thumb|right|'''Colony PCR gel verification of N-TAT&sdot;SOD&sdot;His clones. Gel 1'''<br />4 &mu;l &lambda;; 5 &mu;l sample.<br />1 kb &lambda; = O'GeneRuler 1 kb DNA ladder; 50 bp &lambda; = GeneRuler 50 bp DNA ladder.]]<br />
[[image:ColPCR_Tra10*SH_16sep.png|200px|thumb|right|'''Colony PCR gel verification of N-Tra10&sdot;SOD&sdot;His clones. Gel 2'''<br />4 &mu;l &lambda;; 5 &mu;l sample.<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
[[image:ColPCR_pEX.SOD_16sep.png|200px|thumb|right|'''Colony PCR gel verification of pEX.SOD clones. Gel 3'''<br />4 &mu;l &lambda;; 5 &mu;l sample.<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
<br />
'''Gel 1'''<br /><br />
1 % agarose, 110 V<br />
<br />
Expected bands<br />
*pSB1K3.N-TAT&sdot;SOD&sdot;His (TAT): 848 bp<br />
*pSB1C3.SOD&sdot;His (pC.SH): 815 bp<br />
<br />
'''Gel 2'''<br /><br />
1 % agarose, 110 V<br />
<br />
Expected bands<br />
*pSB1K3.N-Tra10&sdot;SOD&sdot;His (Tra10): 878 bp<br />
*pSB1C3.SOD&sdot;His (pC.SH): 815 bp<br />
<br />
'''Gel 3'''<br /><br />
1 % agarose, 110 V<br />
<br />
Expected bands<br />
*pEX.SOD: 678 bp<br />
*pEX.RFP: 862 bp, 1010 bp, 1124 bp, 1272 bp<br />
<br />
'''Results'''<br /><br />
pSB1K3.N-TAT&sdot;SOD&sdot;His clones 4 and 5 seem slightly larger than the control, pSB1C3.SOD&sdot;His, indicating correct assembly.<br /><br />
Of the pSB1K3.N-Tra10&sdot;SOD&sdot;His samples, clone 5 seems correct, compared to the control (same as above).<br />
For the pEX.SOD samples the results are very strange. Two of the clones resulted in way too large bands (&asymp;2500 bp); unclear what these vectors carry. Clone 2 resulted in a very weak band with the correct size. This clone was chosen for ON growth.<br />
<br />
====ON cultures====<br />
Set ON cultures (5 ml LB + 50 Km ''or'' 100 Amp; 37 &deg;C, 220 rpm) of the following:<br />
*pSB1K3.N-TAT&sdot;SOD&sdot;His 4<br />
*pSB1K3.N-TAT&sdot;SOD&sdot;His 5<br />
*pSB1K3.N-Tra10&sdot;SOD&sdot;His 5<br />
*pEX.SOD 2<br />
<br />
===N-CPP sequencing===<br />
Sequencing results from 13/9 returned.<br />
* pSB1C3.nCCP 2 ([[media:PSB1C3.nCCP_2_premix.txt|fasta]]) <br />
* pSB1C3.nCCP 3 ([[media:PSB1C3.nCCP_3_premix.txt|fasta]])<br />
* pSB1C3.nCCP 5 ([[media:PSB1C3.nCCP_5_premix.txt|fasta]])<br />
* pSB1C3.nCCP 8 ([[media:PSB1C3.nCCP_8_premix.txt|fasta]])<br />
* pSB1C3.nCCP 9 ([[media:PSB1C3.nCCP_9_premix.txt|fasta]])<br />
* pSB1C3.nCCP 10 ([[media:PSB1C3.nCCP_10_premix.txt|fasta]])<br />
* pSB1C3.nCCP 11 ([[media:PSB1C3.nCCP_11_premix.txt|fasta]])<br />
* pSB1C3.nCCP 12 ([[media:PSB1C3.nCCP_12_premix.txt|fasta]])<br />
<br />
Ran multiple nucleotide Blast (Blastn) alignments to identify the three N-CPPs from the sequence:<br />
*pSB1C3.N-TAT: clones 9 & 12 ([[media:Blastn_pSB.N-TAT_pSB1C3.nCPP_15sep.txt|Blastn]])<br />
*pSB1C3.N-Tra10: clone 5 ([[media:Blastn_pSB.N-Tra10_pSB1C3.nCPP_15sep.txt|Blastn]])<br />
*pSB1C3.N-LMWP: clones 2, 3 & 11 ([[media:Blastn_pSB.N-LMWP_pSB1C3.nCPP_15sep.txt|Blastn]])<br />
<br />
====ON cultures====<br />
Set ON cultures for plasmid prep (5 ml LB + 25 Cm; 37 &deg;C, 220 rpm) and glycerol stocks (3 ml LB + 25 Cm; 30 &deg;C).<br />
*Clone 5: pSB1C3.N-Tra10<br />
*Clone 11: pSB1C3.N-LMWP<br />
*Clone 12: pSB1C3.N-TAT<br />
<br />
<br />
<br />
<br />
<br />
<br />
== Mimmi ==<br />
<br />
=== SOD / yCCS ===<br />
<br />
==== protein gel ====<br />
<br />
*Thaw the samples and re-heat them in 95&deg;C, 5min<br />
<br />
*Load them on a PhastGel<br />
<br />
**20% 8 wells x2<br />
<br />
{| align="right"<br />
| <br />
! SOD<br />
! yCCS<br />
|-<br />
| length<br />
| 154aa<br />
| 249aa<br />
|-<br />
| Ip<br />
| 6.0695<br />
| 6.6594<br />
|-<br />
| charge<br />
| -2.0<br />
| +0.5<br />
|-<br />
| size<br />
| 15.9kDa<br />
| 27.3kDa<br />
|}<br />
::{| <br />
! SOD.his<br />
| 0h<br />
| 1h<br />
| 2h<br />
| 3h<br />
|-<br />
! his.SOD<br />
| 0h<br />
| 1h<br />
| 2h<br />
| 3h<br />
|-<br />
! yCCS<br />
| 0h<br />
| 1h<br />
| 2h<br />
| 3h<br />
|}<br />
<br />
<br />
<br />
{|<br />
! well<br />
! sample<br />
| rowspan="9" | [[Image:place_for_picture.jpg|200px|thumb|left|]]<br />
| rowspan="9" width="50" | <br />
! well<br />
! sample<br />
| rowspan="9" | [[Image:place_for_picture.jpg|200px|thumb|left|]]<br />
|-<br />
| 1<br />
| ladder<br />
| 1<br />
| ladder<br />
|-<br />
| 2<br />
| SOD.his 0h<br />
| 2<br />
| his.SOD 2h<br />
|-<br />
| 3<br />
| SOD.his 1h<br />
| 3<br />
| his.SOD 3h<br />
|-<br />
| 4<br />
| SOD.his 2h<br />
| 4<br />
| yCCS 0h<br />
|-<br />
| 5<br />
| SOD.his 3h<br />
| 5<br />
| yCCS 1h<br />
|-<br />
| 6<br />
| his.SOD 0h<br />
| 6<br />
| yCCS 2h<br />
|-<br />
| 7<br />
| his.SOD 1h<br />
| 7<br />
| yCCS 3h<br />
|-<br />
| 8<br />
| ladder<br />
| 8<br />
| ladder<br />
|}<br />
<br />
<br />
==== glycerol stock / over expression ====<br />
<br />
''yCCS''<br />
*Pick 2 new colonies, grow ON<br />
<br />
''SOD.his/his.SOD''<br />
*Pick some cells from the glycerol-stock, grow ON<br />
<br />
{|<br />
! glycerol stocks<br />
|-<br />
| yCCS 1 3ml LB<sub>AMP</sub> + 2µl culture (from PCR)<br />
|-<br />
| yCCS 2 3ml LB<sub>AMP</sub> + 2µl culture (from PCR)<br />
|-<br />
! ON for expression<br />
|-<br />
| SOD.his 1 5ml LB<sub>AMP</sub> + 5µl culture (from PCR)<br />
|-<br />
| his.SOD 1 5ml LB<sub>AMP</sub> + 5µl culture (from PCR)<br />
|-<br />
| yCCS 1 5ml LB<sub>AMP</sub> + 5µl culture (from PCR)<br />
|-<br />
| yCCS 2 5ml LB<sub>AMP</sub> + 5µl culture (from PCR)<br />
|}<br />
<br />
<br />
<br />
==== PCR ====<br />
<br />
{| <br />
! mix<br />
| (µl)<br />
| x4<br />
| rowspan="8" width="100" | <br />
! Primers<br />
| rowspan="8" width="100" | <br />
! colspan="2" | conditions<br />
| rowspan="3" | <br />
|-<br />
| mastermix<br />
| 24.5<br />
| rowspan="7" | <br />
| pEX<br />
! time<br />
! &deg;C<br />
|-<br />
| DNA<br />
| 0.5<br />
| rowspan="6" | <br />
| 10m<br />
| 95<br />
|-<br />
| align="right" | tot<br />
| 25µl<br />
| 30s<br />
| 95<br />
| )<br />
|-<br />
| colspan="2" rowspan="4" | <br />
| 30s<br />
| 55<br />
| > 30 cycles<br />
|-<br />
| 1m<br />
| 72<br />
| )<br />
|-<br />
| 5m<br />
| 72<br />
| rowspan="2" | <br />
|-<br />
| oo<br />
| 25<br />
|}<br />
<br />
<br />
<br />
<br />
=== MITF-M ===<br />
<br />
==== colony PCR ====<br />
<br />
{|<br />
! mix<br />
| (µl)<br />
| x8<br />
| rowspan="8" width="100" | <br />
! colspan="2" | conditions<br />
| rowspan="3" | <br />
|-<br />
| mastermix<br />
| 24.5<br />
| rowspan="7" | <br />
! time<br />
! &deg;C<br />
|-<br />
| DNA<br />
| 0.5<br />
| 10m<br />
| 95<br />
|-<br />
| align="right" | tot<br />
| 25µl<br />
| 30s<br />
| 95<br />
| )<br />
|-<br />
| colspan="2" rowspan="4" | <br />
| 30s<br />
| 55<br />
| > 30 cycles<br />
|-<br />
| 2m<br />
| 72<br />
| )<br />
|-<br />
| 10m<br />
| 72<br />
| rowspan="2" | <br />
|-<br />
| oo<br />
| 25<br />
|}<br />
<br />
<br />
<br />
==== Gel ====<br />
<br />
[[Image:place_for_picture.jpg|200px|thumb|left|]]<br />
{|<br />
! well<br />
! sample<br />
|-<br />
| 1<br />
| ladder<br />
|-<br />
| 2<br />
| MITF-M 1<br />
|-<br />
| 3<br />
| MITF-M 2<br />
|-<br />
| 4<br />
| MITF-M 3<br />
|-<br />
| 5<br />
| MITF-M 4<br />
|-<br />
| 6<br />
| MITF-M 5<br />
|-<br />
| 7<br />
| nTAT<br />
|-<br />
| 8<br />
| cTAT<br />
|-<br />
| 9<br />
| nTra10<br />
|}<br />
<br />
==Johan==<br />
<br />
PCR<br />
* 15sep pMA AS bFGF NS<br />
* 15sep pMA EN bFGF EA<br />
<br />
0,5 µl Pol<br />
<br />
0,5 µl dNTP<br />
<br />
5 µl 5x buffer<br />
<br />
1,5 µl for primer<br />
<br />
1,5 µl rev primer<br />
<br />
16 µl H2O<br />
<br />
3 colonies/plate<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Team/MembersTeam:Stockholm/Team/Members2010-10-28T01:46:32Z<p>JohanNordholm: /* Acknowledgements */</p>
<hr />
<div>{{Stockholm/Team}}<br />
<br><br />
[[image:SU_Team_Icon.gif|400px|center]]<br />
<br />
{|<br />
|<br />
===Students===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Nina.jpg|100px|center]]<center><br />'''Nina Schiller'''<br />[mailto:nina@igem.se nina@igem.se]</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
I am one of the team-members of Team Stockholm, my name is Nina Schiller and I am a master student in molecular biology at Stockholm University. It is the endless possibilities and opportunities in the field of synthetic biology that has caught my attention to put together our iGEM team: Team Stockholm. To me, this field of research and iGEM competition drives science researchers and students to gain better insight and take advantage of the diverse and powerful characters of living organisms. This summer, I will together with my team mates work our hardest to combine biology, chemistry and engineering in order to understand, harness and imitate the complex phenomena of biological life and finally build innovative and useful biological systems.<br />
<br />
My goal with iGEM is to challenge myself to think “out of the box” and seek for ways to put together bits and pieces in science in order to design organisms that would prove useful in the obstacles in modern life. I look forward to build up my science knowledge and laboratory experience. Of course, with a great idea in our luggage, both my and the whole teams goal is to win the iGEM competition! <br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:2.jpg|100px|center]]<center><br />'''Andreas Constantinou'''<br />andreas (at) igem.se</center><br />
|width="590" border="0" align="justify"|I first came in contact with synthetic biology in 2008, when I heard about attempts to create a petroleum-producing bacterium to be used as an alternative energy source. Immediately fascinated by this idea and the synthetic biology concept and methodology, my aim has been to study this interesting field ever since. This has now led to the founding of a Stockholm-based team in the 2010 iGEM competition.<br />
<br />
What fascinates me most about synthetic biology is that it links biology and engineering together. With a great interest in both, I see iGEM as a unique opportunity for me to combine my creativity and knowledge in molecular biology to design and build a biological machine that can be used in every-day life.<br />
<br />
With a revolutionary idea, dedicated and hard-working team-members and a large portion of self-confidence, Team Stockholm is ready to fight for the 2010 iGEM Gold Medal!<br />
<br />
See you at the jamboree at MIT in November!<br />
|}<br />
<br /> <br />
<br />
{|<br />
|width="200"|[[Image:J.jpg|100px|center]]<center><br />'''Johan Nordholm'''<br />[mailto:johan@igem.se johan@igem.se]</center><br />
|width="590" border="0" align="justify"|Greetings!<br />
<br />
Synthetic biology is all about putting engineering into biology. And I think there is a small engineer hidden in each and every one of us. As with the ever-increasing understanding of how the building blocks of the cell function and are put together, so is our capacity to redesign the building blocks and the way they are put together. This has immense potential, I guarantee it can change our society as much as the computer industry has the last decades. This summer, I will do my best to apply existing biological knowledge to hopefully solve a scientific problem, if even a very small one. I am currently in my third and last year in the bachelor program of molecular biology at Stockholm University. As I have not yet undergone any research traineeship or degree project, my time spent in the lab is limited. I therefore find this project as a tremendous opportunity to change that. What makes this even more fun is that my teammates are some of my best friends.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Mim.jpg|100px|center]]<center><br />'''Emmelie Lidh'''</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
My name is Mimmi, right now I’m finishing my bachelor in molecular biology. <br />
<br />
I have always been fascinated by the origin of life. By how the genetic code can produce so many different life forms and make the organisms adapt to so many different niches and environments. Now, this competition is about using different traits nature invented and put them together to create new useful functions in an organism. I think this is an amazing way to study and learn more about the complex network of genes and at the same time produce a helpful organism.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Hassan.jpg|100px|center]]<center><br />'''Hassan Foroughi Asl'''<br />hassanfa (at) kth.se</center><br />
|width="590" border="0" align="justify"|Hi,<br />
<br />
I'm a Masters student in Computational and Systems Biology at Royal Institute of Technology (KTH) and a member of the Stockholm University team for iGEM competition. My first contact with iGEM and synthetic biology wasn't so long time ago. I got introduced to iGEM competitions in 2009. Then Synthetic biology attracted my attention and it became more interesting to me when I started to study about biological circuits and how these circuits are chosen by evolution. Here I will offer all my knowledge and effort to bring our ideas and plans into reality and solve the problem with a great success.<br />
|}<br />
<br /><br />
<br />
===Mentors===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Eli.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br/ >'''Prof. Elisabeth Hagg&aring;rd'''<br />Department of Genetics, Microbiology and Toxicology, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:gunnar_pic1.png|100px|center]]<br />
|width="590" border="0" align="justify"|<br>'''Prof. Gunnar von Heijne'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:Rob_Pick.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br />'''Assistant Prof. Robert Daniels'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
<br />
<br /><br />
{|<br />
|width="200"|<br />
|width="590" border="0" align="justify"|'''Co-advisors at Stockholm University:''' Prof. Lars Wieslander, Prof. Marie &Ouml;hman, Prof. Neus Visa and Prof. Roger Karlsson.<br />
<br />
===Acknowledgements===<br />
Other than valuable help from our mentors, many more people helped us both in the lab, but also helped us shape and develop our idea for the modelling part. Among these, we would like to take this opportunity to show our gratitude to the following people:<br />
<br />
'''Sergey Surkov, Jaroslav Belotserkovsky, Sridhar Mandali and Richard Odegrip.'''<br />
<br />
<br />
----<br />
<br />
The idea was fully created and shaped by the students. All lab work was performed by the students. Invaluable help and support was given from mentors and advisors, in particular Rob Daniels Elisabeth & Hagg&aring;rd, for that we are very grateful.<br />
|}<br />
<br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/17_September_2010Team:Stockholm/17 September 20102010-10-28T01:37:40Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
==Andreas==<br />
===Plasmid preps===<br />
''From 16/9 ON cultures''<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!colspan="3"|DNA concentration<br />
|-<br />
!Sample<br />
!width="60"|Conc [ng/&mu;l]<br />
!width="60"|A<sub>260</sub>/A<sub>280</sub><br />
|-<br />
|pSB1C3.N-TAT<br />
|align="center"|64.07<br />
|align="center"|n/a<br />
|-<br />
|pSB1C3.N-Tra10<br />
|align="center"|46.38<br />
|align="center"|n/a<br />
|-<br />
|pSB1C3.N-LMWP<br />
|align="center"|65.77<br />
|align="center"|n/a<br />
|-<br />
|pSB1K3.N-TAT&sdot;SOD&sdot;His 4<br />
|align="center"|87.83<br />
|align="center"|n/a<br />
|-<br />
|pSB1K3.N-TAT&sdot;SOD&sdot;His 5<br />
|align="center"|8.464<br />
|align="center"|n/a<br />
|-<br />
|pSB1K3.N-Tra10&sdot;SOD&sdot;His 5<br />
|align="center"|6.872<br />
|align="center"|n/a<br />
|-<br />
|pEX.SOD<br />
|align="center"|31.57<br />
|align="center"|n/a<br />
|}<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
== Mimmi ==<br />
<br />
=== SOD / yCCS ===<br />
<br />
==== over expression ====<br />
<br />
*Start culture<br />
**10ml LB<sub>AMP</sub> + 100µl old culture (8:30)<br />
<br />
*Measure OD=0.6 (11:30)<br />
**At OD=0.6 add IPTG 1mM<br />
<br />
*Take samples after:<br />
**0h<br />
**2h<br />
***take 500µl, spinn down and remove LB <br />
***resuspend in 50µl SDS buffer<br />
***Heat in 95&deg;C, 5min<br />
***Freeze<br />
***Re-heat in 95&deg;C, 5min<br />
<br />
*Run gel<br />
<br />
<br />
<br />
<br />
==== PhastGel ====<br />
<br />
{|<br />
! well<br />
! sample<br />
| rowspan="9" | [[Image:Place_for_picture.jpg|200px|thumb|left|]]<br />
| rowspan="9" width="50" | <br />
! well<br />
! sample<br />
| rowspan="9" | [[Image:Place_for_picture.jpg|200px|thumb|left|]]<br />
|-<br />
| 1<br />
| ladder<br />
| 1<br />
| ladder<br />
|-<br />
| 2<br />
| SOD.his 0h<br />
| 2<br />
| yCCS 1 0h<br />
|-<br />
| 3<br />
| SOD.his 2h<br />
| 3<br />
| yCCS 1 2h<br />
|-<br />
| 4<br />
| his.SOD 0h<br />
| 4<br />
| yCCS 2 0h<br />
|-<br />
| 5<br />
| his.SOD 2h<br />
| 5<br />
| yCCS 2 2h<br />
|-<br />
| 6<br />
| ladder<br />
| 6<br />
| ladder<br />
|}<br />
<br />
<br />
=== his.SOD.cTAT ===<br />
<br />
==== colony PCR ====<br />
<br />
{| <br />
! mix<br />
| (µl)<br />
| x8<br />
| rowspan="8" width="100" | <br />
! Primers<br />
| rowspan="8" width="100" | <br />
! colspan="2" | conditions<br />
| rowspan="3" | <br />
|-<br />
| mastermix<br />
| 24.5<br />
| rowspan="7" | <br />
| pSB1_VF2<br />
! time<br />
! &deg;C<br />
|-<br />
| DNA<br />
| 0.5<br />
| pSB1_VR<br />
| 5m<br />
| 95<br />
|-<br />
| align="right" | tot<br />
| 25µl<br />
| rowspan="5" | <br />
| 30s<br />
| 95<br />
| )<br />
|-<br />
| colspan="2" rowspan="4" | <br />
| 30s<br />
| 55<br />
| > 30 cycles<br />
|-<br />
| 1m20s<br />
| 72<br />
| )<br />
|-<br />
| 10m<br />
| 72<br />
| rowspan="2" | <br />
|-<br />
| oo<br />
| 25<br />
|}<br />
<br />
==Johan==<br />
<br />
PCR again, to see if the 900 nt-band or the 700 nt-band is correct<br />
<br />
0,5 µl pol<br />
<br />
0,5 µl dNTP<br />
<br />
5 µl 5x buffer<br />
<br />
1,5 µl for primer<br />
<br />
1,5 µl rev primer<br />
<br />
16 µl H2O<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/20_September_2010Team:Stockholm/20 September 20102010-10-28T01:34:09Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
===Assembly of new parts===<br />
<br />
#'''pSB1K3.N-LMWP&sdot;SOD&sdot;His'''<br />
#*Dig pSB1C3.N-LMWP (E+A)<br />
#*Dig pMA.SOD&sdot;His (N+P)<br />
#*Dig pSB1K3.RFP (E+P)<br />
#'''pSB1C3.N-LMWP&sdot;SOD&sdot;His'''<br />
#*Dig pSB1C3.N-LMWP (A+S)<br />
#*Dig pMA.SOD&sdot;His (N+S)<br />
<br />
====Digestions====<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
|&nbsp;<br />
!width="50"|pSB1C3. N-LMWP<br />
!width="50"|pMA. SOD&sdot;His<br />
!width="50"|pSB1C3. N-LMWP<br />
!width="50"|pSB1K3. N-TAT&sdot;SOD&sdot; His 4<br />
|-<br />
|10X FastDigest buffer<br />
|align="center"|3<br />
|align="center"|3<br />
|align="center"|3<br />
|align="center"|2<br />
|-<br />
|dH<sub>2</sub>O<br />
|align="center"|15.2<br />
|align="center"|4.1<br />
|align="center"|15.2<br />
|align="center"|11.4<br />
|-<br />
|DNA (1 &mu;g)<br />
|align="center"|9.8<br />
|align="center"|20.9<br />
|align="center"|9.8<br />
|align="center"|4.6<br />
|-<br />
|AgeI<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|-<br />
|NgoMIV<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|0<br />
|-<br />
|FD SpeI<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|0<br />
|-<br />
|FD EcoRI<br />
|align="center"|0<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|-<br />
|FD PstI<br />
|align="center"|0<br />
|align="center"|0<br />
|align="center"|0<br />
|align="center"|1<br />
|-<br />
|FD XbaI<br />
|align="center"|0<br />
|align="center"|0<br />
|align="center"|0<br />
|align="center"|1<br />
|-<br />
|&nbsp;<br />
!30 &mu;l<br />
!30 &mu;l<br />
!30 &mu;l<br />
!20 &mu;l<br />
|}<br />
*Incubation: 37 &deg;C, 2:00 (NgoMIV & AgeI); 0:30 (FD)<br />
*Inactivation: 80 &deg;C, 20 min<br />
<br />
====Gel verification====<br />
1.5 % agarose, 120 V<br />
<br />
'''Expected bands'''<br />
*Dig pSB1C3.N-LMWP A+S 20/9: 2118 bp, (14 bp)<br />
*Dig pMA.SOD&sdot;His N+S 20/9: 2416 bp, 503 bp<br />
*Dig pSB1C3.N-LMWP E+A 20/9: 2063 bp, 69 bp<br />
*Dig pSB1K3.N-TAT&sdot;SOD&sdot;His 4 X+P 20/9: &asymp;2200 bp, 558 bp<br />
<br />
'''Results'''<br /><br />
<br />
====Ligations====<br />
*[Dig pSB1K3.RFP E+P 14/9] = 66.6 ng/&mu;l<br />
*[Dig pMA.His&sdot;SOD E+A 14/9] = 66.6 ng/&mu;l<br />
*[Dig pSB1C3.C-TAT N+P 15/9] = 66.6 ng/&mu;l<br />
*[Dig pSB1C3.N-LMWP A+S 20/9] = 33.3 ng/&mu;l<br />
*[Dig pMA.SOD&sdot;His N+S 20/9] = 33.3 ng/&mu;l<br />
*[Dig pSB1C3.N-LMWP E+A 20/9] = 33.3 ng/&mu;l<br />
*[Dig pSB1K3.N-TAT&sdot;SOD&sdot;His 4 X+P 20/9] = 33.3 ng/&mu;l<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
|&nbsp;<br />
!width="80"|pSB1C3. N-LMWP&sdot;SH<br />
!width="80"|pSB1K3. N-LMWP&sdot;SH<br />
!width="80"|pSB1A2. RBS.yCCS<br />
!width="80"|pEX. N-TAT&sdot;SH<br />
|-<br />
|10X T4 Ligase buffer<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|-<br />
|dH<sub>2</sub>O<br />
|align="center"|9<br />
|align="center"|0<br />
|align="center"|11<br />
|align="center"|11<br />
|-<br />
|Vector DNA<br />
|align="center"|2<br />
|align="center"|1.5<br />
|align="center"|1.5<br />
|align="center"|1.5<br />
|-<br />
|Insert 1 DNA<br />
|align="center"|6<br />
|align="center"|4.5<br />
|align="center"|4.5<br />
|align="center"|4.5<br />
|-<br />
|Insert 2 DNA<br />
|align="center"|&ndash;<br />
|align="center"|11<br />
|align="center"|&ndash;<br />
|align="center"|&ndash;<br />
|-<br />
|T4 DNA ligase<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|-<br />
|&nbsp;<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
|}<br />
*Incubation: 22 &deg;C, 15 min<br />
<br />
====Transformations====<br />
Standard transformations, procedures according to protocol.<br />
*1 &mu;l ligation mix<br />
**Lig pSB1C3.N-LMWP&sdot;SH (Cm 25)<br />
**Lig pSB1K3.N-LMWP&sdot;SH (Km 50)<br />
**Lig pSB1A2.RBS.yCCS (Amp 100)<br />
**Lig pEX.N-TAT&sdot;SH (Amp 100 + 50 &mu;l 0.1 mM IPTG)<br />
<br />
<br />
<br />
<br />
<br />
<br />
== Mimmi ==<br />
<br />
=== his.SOD.cTAT ===<br />
<br />
==== Gel ====<br />
<br />
<br />
{|<br />
! well<br />
! sample<br />
|-<br />
| 1<br />
| ladder<br />
|-<br />
| 2<br />
| pSB1C3.his.SOD.cTAT 1<br />
|-<br />
| 3<br />
| pSB1C3.his.SOD.cTAT 2<br />
|-<br />
| 4<br />
| pSB1C3.his.SOD.cTAT 3<br />
|-<br />
| 5<br />
| pSB1C3.his.SOD.cTAT 4<br />
|-<br />
| 6<br />
| pSB1C3.his.SOD.cTAT 5<br />
|-<br />
| 7<br />
| pSB1C3.his.SOD.cTAT 6<br />
|-<br />
| 8<br />
| pSB1C3.his.SOD<br />
|-<br />
| 9<br />
| pEX.SOD<br />
|}<br />
<br />
<br />
<br />
<br />
==== PhastGel ====<br />
<br />
{|<br />
! well<br />
! sample<br />
| rowspan="9" | [[Image:place_for_picture.jpg|200px|thumb|left|]]<br />
|-<br />
| 1<br />
| SOD.his 0h<br />
|-<br />
| 2<br />
| SOD.his 2h 1:1.5<br />
|-<br />
| 3<br />
| his.SOD 0h<br />
|-<br />
| 4<br />
| his.SOD 2h 1:2<br />
|-<br />
| 5<br />
| yCCS 1 2h 1:2<br />
|-<br />
| 6<br />
| ladder<br />
|}<br />
<br />
<br />
<br />
=== pEX.SOD.his ===<br />
<br />
==== Gel ====<br />
<br />
[[Image:2010-09-20_pEX.SOD.jpg|200px|thumb|left|]]<br />
{|<br />
! well<br />
! sample<br />
|-<br />
| 1<br />
| ladder<br />
|-<br />
| 2<br />
| pEX.SOD.his<br />
|-<br />
| 3<br />
| pEX.his.SOD<br />
|-<br />
| 4<br />
| yCCS 1<br />
|-<br />
| 5<br />
| yCCS 2<br />
|}<br />
<br />
*Very weak bands, and in the wrong size...<br />
<br />
==Johan==<br />
<br />
* Cut tyrosinase with NgoMIV & SpeI<br />
<br />
10 µl DNA<br />
<br />
2 µl 10x buffer<br />
<br />
1 µl NgoMIV<br />
<br />
1 µl SpeI<br />
<br />
6 µl H2O<br />
<br />
* Cut bFGF with BamHI<br />
<br />
2 µl DNA <br />
<br />
2 µl 10x buffer<br />
<br />
(1 µl BamHI)<br />
<br />
15 µl H2O<br />
<br />
Did a gel and showed that the bFGF are correct<br />
<br />
* Ligated tyrosinase into pMA (vector with histag)<br />
<br />
1 µl pMA<br />
<br />
2 µl tyrosinase<br />
<br />
2 µl 10x buffer<br />
<br />
1 µl T4 ligase<br />
<br />
14 µl H2O<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/IntroductionTeam:Stockholm/Project Idea/Introduction2010-10-28T01:20:37Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
<br />
{|<br />
|<br />[[image:SU_Planning_Icon.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
<div align="justify"><br />
==Introduction==<br />
Many different ideas were discussed during the startup of our iGEM project. We finally decided to focus on the skin disorder Vitiligo. We have discussed our project idea with two leading Vitiligo researchers in Sweden (Mats J. Olsson & Håkan Hedstrand, Uppsala University), both who have shown interest and encouraged us to go ahead with the project. We have also been given a grant from the [http://www.vitiligoforbundet.se Swedish Vitiligo Association].<br />
<br />
<br />
'''Vitiligo - in short'''<br />
[[Image:Vitiligohands.jpg|right|200px|Vitiligo hands. From Wikipedia, the free encyclopedia. Creative Commons Attribution-Share Alike 3.0 Unported License]]<br />
<br />
Vitiligo is a skin disorder causing affected parts of the skin to turn white. This is due to abnormal melanocyte function, resulting from the immune system mistakenly targeting the pigment cells, making Vitiligo an autoimmune disease. Vitiligo usually begins before the age of 20 and is estimated to affect 0.5-2 % of the world population. It is a very complex disorder and there is a lack of good treatments.<br />
<br />
<br />
'''<br />
== Spot on Treatment ==<br />
'''<br />
<br />
'''iGEM Stockholm on the Vitiligo project <br />
This article is an effort from us in the iGEM Stockholm team to explain our Vitiligo-treatment scientific project in words that anyone can understand, consequently we will keep the scientific explanations on a basic level. <br />
'''<br />
<br />
Our primary goal is to merge current scientific knowledge with an innovative new investigative approach known as Synthetic Biology, in order to hopefully help Vitiligo patients achieve faster and more efficient repigmentation of affected skin in the future. <br />
<br />
'''Background'''<br />
<br />
Vitiligo (leukoderma) is a skin disorder in which pigment cells known as melanocytes are destroyed, resulting in white patches of the skin1. Melanocytes are the cells responsible for creating skin color, so when these are destroyed, the normal shade of the skin turns white. Vitiligo is in itself not dangerous and does not lead to any severe health problems, but patients’ life quality may be seriously altered by the cosmetic appearance that is a result of the white spots from Vitiligo. Between 1-2 percent of the world population are estimated to be affected by Vitiligo, with varying levels of severity. The disorder is characterized by patches occurring on the skin in various parts of the body, hair growing on the patches may also turn white [1]. <br />
<br />
Population surveys have shown that Vitiligo patients first outbreak is seen before the age of 20 in 50 % of the cases, and 70-80 before the age of 30. So it is relatively uncommon with Vitiligo outbreaks in mid-age. Both sexes in adults and children are affected in equal weights; however studies have showed that females contact doctors in a larger number due to greater psychological and social impact [2].<br />
<br />
At first, vitiligo can be thought of as a minor disorder, however the effect on patient’s self-esteem and social interactions can be devastating, especially in patients with darker pigmented skin where the white patches can be more visible. There are two distinguished large sub-sets of vitiligo, called focal/segmental vitiligo and non-segmental vitiligo. The former is characterized by few numbers of small lesions while the second form by an asymmetric distribution of the skin surface. Non-segmental vitiligo is correlated to all generalized, symmetrical forms. The course of the outbreak of the disease is unpredictable with phases of stabilized depigmentation. White vitiligo patches that are in an enlarging manner or the development of new lesions are classified as in an active form of disease [3]. <br />
<br />
Currently three major hypotheses of vitiligo have been proposed. The neural hypothesis implicates an accumulation of a neurochemical substance in the form of a toxin from nerve endings. This damages melanocytes and thus decreases melanin production. The biochemical hypothesis suggests an accumulation of toxic molecules from the synthesis of melanin in melanocytes, the breakdown of antioxidant molecules, and the build-up of large amounts of reactive molecules in pigment cells. Additionally, an autoimmune response in vitiligo patients has been proposed. Studies have demonstrated that vitiligo patients have developed antibodies and an activated immune system destructive against the body’s own pigment cells. Other possible causes of vitiligo have been suggested, including impaired melanocyte migration and/or development [3]. <br />
<br />
It might be that the mentioned factors act independently or together to result in the same effect, which is the disappearance of melanocytes from the skin [3]. <br />
<br />
Our research is divided up into two areas, which are long and short time effect on the skin. The long term research is focusing on both the biochemical and autoimmune hypothesis, which is to result in a repigmentation of white skin patches after a longer time period of treatment. The complementary short term research is based on repigmenting the affected patches in the similar effect of make-up while the long term treatment is under progress. This will be carried out by bacteria producing melanin on the skin, which will be absorbed and result in colored skin. <br />
<br />
'''Our aim'''<br />
<br />
Our research project uses harmless bacteria that, in fact, are already living in the human body as biological machines. These helpful bacteria are designed in our research project to become cost efficient machines to produce molecules that are deficient in vitiligo skin compared to normal skin. The goal with our project, until November 2010, is to obtain a “proof-of-concept” by having our bacteria produce and secrete molecules that we know, through previous research, are in a deficit in vitiligo skin. The lack of these specific molecules is thought to be involved in the impaired and disappeared pigment cells in vitiligo affected skin areas, leading to white spots.<br />
<br />
Currently, there are not any treatments like ours for vitiligo skin. Our idea is to develop a treatment for vitiligo skin, where an ointment with harmless bacteria is to be produced for applying on white patched skin. The bacteria will synthesize and secrete several molecules of interest, which will then target specific inner skin cells with the aim of repigmentation. <br />
<br />
One problem with this type of treatment is that the skin epidermis functions as a very efficient barrier against larger molecules. To help our potentially beneficial molecules reach their destination, we will therefore fuse them to special carrier molecules called cell-penetrating peptides (CPPs). As the name suggests, CPPs are small molecules that have the ability of penetrating into cells, but can in some cases also overcome the skin barrier. By fusing our molecules to such CPPs, we can let them hitch-hike over the skin barrier to the target area.<br />
<br />
With our research we aim to in the future develop a treatment that works faster and more efficient in achieving a repigmentation on affected skin areas compared to current medicine. <br />
</div><br />
<br />
'''References'''<br />
<br />
1. Current remedies for vitiligo Javed Ali et al. Autoimmunity Reviews, 2010 <br />
<br />
2. Vitiligo by Mauro Picardo Springer-Verlag Berlin Heidelberg, 2010<br />
<br />
3. Autoantibody responses to melanocytes in the depigmenting skin disease vitiligo Anthony P. Weetman et al. Autoimmunity Reviews, 2007<br />
<br />
----<br />
<br />
To read more about the "special carrier molecules", also known as '''cell-penetrating peptides''':<br />
<br />
* Happy birthday cell penetrating peptides: Already 20years, Brasseur R, Divita G, Biochim Biophys Acta, 2010 (and references within)<br />
<br />
|-<br />
|colspan="3" align="right"|<br />
<html><br />
<embed <br />
src="https://static.igem.org/mediawiki/2010/3/30/SU_animation_final_version.swf" <br />
width="700"<br />
height="500"<br />
allowscriptaccess="always"<br />
allowfullscreen="true"<br />
/><br />
</html><br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/IntroductionTeam:Stockholm/Project Idea/Introduction2010-10-28T01:19:59Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
<br />
{|<br />
|<br />[[image:SU_Planning_Icon.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
<div align="justify"><br />
==Introduction==<br />
Many different ideas were discussed during the startup of our iGEM project. We finally decided to focus on the skin disorder Vitiligo. We have discussed our project idea with two leading Vitiligo researchers in Sweden (Mats J. Olsson & Håkan Hedstrand, Uppsala University), both who have shown interest and encouraged us to go ahead with the project. We have also been given a grant from the [http://www.vitiligoforbundet.se Swedish Vitiligo Association].<br />
<br />
<br />
'''Vitiligo - in short'''<br />
[[Image:Vitiligohands.jpg|right|200px|Vitiligo hands. From Wikipedia, the free encyclopedia. Creative Commons Attribution-Share Alike 3.0 Unported License]]<br />
<br />
Vitiligo is a skin disorder causing affected parts of the skin to turn white. This is due to abnormal melanocyte function, resulting from the immune system mistakenly targeting the pigment cells, making Vitiligo an autoimmune disease. Vitiligo usually begins before the age of 20 and is estimated to affect 0.5-2 % of the world population. It is a very complex disorder and there is a lack of good treatments.<br />
<br />
<br />
'''<br />
== Spot on Treatment ==<br />
'''<br />
<br />
'''iGEM Stockholm on the Vitiligo project <br />
This article is an effort from us in the iGEM Stockholm team to explain our Vitiligo-treatment scientific project in words that anyone can understand, consequently we will keep the scientific explanations on a basic level. <br />
'''<br />
<br />
Our primary goal is to merge current scientific knowledge with an innovative new investigative approach known as Synthetic Biology, in order to hopefully help Vitiligo patients achieve faster and more efficient repigmentation of affected skin in the future. <br />
<br />
'''Background'''<br />
<br />
Vitiligo (leukoderma) is a skin disorder in which pigment cells known as melanocytes are destroyed, resulting in white patches of the skin1. Melanocytes are the cells responsible for creating skin color, so when these are destroyed, the normal shade of the skin turns white. Vitiligo is in itself not dangerous and does not lead to any severe health problems, but patients’ life quality may be seriously altered by the cosmetic appearance that is a result of the white spots from Vitiligo. Between 1-2 percent of the world population are estimated to be affected by Vitiligo, with varying levels of severity. The disorder is characterized by patches occurring on the skin in various parts of the body, hair growing on the patches may also turn white [1]. <br />
<br />
Population surveys have shown that Vitiligo patients first outbreak is seen before the age of 20 in 50 % of the cases, and 70-80 before the age of 30. So it is relatively uncommon with Vitiligo outbreaks in mid-age. Both sexes in adults and children are affected in equal weights; however studies have showed that females contact doctors in a larger number due to greater psychological and social impact [2].<br />
<br />
At first, vitiligo can be thought of as a minor disorder, however the effect on patient’s self-esteem and social interactions can be devastating, especially in patients with darker pigmented skin where the white patches can be more visible. There are two distinguished large sub-sets of vitiligo, called focal/segmental vitiligo and non-segmental vitiligo. The former is characterized by few numbers of small lesions while the second form by an asymmetric distribution of the skin surface. Non-segmental vitiligo is correlated to all generalized, symmetrical forms. The course of the outbreak of the disease is unpredictable with phases of stabilized depigmentation. White vitiligo patches that are in an enlarging manner or the development of new lesions are classified as in an active form of disease [3]. <br />
<br />
Currently three major hypotheses of vitiligo have been proposed. The neural hypothesis implicates an accumulation of a neurochemical substance in the form of a toxin from nerve endings. This damages melanocytes and thus decreases melanin production. The biochemical hypothesis suggests an accumulation of toxic molecules from the synthesis of melanin in melanocytes, the breakdown of antioxidant molecules, and the build-up of large amounts of reactive molecules in pigment cells. Additionally, an autoimmune response in vitiligo patients has been proposed. Studies have demonstrated that vitiligo patients have developed antibodies and an activated immune system destructive against the body’s own pigment cells. Other possible causes of vitiligo have been suggested, including impaired melanocyte migration and/or development [3]. <br />
<br />
It might be that the mentioned factors act independently or together to result in the same effect, which is the disappearance of melanocytes from the skin [3]. <br />
<br />
Our research is divided up into two areas, which are long and short time effect on the skin. The long term research is focusing on both the biochemical and autoimmune hypothesis, which is to result in a repigmentation of white skin patches after a longer time period of treatment. The complementary short term research is based on repigmenting the affected patches in the similar effect of make-up while the long term treatment is under progress. This will be carried out by bacteria producing melanin on the skin, which will be absorbed and result in colored skin. <br />
<br />
'''Our aim'''<br />
<br />
Our research project uses harmless bacteria that, in fact, are already living in the human body as biological machines. These helpful bacteria are designed in our research project to become cost efficient machines to produce molecules that are deficient in vitiligo skin compared to normal skin. The goal with our project, until November 2010, is to obtain a “proof-of-concept” by having our bacteria produce and secrete molecules that we know, through previous research, are in a deficit in vitiligo skin. The lack of these specific molecules is thought to be involved in the impaired and disappeared pigment cells in vitiligo affected skin areas, leading to white spots.<br />
<br />
Currently, there are not any treatments like ours for vitiligo skin. Our idea is to develop a treatment for vitiligo skin, where an ointment with harmless bacteria is to be produced for applying on white patched skin. The bacteria will synthesize and secrete several molecules of interest, which will then target specific inner skin cells with the aim of repigmentation. <br />
<br />
One problem with this type of treatment is that the skin epidermis functions as a very efficient barrier against larger molecules. To help our potentially beneficial molecules reach their destination, we will therefore fuse them to special carrier molecules called cell-penetrating peptides (CPPs). As the name suggests, CPPs are small molecules that have the ability of penetrating into cells, but can in some cases also overcome the skin barrier. By fusing our molecules to such CPPs, we can let them hitch-hike over the skin barrier to the target area.<br />
<br />
With our research we aim to in the future develop a treatment that works faster and more efficient in achieving a repigmentation on affected skin areas compared to current medicine. <br />
</div><br />
<br />
'''References'''<br />
<br />
1. Current remedies for vitiligo Javed Ali et al. Autoimmunity Reviews, 2010 <br />
<br />
2. Vitiligo by Mauro Picardo Springer-Verlag Berlin Heidelberg, 2010<br />
<br />
3. Autoantibody responses to melanocytes in the depigmenting skin disease vitiligo Anthony P. Weetman et al. Autoimmunity Reviews, 2007<br />
<br />
----<br />
<br />
To read more about the "special carrier molecules", also known as '''cell-penetrating peptides (CPPs)''':<br />
<br />
* Happy birthday cell penetrating peptides: Already 20years, Brasseur R, Divita G, Biochim Biophys Acta, 2010 (and references within)<br />
<br />
|-<br />
|colspan="3" align="right"|<br />
<html><br />
<embed <br />
src="https://static.igem.org/mediawiki/2010/3/30/SU_animation_final_version.swf" <br />
width="700"<br />
height="500"<br />
allowscriptaccess="always"<br />
allowfullscreen="true"<br />
/><br />
</html><br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/ProteinsTeam:Stockholm/Project Idea/Proteins2010-10-28T01:19:04Z<p>JohanNordholm: /* IgG protease (IdeS) */</p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
{| <br />
|[[image:SU_Modeling_Icon_2.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
== Proteins ==<br />
<br />
=== Superoxide dismutase 1 (SOD1) ===<br />
Human soluble Superoxide dismutase 1 (SOD1) is a soluble cytoplasmic protein functional as a homodimer that binds copper and zink ions. SOD1 catalyzes the reaction O<sup>-</sup><sub>2</sub> + O<sup>-</sup><sub>2</sub> + 2H<sup>+</sup> &rarr; H<sub>2</sub>O<sub>2</sub> + O<sub>2</sub>, protecting the cell from oxidative damage. SOD1 was first cloned and expressed in ''Escherichia coli'' by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)]. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:SOD1_dimeric.png|250px]]<br />3D structure of human SOD1 in its dimeric form. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20822138 Leinartaite ''et al''. (2010)]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|465 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nucleotide/38489879?report=genbank&log$=nucltop&blast_rank=22&RID=CAM83NYN01S AY450286.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|154 aa<br />
|-<br />
|'''Size'''<br />
|15,936 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/49456443?report=fasta SOD1]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)].<br />
|}<br />
<br />
<br />
----<br />
<br />
=== Yeast copper chaperon (yCCS) ===<br />
Yeast copper chaperon protein (yCCS) is a helper chaperon specific for copper/zinc superoxide dismutase located to the cytoplasm. yCCS generates fully metallized, active SOD1 proteins that in turn protects the cell from oxidative damage. <br />
<br />
yCCS has been shown to successfully mediate the delivery of copper ions to human SOD1 ([http://www.ncbi.nlm.nih.gov/pubmed/15358352 Ahl ''et al''. 2003]). Co-expression of SOD1 and yCCS yields proteins with higher copper contents, leading to increased activity and more stable proteins. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:YSOD+yCCS_interaction.jpg|250px]]<br />3D structure of yCCS interacting with yeast superoxide dismutase (ySOD) in it's monomeric form. Ions indicated as gray orbs. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/11524675 Lamb ''et al''. 2001]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|750 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nuccore/NM_001182535.1?report=genbank&log$=seqview NM_001182535.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|249 aa<br />
|-<br />
|'''Size'''<br />
|27,330 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/596088?report=fasta yCCS]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/9295278 Culotta ''et al''. (1997)].<br /><br><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Human basic fibroblast growth factor (bFGF) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:BFGF.jpg|250px]]<br />3D structure of bFGF. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20133753 Bae ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|468 bp<br />
|-<br />
|'''GenBank'''<br />
|(full mRNA) [http://www.ncbi.nlm.nih.gov/nuccore/153285460 153285460]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|155 aa<br />
|-<br />
|'''Size'''<br />
|17,353 Da<br />
|-<br />
|'''Fasta'''<br /><br><br><br><br><br />
|[http://www.ncbi.nlm.nih.gov/protein/153285461?report=fasta bFGF]<br /><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Protein A, z domain ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Genepart <br />
|rowspan="10" width="250"|[[Image:ProteinA_z_domain.jpg|250px]]<br />3D structure of the Z-domain of Protein A. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/9325113 Tashiro ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|174 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/2859152 2859152] (full protein)<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|58 aa <br />
(508 aa, full protein )<br />
|-<br />
|'''Size'''<br />
|55,439 Da (full protein)<br />
|-<br />
|'''Fasta'''<br /><br><br><br><br><br><br />
|[http://www.uniprot.org/uniprot/P38507.fasta Protein A] (full protein)<br /><br><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== IgG protease (IdeS) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:IdeS.jpg|250px]]<br />Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/15574492 Wenig ''et al''. 2004]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|930 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/6985687 6985687]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|339 aa<br />
|-<br />
|'''Size'''<br />
|37,977 Da<br />
|-<br />
|'''Fasta'''<br /><br><br><br><br><br><br />
|[http://www.ncbi.nlm.nih.gov/protein/209559219?report=fasta IdeS]<br /><br><br><br><br><br><br />
|}<br />
<br />
<br />
<br />
----<br />
<br />
== Cell penetrating peptides ==<br />
<br />
These cell-penetrating peptides, (CPPs) may be used in N- and C-terminal fusions with full-length proteins to create transduction proteins with the ability to permeate the lipid bilayer of various cell types, making them potential gene or protein delivery vectors.<br />
<br />
<br />
=== TAT cell penetrating peptide (TAT) ===<br />
Purified full-length TAT fusion proteins expressed in ''Escherichia coli'' have been shown to successfully translocate into several human cell types, including all cells found in whole blood, as well as bone marrow stem cells and osteoblasts, while still retaining the fused protein's activity ([http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). The mechanism for transduction over the bilipid membrane is still a matter of debate, but has been suggested to occur through macropinocytosis, a specialized form of endocytosis ([http://www.ncbi.nlm.nih.gov/pubmed/17913584 Gump and Dowdy, 2007]).<br />
TAT is an 11-amino acid derivative from the Human Immunodeficiency Virus 1 (HIV-1) ''trans''-activating transcriptional activator (Tat) ([http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green and Loewenstein, 1988]; [http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|33 bp<br />
|-<br />
|'''Patent PCT'''<br />
|[http://v3.espacenet.com/publicationDetails/biblio;jsessionid=646EDA06997EDDFC0CC04CCE49F87F6B.espacenet_levelx_prod_5?CC=WO&NR=2005084158A2&KC=A2&FT=D&date=20050915&DB=EPODOC&locale=se_se WO 2005/084158 A2]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|11 aa<br />
|-<br />
|'''Size'''<br />
|1,560 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|YGRKKRRQRRR<br />
|-<br />
|colspan="2"|First reported by <br />
[http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green ''et al''. (1988)] and [http://www.ncbi.nlm.nih.gov/pubmed/2849510 Frankel ''et al''. (1988)]<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Low molecular weight protamine (LMWP) ===<br />
Enzymatically prepared LMWP chemically conjugated to ovalbumin (OVA) and bovine serum albumin (BSA) have previously been shown to penetrate the lipid bilayer of human keratinocytes, as well as to successfully permeate mouse skin epidermis ([http://www.ncbi.nlm.nih.gov/pubmed/20232417 Huang ''et al.'', 2010]). Furthermore, LMWP/pDNA complexes can efficiently penetrate into human embryonic kidney cells ([http://www.ncbi.nlm.nih.gov/pubmed/12898639 Park ''et al.'', 2003]). As LMWP has been shown to be neither toxic nor immunogenic ([http://www.ncbi.nlm.nih.gov/pubmed/11741268 Chang ''et al.'' a, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741269 Chang ''et al.'' b, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741270 Lee ''et al.'', 2001]), it may be used as a potential vaccine, drug or gene delivery vector.<br />
LMWP is a 14-amino acid derivative from Rainbow trout (''Oncorhynchus mykiss'') protamine, an arginine-rich protein that replaces histones in chromatin during spermatogenesis ([http://www.ncbi.nlm.nih.gov/pubmed/3755398 McKay ''et al.'', 1986]; [http://www.ncbi.nlm.nih.gov/pubmed/10213181 Byun ''et al.'', 1999]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|42 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2007/0071677.html 20070071677]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|14 aa<br />
|-<br />
|'''Size'''<br />
|1,880 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|VSRRRRRRGGRRRR<br />
|-<br />
|colspan="2"|Patent application by Park et al. (2004)<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Transportan 10 (Tp10) ===<br />
Chemically synthesized Tp10 peptides conjugated to different cargo, including pDNA and protein, have been shown to efficiently penetrate the lipid bilayer of both human and mouse cells ([http://www.ncbi.nlm.nih.gov/pubmed/15763630 Kilk ''et al.'', 2005]). Membrane permeation is both energy and temperature independent ([http://www.ncbi.nlm.nih.gov/pubmed/11718666 H&auml;llbrink ''et al.'', 2001]). The exact mechanism for penetration is still unclear ([http://www.ncbi.nlm.nih.gov/pubmed/17218466 Yandek ''et al.'', 2007]).<br />
Tp10 is a 21-amino acid derivative from the parent peptide transportan (originally known as galparan), which is a peptide chimera of the neuropeptide galanin and the wasp venom peptide mastoparan ([http://www.ncbi.nlm.nih.gov/pubmed/10930519 Soomets ''et al.'', 2000]; [http://www.ncbi.nlm.nih.gov/pubmed/8738882 Langel ''et al.'', 1996]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|rowspan="8" width="250"|[[Image:Transportan.jpg|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|63 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2008/0234183.html 20080234183]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|21 aa<br />
|-<br />
|'''Size'''<br />
|2,183 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|AGYLLGKINLKALAALAKKIL<br />
|-<br />
|colspan="2"|Patent application by Hallbrink et al. (2003)<br /><br />
|}<br />
<br />
<!--|-<br />
|rowspan="8" width="250"|[[Image:Tp10_prediction.png|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]--><br />
----<br />
<br />
|}<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/ProteinsTeam:Stockholm/Project Idea/Proteins2010-10-28T01:18:25Z<p>JohanNordholm: /* Protein A, z domain */</p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
{| <br />
|[[image:SU_Modeling_Icon_2.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
== Proteins ==<br />
<br />
=== Superoxide dismutase 1 (SOD1) ===<br />
Human soluble Superoxide dismutase 1 (SOD1) is a soluble cytoplasmic protein functional as a homodimer that binds copper and zink ions. SOD1 catalyzes the reaction O<sup>-</sup><sub>2</sub> + O<sup>-</sup><sub>2</sub> + 2H<sup>+</sup> &rarr; H<sub>2</sub>O<sub>2</sub> + O<sub>2</sub>, protecting the cell from oxidative damage. SOD1 was first cloned and expressed in ''Escherichia coli'' by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)]. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:SOD1_dimeric.png|250px]]<br />3D structure of human SOD1 in its dimeric form. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20822138 Leinartaite ''et al''. (2010)]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|465 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nucleotide/38489879?report=genbank&log$=nucltop&blast_rank=22&RID=CAM83NYN01S AY450286.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|154 aa<br />
|-<br />
|'''Size'''<br />
|15,936 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/49456443?report=fasta SOD1]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)].<br />
|}<br />
<br />
<br />
----<br />
<br />
=== Yeast copper chaperon (yCCS) ===<br />
Yeast copper chaperon protein (yCCS) is a helper chaperon specific for copper/zinc superoxide dismutase located to the cytoplasm. yCCS generates fully metallized, active SOD1 proteins that in turn protects the cell from oxidative damage. <br />
<br />
yCCS has been shown to successfully mediate the delivery of copper ions to human SOD1 ([http://www.ncbi.nlm.nih.gov/pubmed/15358352 Ahl ''et al''. 2003]). Co-expression of SOD1 and yCCS yields proteins with higher copper contents, leading to increased activity and more stable proteins. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:YSOD+yCCS_interaction.jpg|250px]]<br />3D structure of yCCS interacting with yeast superoxide dismutase (ySOD) in it's monomeric form. Ions indicated as gray orbs. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/11524675 Lamb ''et al''. 2001]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|750 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nuccore/NM_001182535.1?report=genbank&log$=seqview NM_001182535.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|249 aa<br />
|-<br />
|'''Size'''<br />
|27,330 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/596088?report=fasta yCCS]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/9295278 Culotta ''et al''. (1997)].<br /><br><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Human basic fibroblast growth factor (bFGF) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:BFGF.jpg|250px]]<br />3D structure of bFGF. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20133753 Bae ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|468 bp<br />
|-<br />
|'''GenBank'''<br />
|(full mRNA) [http://www.ncbi.nlm.nih.gov/nuccore/153285460 153285460]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|155 aa<br />
|-<br />
|'''Size'''<br />
|17,353 Da<br />
|-<br />
|'''Fasta'''<br /><br><br><br><br><br />
|[http://www.ncbi.nlm.nih.gov/protein/153285461?report=fasta bFGF]<br /><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Protein A, z domain ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Genepart <br />
|rowspan="10" width="250"|[[Image:ProteinA_z_domain.jpg|250px]]<br />3D structure of the Z-domain of Protein A. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/9325113 Tashiro ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|174 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/2859152 2859152] (full protein)<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|58 aa <br />
(508 aa, full protein )<br />
|-<br />
|'''Size'''<br />
|55,439 Da (full protein)<br />
|-<br />
|'''Fasta'''<br /><br><br><br><br><br><br />
|[http://www.uniprot.org/uniprot/P38507.fasta Protein A] (full protein)<br /><br><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== IgG protease (IdeS) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:IdeS.jpg|250px]]<br />Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/15574492 Wenig ''et al''. 2004]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|930 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/6985687 6985687]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|339 aa<br />
|-<br />
|'''Size'''<br />
|37,977 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/209559219?report=fasta IdeS]<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
<br />
----<br />
<br />
== Cell penetrating peptides ==<br />
<br />
These cell-penetrating peptides, (CPPs) may be used in N- and C-terminal fusions with full-length proteins to create transduction proteins with the ability to permeate the lipid bilayer of various cell types, making them potential gene or protein delivery vectors.<br />
<br />
<br />
=== TAT cell penetrating peptide (TAT) ===<br />
Purified full-length TAT fusion proteins expressed in ''Escherichia coli'' have been shown to successfully translocate into several human cell types, including all cells found in whole blood, as well as bone marrow stem cells and osteoblasts, while still retaining the fused protein's activity ([http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). The mechanism for transduction over the bilipid membrane is still a matter of debate, but has been suggested to occur through macropinocytosis, a specialized form of endocytosis ([http://www.ncbi.nlm.nih.gov/pubmed/17913584 Gump and Dowdy, 2007]).<br />
TAT is an 11-amino acid derivative from the Human Immunodeficiency Virus 1 (HIV-1) ''trans''-activating transcriptional activator (Tat) ([http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green and Loewenstein, 1988]; [http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|33 bp<br />
|-<br />
|'''Patent PCT'''<br />
|[http://v3.espacenet.com/publicationDetails/biblio;jsessionid=646EDA06997EDDFC0CC04CCE49F87F6B.espacenet_levelx_prod_5?CC=WO&NR=2005084158A2&KC=A2&FT=D&date=20050915&DB=EPODOC&locale=se_se WO 2005/084158 A2]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|11 aa<br />
|-<br />
|'''Size'''<br />
|1,560 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|YGRKKRRQRRR<br />
|-<br />
|colspan="2"|First reported by <br />
[http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green ''et al''. (1988)] and [http://www.ncbi.nlm.nih.gov/pubmed/2849510 Frankel ''et al''. (1988)]<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Low molecular weight protamine (LMWP) ===<br />
Enzymatically prepared LMWP chemically conjugated to ovalbumin (OVA) and bovine serum albumin (BSA) have previously been shown to penetrate the lipid bilayer of human keratinocytes, as well as to successfully permeate mouse skin epidermis ([http://www.ncbi.nlm.nih.gov/pubmed/20232417 Huang ''et al.'', 2010]). Furthermore, LMWP/pDNA complexes can efficiently penetrate into human embryonic kidney cells ([http://www.ncbi.nlm.nih.gov/pubmed/12898639 Park ''et al.'', 2003]). As LMWP has been shown to be neither toxic nor immunogenic ([http://www.ncbi.nlm.nih.gov/pubmed/11741268 Chang ''et al.'' a, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741269 Chang ''et al.'' b, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741270 Lee ''et al.'', 2001]), it may be used as a potential vaccine, drug or gene delivery vector.<br />
LMWP is a 14-amino acid derivative from Rainbow trout (''Oncorhynchus mykiss'') protamine, an arginine-rich protein that replaces histones in chromatin during spermatogenesis ([http://www.ncbi.nlm.nih.gov/pubmed/3755398 McKay ''et al.'', 1986]; [http://www.ncbi.nlm.nih.gov/pubmed/10213181 Byun ''et al.'', 1999]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|42 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2007/0071677.html 20070071677]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|14 aa<br />
|-<br />
|'''Size'''<br />
|1,880 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|VSRRRRRRGGRRRR<br />
|-<br />
|colspan="2"|Patent application by Park et al. (2004)<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Transportan 10 (Tp10) ===<br />
Chemically synthesized Tp10 peptides conjugated to different cargo, including pDNA and protein, have been shown to efficiently penetrate the lipid bilayer of both human and mouse cells ([http://www.ncbi.nlm.nih.gov/pubmed/15763630 Kilk ''et al.'', 2005]). Membrane permeation is both energy and temperature independent ([http://www.ncbi.nlm.nih.gov/pubmed/11718666 H&auml;llbrink ''et al.'', 2001]). The exact mechanism for penetration is still unclear ([http://www.ncbi.nlm.nih.gov/pubmed/17218466 Yandek ''et al.'', 2007]).<br />
Tp10 is a 21-amino acid derivative from the parent peptide transportan (originally known as galparan), which is a peptide chimera of the neuropeptide galanin and the wasp venom peptide mastoparan ([http://www.ncbi.nlm.nih.gov/pubmed/10930519 Soomets ''et al.'', 2000]; [http://www.ncbi.nlm.nih.gov/pubmed/8738882 Langel ''et al.'', 1996]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|rowspan="8" width="250"|[[Image:Transportan.jpg|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|63 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2008/0234183.html 20080234183]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|21 aa<br />
|-<br />
|'''Size'''<br />
|2,183 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|AGYLLGKINLKALAALAKKIL<br />
|-<br />
|colspan="2"|Patent application by Hallbrink et al. (2003)<br /><br />
|}<br />
<br />
<!--|-<br />
|rowspan="8" width="250"|[[Image:Tp10_prediction.png|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]--><br />
----<br />
<br />
|}<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/ProteinsTeam:Stockholm/Project Idea/Proteins2010-10-28T01:18:08Z<p>JohanNordholm: /* Protein A, z domain */</p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
{| <br />
|[[image:SU_Modeling_Icon_2.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
== Proteins ==<br />
<br />
=== Superoxide dismutase 1 (SOD1) ===<br />
Human soluble Superoxide dismutase 1 (SOD1) is a soluble cytoplasmic protein functional as a homodimer that binds copper and zink ions. SOD1 catalyzes the reaction O<sup>-</sup><sub>2</sub> + O<sup>-</sup><sub>2</sub> + 2H<sup>+</sup> &rarr; H<sub>2</sub>O<sub>2</sub> + O<sub>2</sub>, protecting the cell from oxidative damage. SOD1 was first cloned and expressed in ''Escherichia coli'' by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)]. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:SOD1_dimeric.png|250px]]<br />3D structure of human SOD1 in its dimeric form. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20822138 Leinartaite ''et al''. (2010)]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|465 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nucleotide/38489879?report=genbank&log$=nucltop&blast_rank=22&RID=CAM83NYN01S AY450286.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|154 aa<br />
|-<br />
|'''Size'''<br />
|15,936 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/49456443?report=fasta SOD1]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)].<br />
|}<br />
<br />
<br />
----<br />
<br />
=== Yeast copper chaperon (yCCS) ===<br />
Yeast copper chaperon protein (yCCS) is a helper chaperon specific for copper/zinc superoxide dismutase located to the cytoplasm. yCCS generates fully metallized, active SOD1 proteins that in turn protects the cell from oxidative damage. <br />
<br />
yCCS has been shown to successfully mediate the delivery of copper ions to human SOD1 ([http://www.ncbi.nlm.nih.gov/pubmed/15358352 Ahl ''et al''. 2003]). Co-expression of SOD1 and yCCS yields proteins with higher copper contents, leading to increased activity and more stable proteins. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:YSOD+yCCS_interaction.jpg|250px]]<br />3D structure of yCCS interacting with yeast superoxide dismutase (ySOD) in it's monomeric form. Ions indicated as gray orbs. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/11524675 Lamb ''et al''. 2001]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|750 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nuccore/NM_001182535.1?report=genbank&log$=seqview NM_001182535.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|249 aa<br />
|-<br />
|'''Size'''<br />
|27,330 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/596088?report=fasta yCCS]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/9295278 Culotta ''et al''. (1997)].<br /><br><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Human basic fibroblast growth factor (bFGF) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:BFGF.jpg|250px]]<br />3D structure of bFGF. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20133753 Bae ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|468 bp<br />
|-<br />
|'''GenBank'''<br />
|(full mRNA) [http://www.ncbi.nlm.nih.gov/nuccore/153285460 153285460]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|155 aa<br />
|-<br />
|'''Size'''<br />
|17,353 Da<br />
|-<br />
|'''Fasta'''<br /><br><br><br><br><br />
|[http://www.ncbi.nlm.nih.gov/protein/153285461?report=fasta bFGF]<br /><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Protein A, z domain ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Genepart <br />
|rowspan="10" width="250"|[[Image:ProteinA_z_domain.jpg|250px]]<br />3D structure of the Z-domain of Protein A. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/9325113 Tashiro ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|174 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/2859152 2859152] (full protein)<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|58 aa <br />
(508 aa, full protein )<br />
|-<br />
|'''Size'''<br />
|55,439 Da (full protein)<br />
|-<br />
|'''Fasta'''<br /><br><br><br><br><br />
|[http://www.uniprot.org/uniprot/P38507.fasta Protein A] (full protein)<br /><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== IgG protease (IdeS) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:IdeS.jpg|250px]]<br />Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/15574492 Wenig ''et al''. 2004]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|930 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/6985687 6985687]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|339 aa<br />
|-<br />
|'''Size'''<br />
|37,977 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/209559219?report=fasta IdeS]<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
<br />
----<br />
<br />
== Cell penetrating peptides ==<br />
<br />
These cell-penetrating peptides, (CPPs) may be used in N- and C-terminal fusions with full-length proteins to create transduction proteins with the ability to permeate the lipid bilayer of various cell types, making them potential gene or protein delivery vectors.<br />
<br />
<br />
=== TAT cell penetrating peptide (TAT) ===<br />
Purified full-length TAT fusion proteins expressed in ''Escherichia coli'' have been shown to successfully translocate into several human cell types, including all cells found in whole blood, as well as bone marrow stem cells and osteoblasts, while still retaining the fused protein's activity ([http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). The mechanism for transduction over the bilipid membrane is still a matter of debate, but has been suggested to occur through macropinocytosis, a specialized form of endocytosis ([http://www.ncbi.nlm.nih.gov/pubmed/17913584 Gump and Dowdy, 2007]).<br />
TAT is an 11-amino acid derivative from the Human Immunodeficiency Virus 1 (HIV-1) ''trans''-activating transcriptional activator (Tat) ([http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green and Loewenstein, 1988]; [http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|33 bp<br />
|-<br />
|'''Patent PCT'''<br />
|[http://v3.espacenet.com/publicationDetails/biblio;jsessionid=646EDA06997EDDFC0CC04CCE49F87F6B.espacenet_levelx_prod_5?CC=WO&NR=2005084158A2&KC=A2&FT=D&date=20050915&DB=EPODOC&locale=se_se WO 2005/084158 A2]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|11 aa<br />
|-<br />
|'''Size'''<br />
|1,560 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|YGRKKRRQRRR<br />
|-<br />
|colspan="2"|First reported by <br />
[http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green ''et al''. (1988)] and [http://www.ncbi.nlm.nih.gov/pubmed/2849510 Frankel ''et al''. (1988)]<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Low molecular weight protamine (LMWP) ===<br />
Enzymatically prepared LMWP chemically conjugated to ovalbumin (OVA) and bovine serum albumin (BSA) have previously been shown to penetrate the lipid bilayer of human keratinocytes, as well as to successfully permeate mouse skin epidermis ([http://www.ncbi.nlm.nih.gov/pubmed/20232417 Huang ''et al.'', 2010]). Furthermore, LMWP/pDNA complexes can efficiently penetrate into human embryonic kidney cells ([http://www.ncbi.nlm.nih.gov/pubmed/12898639 Park ''et al.'', 2003]). As LMWP has been shown to be neither toxic nor immunogenic ([http://www.ncbi.nlm.nih.gov/pubmed/11741268 Chang ''et al.'' a, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741269 Chang ''et al.'' b, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741270 Lee ''et al.'', 2001]), it may be used as a potential vaccine, drug or gene delivery vector.<br />
LMWP is a 14-amino acid derivative from Rainbow trout (''Oncorhynchus mykiss'') protamine, an arginine-rich protein that replaces histones in chromatin during spermatogenesis ([http://www.ncbi.nlm.nih.gov/pubmed/3755398 McKay ''et al.'', 1986]; [http://www.ncbi.nlm.nih.gov/pubmed/10213181 Byun ''et al.'', 1999]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|42 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2007/0071677.html 20070071677]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|14 aa<br />
|-<br />
|'''Size'''<br />
|1,880 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|VSRRRRRRGGRRRR<br />
|-<br />
|colspan="2"|Patent application by Park et al. (2004)<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Transportan 10 (Tp10) ===<br />
Chemically synthesized Tp10 peptides conjugated to different cargo, including pDNA and protein, have been shown to efficiently penetrate the lipid bilayer of both human and mouse cells ([http://www.ncbi.nlm.nih.gov/pubmed/15763630 Kilk ''et al.'', 2005]). Membrane permeation is both energy and temperature independent ([http://www.ncbi.nlm.nih.gov/pubmed/11718666 H&auml;llbrink ''et al.'', 2001]). The exact mechanism for penetration is still unclear ([http://www.ncbi.nlm.nih.gov/pubmed/17218466 Yandek ''et al.'', 2007]).<br />
Tp10 is a 21-amino acid derivative from the parent peptide transportan (originally known as galparan), which is a peptide chimera of the neuropeptide galanin and the wasp venom peptide mastoparan ([http://www.ncbi.nlm.nih.gov/pubmed/10930519 Soomets ''et al.'', 2000]; [http://www.ncbi.nlm.nih.gov/pubmed/8738882 Langel ''et al.'', 1996]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|rowspan="8" width="250"|[[Image:Transportan.jpg|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|63 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2008/0234183.html 20080234183]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|21 aa<br />
|-<br />
|'''Size'''<br />
|2,183 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|AGYLLGKINLKALAALAKKIL<br />
|-<br />
|colspan="2"|Patent application by Hallbrink et al. (2003)<br /><br />
|}<br />
<br />
<!--|-<br />
|rowspan="8" width="250"|[[Image:Tp10_prediction.png|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]--><br />
----<br />
<br />
|}<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/ProteinsTeam:Stockholm/Project Idea/Proteins2010-10-28T01:17:03Z<p>JohanNordholm: /* Human basic fibroblast growth factor (bFGF) */</p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
{| <br />
|[[image:SU_Modeling_Icon_2.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
== Proteins ==<br />
<br />
=== Superoxide dismutase 1 (SOD1) ===<br />
Human soluble Superoxide dismutase 1 (SOD1) is a soluble cytoplasmic protein functional as a homodimer that binds copper and zink ions. SOD1 catalyzes the reaction O<sup>-</sup><sub>2</sub> + O<sup>-</sup><sub>2</sub> + 2H<sup>+</sup> &rarr; H<sub>2</sub>O<sub>2</sub> + O<sub>2</sub>, protecting the cell from oxidative damage. SOD1 was first cloned and expressed in ''Escherichia coli'' by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)]. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:SOD1_dimeric.png|250px]]<br />3D structure of human SOD1 in its dimeric form. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20822138 Leinartaite ''et al''. (2010)]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|465 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nucleotide/38489879?report=genbank&log$=nucltop&blast_rank=22&RID=CAM83NYN01S AY450286.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|154 aa<br />
|-<br />
|'''Size'''<br />
|15,936 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/49456443?report=fasta SOD1]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)].<br />
|}<br />
<br />
<br />
----<br />
<br />
=== Yeast copper chaperon (yCCS) ===<br />
Yeast copper chaperon protein (yCCS) is a helper chaperon specific for copper/zinc superoxide dismutase located to the cytoplasm. yCCS generates fully metallized, active SOD1 proteins that in turn protects the cell from oxidative damage. <br />
<br />
yCCS has been shown to successfully mediate the delivery of copper ions to human SOD1 ([http://www.ncbi.nlm.nih.gov/pubmed/15358352 Ahl ''et al''. 2003]). Co-expression of SOD1 and yCCS yields proteins with higher copper contents, leading to increased activity and more stable proteins. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:YSOD+yCCS_interaction.jpg|250px]]<br />3D structure of yCCS interacting with yeast superoxide dismutase (ySOD) in it's monomeric form. Ions indicated as gray orbs. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/11524675 Lamb ''et al''. 2001]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|750 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nuccore/NM_001182535.1?report=genbank&log$=seqview NM_001182535.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|249 aa<br />
|-<br />
|'''Size'''<br />
|27,330 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/596088?report=fasta yCCS]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/9295278 Culotta ''et al''. (1997)].<br /><br><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Human basic fibroblast growth factor (bFGF) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:BFGF.jpg|250px]]<br />3D structure of bFGF. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20133753 Bae ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|468 bp<br />
|-<br />
|'''GenBank'''<br />
|(full mRNA) [http://www.ncbi.nlm.nih.gov/nuccore/153285460 153285460]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|155 aa<br />
|-<br />
|'''Size'''<br />
|17,353 Da<br />
|-<br />
|'''Fasta'''<br /><br><br><br><br><br />
|[http://www.ncbi.nlm.nih.gov/protein/153285461?report=fasta bFGF]<br /><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Protein A, z domain ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Genepart <br />
|rowspan="10" width="250"|[[Image:ProteinA_z_domain.jpg|250px]]<br />3D structure of the Z-domain of Protein A. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/9325113 Tashiro ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|174 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/2859152 2859152] (full protein)<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|58 aa <br />
(508 aa, full protein )<br />
|-<br />
|'''Size'''<br />
|55,439 Da (full protein)<br />
|-<br />
|'''Fasta'''<br />
|[http://www.uniprot.org/uniprot/P38507.fasta Protein A] (full protein)<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== IgG protease (IdeS) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:IdeS.jpg|250px]]<br />Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/15574492 Wenig ''et al''. 2004]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|930 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/6985687 6985687]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|339 aa<br />
|-<br />
|'''Size'''<br />
|37,977 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/209559219?report=fasta IdeS]<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
<br />
----<br />
<br />
== Cell penetrating peptides ==<br />
<br />
These cell-penetrating peptides, (CPPs) may be used in N- and C-terminal fusions with full-length proteins to create transduction proteins with the ability to permeate the lipid bilayer of various cell types, making them potential gene or protein delivery vectors.<br />
<br />
<br />
=== TAT cell penetrating peptide (TAT) ===<br />
Purified full-length TAT fusion proteins expressed in ''Escherichia coli'' have been shown to successfully translocate into several human cell types, including all cells found in whole blood, as well as bone marrow stem cells and osteoblasts, while still retaining the fused protein's activity ([http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). The mechanism for transduction over the bilipid membrane is still a matter of debate, but has been suggested to occur through macropinocytosis, a specialized form of endocytosis ([http://www.ncbi.nlm.nih.gov/pubmed/17913584 Gump and Dowdy, 2007]).<br />
TAT is an 11-amino acid derivative from the Human Immunodeficiency Virus 1 (HIV-1) ''trans''-activating transcriptional activator (Tat) ([http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green and Loewenstein, 1988]; [http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|33 bp<br />
|-<br />
|'''Patent PCT'''<br />
|[http://v3.espacenet.com/publicationDetails/biblio;jsessionid=646EDA06997EDDFC0CC04CCE49F87F6B.espacenet_levelx_prod_5?CC=WO&NR=2005084158A2&KC=A2&FT=D&date=20050915&DB=EPODOC&locale=se_se WO 2005/084158 A2]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|11 aa<br />
|-<br />
|'''Size'''<br />
|1,560 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|YGRKKRRQRRR<br />
|-<br />
|colspan="2"|First reported by <br />
[http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green ''et al''. (1988)] and [http://www.ncbi.nlm.nih.gov/pubmed/2849510 Frankel ''et al''. (1988)]<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Low molecular weight protamine (LMWP) ===<br />
Enzymatically prepared LMWP chemically conjugated to ovalbumin (OVA) and bovine serum albumin (BSA) have previously been shown to penetrate the lipid bilayer of human keratinocytes, as well as to successfully permeate mouse skin epidermis ([http://www.ncbi.nlm.nih.gov/pubmed/20232417 Huang ''et al.'', 2010]). Furthermore, LMWP/pDNA complexes can efficiently penetrate into human embryonic kidney cells ([http://www.ncbi.nlm.nih.gov/pubmed/12898639 Park ''et al.'', 2003]). As LMWP has been shown to be neither toxic nor immunogenic ([http://www.ncbi.nlm.nih.gov/pubmed/11741268 Chang ''et al.'' a, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741269 Chang ''et al.'' b, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741270 Lee ''et al.'', 2001]), it may be used as a potential vaccine, drug or gene delivery vector.<br />
LMWP is a 14-amino acid derivative from Rainbow trout (''Oncorhynchus mykiss'') protamine, an arginine-rich protein that replaces histones in chromatin during spermatogenesis ([http://www.ncbi.nlm.nih.gov/pubmed/3755398 McKay ''et al.'', 1986]; [http://www.ncbi.nlm.nih.gov/pubmed/10213181 Byun ''et al.'', 1999]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|42 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2007/0071677.html 20070071677]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|14 aa<br />
|-<br />
|'''Size'''<br />
|1,880 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|VSRRRRRRGGRRRR<br />
|-<br />
|colspan="2"|Patent application by Park et al. (2004)<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Transportan 10 (Tp10) ===<br />
Chemically synthesized Tp10 peptides conjugated to different cargo, including pDNA and protein, have been shown to efficiently penetrate the lipid bilayer of both human and mouse cells ([http://www.ncbi.nlm.nih.gov/pubmed/15763630 Kilk ''et al.'', 2005]). Membrane permeation is both energy and temperature independent ([http://www.ncbi.nlm.nih.gov/pubmed/11718666 H&auml;llbrink ''et al.'', 2001]). The exact mechanism for penetration is still unclear ([http://www.ncbi.nlm.nih.gov/pubmed/17218466 Yandek ''et al.'', 2007]).<br />
Tp10 is a 21-amino acid derivative from the parent peptide transportan (originally known as galparan), which is a peptide chimera of the neuropeptide galanin and the wasp venom peptide mastoparan ([http://www.ncbi.nlm.nih.gov/pubmed/10930519 Soomets ''et al.'', 2000]; [http://www.ncbi.nlm.nih.gov/pubmed/8738882 Langel ''et al.'', 1996]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|rowspan="8" width="250"|[[Image:Transportan.jpg|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|63 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2008/0234183.html 20080234183]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|21 aa<br />
|-<br />
|'''Size'''<br />
|2,183 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|AGYLLGKINLKALAALAKKIL<br />
|-<br />
|colspan="2"|Patent application by Hallbrink et al. (2003)<br /><br />
|}<br />
<br />
<!--|-<br />
|rowspan="8" width="250"|[[Image:Tp10_prediction.png|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]--><br />
----<br />
<br />
|}<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/ProteinsTeam:Stockholm/Project Idea/Proteins2010-10-28T01:12:10Z<p>JohanNordholm: /* Yeast copper chaperon (yCCS) */</p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
{| <br />
|[[image:SU_Modeling_Icon_2.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
== Proteins ==<br />
<br />
=== Superoxide dismutase 1 (SOD1) ===<br />
Human soluble Superoxide dismutase 1 (SOD1) is a soluble cytoplasmic protein functional as a homodimer that binds copper and zink ions. SOD1 catalyzes the reaction O<sup>-</sup><sub>2</sub> + O<sup>-</sup><sub>2</sub> + 2H<sup>+</sup> &rarr; H<sub>2</sub>O<sub>2</sub> + O<sub>2</sub>, protecting the cell from oxidative damage. SOD1 was first cloned and expressed in ''Escherichia coli'' by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)]. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:SOD1_dimeric.png|250px]]<br />3D structure of human SOD1 in its dimeric form. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20822138 Leinartaite ''et al''. (2010)]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|465 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nucleotide/38489879?report=genbank&log$=nucltop&blast_rank=22&RID=CAM83NYN01S AY450286.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|154 aa<br />
|-<br />
|'''Size'''<br />
|15,936 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/49456443?report=fasta SOD1]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)].<br />
|}<br />
<br />
<br />
----<br />
<br />
=== Yeast copper chaperon (yCCS) ===<br />
Yeast copper chaperon protein (yCCS) is a helper chaperon specific for copper/zinc superoxide dismutase located to the cytoplasm. yCCS generates fully metallized, active SOD1 proteins that in turn protects the cell from oxidative damage. <br />
<br />
yCCS has been shown to successfully mediate the delivery of copper ions to human SOD1 ([http://www.ncbi.nlm.nih.gov/pubmed/15358352 Ahl ''et al''. 2003]). Co-expression of SOD1 and yCCS yields proteins with higher copper contents, leading to increased activity and more stable proteins. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:YSOD+yCCS_interaction.jpg|250px]]<br />3D structure of yCCS interacting with yeast superoxide dismutase (ySOD) in it's monomeric form. Ions indicated as gray orbs. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/11524675 Lamb ''et al''. 2001]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|750 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nuccore/NM_001182535.1?report=genbank&log$=seqview NM_001182535.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|249 aa<br />
|-<br />
|'''Size'''<br />
|27,330 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/596088?report=fasta yCCS]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/9295278 Culotta ''et al''. (1997)].<br /><br><br><br><br><br><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Human basic fibroblast growth factor (bFGF) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:BFGF.jpg|250px]]<br />3D structure of bFGF. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20133753 Bae ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|468 bp<br />
|-<br />
|'''GenBank'''<br />
|(full mRNA) [http://www.ncbi.nlm.nih.gov/nuccore/153285460 153285460]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|155 aa<br />
|-<br />
|'''Size'''<br />
|17,353 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/153285461?report=fasta bFGF]<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Protein A, z domain ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Genepart <br />
|rowspan="10" width="250"|[[Image:ProteinA_z_domain.jpg|250px]]<br />3D structure of the Z-domain of Protein A. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/9325113 Tashiro ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|174 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/2859152 2859152] (full protein)<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|58 aa <br />
(508 aa, full protein )<br />
|-<br />
|'''Size'''<br />
|55,439 Da (full protein)<br />
|-<br />
|'''Fasta'''<br />
|[http://www.uniprot.org/uniprot/P38507.fasta Protein A] (full protein)<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== IgG protease (IdeS) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:IdeS.jpg|250px]]<br />Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/15574492 Wenig ''et al''. 2004]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|930 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/6985687 6985687]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|339 aa<br />
|-<br />
|'''Size'''<br />
|37,977 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/209559219?report=fasta IdeS]<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
<br />
----<br />
<br />
== Cell penetrating peptides ==<br />
<br />
These cell-penetrating peptides, (CPPs) may be used in N- and C-terminal fusions with full-length proteins to create transduction proteins with the ability to permeate the lipid bilayer of various cell types, making them potential gene or protein delivery vectors.<br />
<br />
<br />
=== TAT cell penetrating peptide (TAT) ===<br />
Purified full-length TAT fusion proteins expressed in ''Escherichia coli'' have been shown to successfully translocate into several human cell types, including all cells found in whole blood, as well as bone marrow stem cells and osteoblasts, while still retaining the fused protein's activity ([http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). The mechanism for transduction over the bilipid membrane is still a matter of debate, but has been suggested to occur through macropinocytosis, a specialized form of endocytosis ([http://www.ncbi.nlm.nih.gov/pubmed/17913584 Gump and Dowdy, 2007]).<br />
TAT is an 11-amino acid derivative from the Human Immunodeficiency Virus 1 (HIV-1) ''trans''-activating transcriptional activator (Tat) ([http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green and Loewenstein, 1988]; [http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|33 bp<br />
|-<br />
|'''Patent PCT'''<br />
|[http://v3.espacenet.com/publicationDetails/biblio;jsessionid=646EDA06997EDDFC0CC04CCE49F87F6B.espacenet_levelx_prod_5?CC=WO&NR=2005084158A2&KC=A2&FT=D&date=20050915&DB=EPODOC&locale=se_se WO 2005/084158 A2]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|11 aa<br />
|-<br />
|'''Size'''<br />
|1,560 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|YGRKKRRQRRR<br />
|-<br />
|colspan="2"|First reported by <br />
[http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green ''et al''. (1988)] and [http://www.ncbi.nlm.nih.gov/pubmed/2849510 Frankel ''et al''. (1988)]<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Low molecular weight protamine (LMWP) ===<br />
Enzymatically prepared LMWP chemically conjugated to ovalbumin (OVA) and bovine serum albumin (BSA) have previously been shown to penetrate the lipid bilayer of human keratinocytes, as well as to successfully permeate mouse skin epidermis ([http://www.ncbi.nlm.nih.gov/pubmed/20232417 Huang ''et al.'', 2010]). Furthermore, LMWP/pDNA complexes can efficiently penetrate into human embryonic kidney cells ([http://www.ncbi.nlm.nih.gov/pubmed/12898639 Park ''et al.'', 2003]). As LMWP has been shown to be neither toxic nor immunogenic ([http://www.ncbi.nlm.nih.gov/pubmed/11741268 Chang ''et al.'' a, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741269 Chang ''et al.'' b, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741270 Lee ''et al.'', 2001]), it may be used as a potential vaccine, drug or gene delivery vector.<br />
LMWP is a 14-amino acid derivative from Rainbow trout (''Oncorhynchus mykiss'') protamine, an arginine-rich protein that replaces histones in chromatin during spermatogenesis ([http://www.ncbi.nlm.nih.gov/pubmed/3755398 McKay ''et al.'', 1986]; [http://www.ncbi.nlm.nih.gov/pubmed/10213181 Byun ''et al.'', 1999]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|42 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2007/0071677.html 20070071677]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|14 aa<br />
|-<br />
|'''Size'''<br />
|1,880 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|VSRRRRRRGGRRRR<br />
|-<br />
|colspan="2"|Patent application by Park et al. (2004)<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Transportan 10 (Tp10) ===<br />
Chemically synthesized Tp10 peptides conjugated to different cargo, including pDNA and protein, have been shown to efficiently penetrate the lipid bilayer of both human and mouse cells ([http://www.ncbi.nlm.nih.gov/pubmed/15763630 Kilk ''et al.'', 2005]). Membrane permeation is both energy and temperature independent ([http://www.ncbi.nlm.nih.gov/pubmed/11718666 H&auml;llbrink ''et al.'', 2001]). The exact mechanism for penetration is still unclear ([http://www.ncbi.nlm.nih.gov/pubmed/17218466 Yandek ''et al.'', 2007]).<br />
Tp10 is a 21-amino acid derivative from the parent peptide transportan (originally known as galparan), which is a peptide chimera of the neuropeptide galanin and the wasp venom peptide mastoparan ([http://www.ncbi.nlm.nih.gov/pubmed/10930519 Soomets ''et al.'', 2000]; [http://www.ncbi.nlm.nih.gov/pubmed/8738882 Langel ''et al.'', 1996]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|rowspan="8" width="250"|[[Image:Transportan.jpg|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|63 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2008/0234183.html 20080234183]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|21 aa<br />
|-<br />
|'''Size'''<br />
|2,183 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|AGYLLGKINLKALAALAKKIL<br />
|-<br />
|colspan="2"|Patent application by Hallbrink et al. (2003)<br /><br />
|}<br />
<br />
<!--|-<br />
|rowspan="8" width="250"|[[Image:Tp10_prediction.png|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]--><br />
----<br />
<br />
|}<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/ProteinsTeam:Stockholm/Project Idea/Proteins2010-10-28T01:09:55Z<p>JohanNordholm: /* Cell penetrating peptides */</p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
{| <br />
|[[image:SU_Modeling_Icon_2.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
== Proteins ==<br />
<br />
=== Superoxide dismutase 1 (SOD1) ===<br />
Human soluble Superoxide dismutase 1 (SOD1) is a soluble cytoplasmic protein functional as a homodimer that binds copper and zink ions. SOD1 catalyzes the reaction O<sup>-</sup><sub>2</sub> + O<sup>-</sup><sub>2</sub> + 2H<sup>+</sup> &rarr; H<sub>2</sub>O<sub>2</sub> + O<sub>2</sub>, protecting the cell from oxidative damage. SOD1 was first cloned and expressed in ''Escherichia coli'' by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)]. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:SOD1_dimeric.png|250px]]<br />3D structure of human SOD1 in its dimeric form. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20822138 Leinartaite ''et al''. (2010)]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|465 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nucleotide/38489879?report=genbank&log$=nucltop&blast_rank=22&RID=CAM83NYN01S AY450286.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|154 aa<br />
|-<br />
|'''Size'''<br />
|15,936 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/49456443?report=fasta SOD1]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)].<br />
|}<br />
<br />
<br />
----<br />
<br />
=== Yeast copper chaperon (yCCS) ===<br />
Yeast copper chaperon protein (yCCS) is a helper chaperon specific for copper/zinc superoxide dismutase located to the cytoplasm. yCCS generates fully metallized, active SOD1 proteins that in turn protects the cell from oxidative damage. <br />
<br />
yCCS has been shown to successfully mediate the delivery of copper ions to human SOD1 ([http://www.ncbi.nlm.nih.gov/pubmed/15358352 Ahl ''et al''. 2003]). Co-expression of SOD1 and yCCS yields proteins with higher copper contents, leading to increased activity and more stable proteins. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:YSOD+yCCS_interaction.jpg|250px]]<br />3D structure of yCCS interacting with yeast superoxide dismutase (ySOD) in it's monomeric form. Ions indicated as gray orbs. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/11524675 Lamb ''et al''. 2001]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|750 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nuccore/NM_001182535.1?report=genbank&log$=seqview NM_001182535.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|249 aa<br />
|-<br />
|'''Size'''<br />
|27,330 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/596088?report=fasta yCCS]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/9295278 Culotta ''et al''. (1997)].<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Human basic fibroblast growth factor (bFGF) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:BFGF.jpg|250px]]<br />3D structure of bFGF. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20133753 Bae ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|468 bp<br />
|-<br />
|'''GenBank'''<br />
|(full mRNA) [http://www.ncbi.nlm.nih.gov/nuccore/153285460 153285460]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|155 aa<br />
|-<br />
|'''Size'''<br />
|17,353 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/153285461?report=fasta bFGF]<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Protein A, z domain ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Genepart <br />
|rowspan="10" width="250"|[[Image:ProteinA_z_domain.jpg|250px]]<br />3D structure of the Z-domain of Protein A. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/9325113 Tashiro ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|174 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/2859152 2859152] (full protein)<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|58 aa <br />
(508 aa, full protein )<br />
|-<br />
|'''Size'''<br />
|55,439 Da (full protein)<br />
|-<br />
|'''Fasta'''<br />
|[http://www.uniprot.org/uniprot/P38507.fasta Protein A] (full protein)<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== IgG protease (IdeS) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:IdeS.jpg|250px]]<br />Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/15574492 Wenig ''et al''. 2004]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|930 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/6985687 6985687]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|339 aa<br />
|-<br />
|'''Size'''<br />
|37,977 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/209559219?report=fasta IdeS]<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
<br />
----<br />
<br />
== Cell penetrating peptides ==<br />
<br />
These cell-penetrating peptides, (CPPs) may be used in N- and C-terminal fusions with full-length proteins to create transduction proteins with the ability to permeate the lipid bilayer of various cell types, making them potential gene or protein delivery vectors.<br />
<br />
<br />
=== TAT cell penetrating peptide (TAT) ===<br />
Purified full-length TAT fusion proteins expressed in ''Escherichia coli'' have been shown to successfully translocate into several human cell types, including all cells found in whole blood, as well as bone marrow stem cells and osteoblasts, while still retaining the fused protein's activity ([http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). The mechanism for transduction over the bilipid membrane is still a matter of debate, but has been suggested to occur through macropinocytosis, a specialized form of endocytosis ([http://www.ncbi.nlm.nih.gov/pubmed/17913584 Gump and Dowdy, 2007]).<br />
TAT is an 11-amino acid derivative from the Human Immunodeficiency Virus 1 (HIV-1) ''trans''-activating transcriptional activator (Tat) ([http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green and Loewenstein, 1988]; [http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|33 bp<br />
|-<br />
|'''Patent PCT'''<br />
|[http://v3.espacenet.com/publicationDetails/biblio;jsessionid=646EDA06997EDDFC0CC04CCE49F87F6B.espacenet_levelx_prod_5?CC=WO&NR=2005084158A2&KC=A2&FT=D&date=20050915&DB=EPODOC&locale=se_se WO 2005/084158 A2]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|11 aa<br />
|-<br />
|'''Size'''<br />
|1,560 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|YGRKKRRQRRR<br />
|-<br />
|colspan="2"|First reported by <br />
[http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green ''et al''. (1988)] and [http://www.ncbi.nlm.nih.gov/pubmed/2849510 Frankel ''et al''. (1988)]<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Low molecular weight protamine (LMWP) ===<br />
Enzymatically prepared LMWP chemically conjugated to ovalbumin (OVA) and bovine serum albumin (BSA) have previously been shown to penetrate the lipid bilayer of human keratinocytes, as well as to successfully permeate mouse skin epidermis ([http://www.ncbi.nlm.nih.gov/pubmed/20232417 Huang ''et al.'', 2010]). Furthermore, LMWP/pDNA complexes can efficiently penetrate into human embryonic kidney cells ([http://www.ncbi.nlm.nih.gov/pubmed/12898639 Park ''et al.'', 2003]). As LMWP has been shown to be neither toxic nor immunogenic ([http://www.ncbi.nlm.nih.gov/pubmed/11741268 Chang ''et al.'' a, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741269 Chang ''et al.'' b, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741270 Lee ''et al.'', 2001]), it may be used as a potential vaccine, drug or gene delivery vector.<br />
LMWP is a 14-amino acid derivative from Rainbow trout (''Oncorhynchus mykiss'') protamine, an arginine-rich protein that replaces histones in chromatin during spermatogenesis ([http://www.ncbi.nlm.nih.gov/pubmed/3755398 McKay ''et al.'', 1986]; [http://www.ncbi.nlm.nih.gov/pubmed/10213181 Byun ''et al.'', 1999]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|42 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2007/0071677.html 20070071677]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|14 aa<br />
|-<br />
|'''Size'''<br />
|1,880 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|VSRRRRRRGGRRRR<br />
|-<br />
|colspan="2"|Patent application by Park et al. (2004)<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Transportan 10 (Tp10) ===<br />
Chemically synthesized Tp10 peptides conjugated to different cargo, including pDNA and protein, have been shown to efficiently penetrate the lipid bilayer of both human and mouse cells ([http://www.ncbi.nlm.nih.gov/pubmed/15763630 Kilk ''et al.'', 2005]). Membrane permeation is both energy and temperature independent ([http://www.ncbi.nlm.nih.gov/pubmed/11718666 H&auml;llbrink ''et al.'', 2001]). The exact mechanism for penetration is still unclear ([http://www.ncbi.nlm.nih.gov/pubmed/17218466 Yandek ''et al.'', 2007]).<br />
Tp10 is a 21-amino acid derivative from the parent peptide transportan (originally known as galparan), which is a peptide chimera of the neuropeptide galanin and the wasp venom peptide mastoparan ([http://www.ncbi.nlm.nih.gov/pubmed/10930519 Soomets ''et al.'', 2000]; [http://www.ncbi.nlm.nih.gov/pubmed/8738882 Langel ''et al.'', 1996]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|rowspan="8" width="250"|[[Image:Transportan.jpg|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|63 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2008/0234183.html 20080234183]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|21 aa<br />
|-<br />
|'''Size'''<br />
|2,183 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|AGYLLGKINLKALAALAKKIL<br />
|-<br />
|colspan="2"|Patent application by Hallbrink et al. (2003)<br /><br />
|}<br />
<br />
<!--|-<br />
|rowspan="8" width="250"|[[Image:Tp10_prediction.png|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]--><br />
----<br />
<br />
|}<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/ProteinsTeam:Stockholm/Project Idea/Proteins2010-10-28T01:02:53Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
{| <br />
|[[image:SU_Modeling_Icon_2.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
== Proteins ==<br />
<br />
=== Superoxide dismutase 1 (SOD1) ===<br />
Human soluble Superoxide dismutase 1 (SOD1) is a soluble cytoplasmic protein functional as a homodimer that binds copper and zink ions. SOD1 catalyzes the reaction O<sup>-</sup><sub>2</sub> + O<sup>-</sup><sub>2</sub> + 2H<sup>+</sup> &rarr; H<sub>2</sub>O<sub>2</sub> + O<sub>2</sub>, protecting the cell from oxidative damage. SOD1 was first cloned and expressed in ''Escherichia coli'' by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)]. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:SOD1_dimeric.png|250px]]<br />3D structure of human SOD1 in its dimeric form. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20822138 Leinartaite ''et al''. (2010)]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|465 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nucleotide/38489879?report=genbank&log$=nucltop&blast_rank=22&RID=CAM83NYN01S AY450286.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|154 aa<br />
|-<br />
|'''Size'''<br />
|15,936 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/49456443?report=fasta SOD1]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ''et al''., (1985)].<br />
|}<br />
<br />
<br />
----<br />
<br />
=== Yeast copper chaperon (yCCS) ===<br />
Yeast copper chaperon protein (yCCS) is a helper chaperon specific for copper/zinc superoxide dismutase located to the cytoplasm. yCCS generates fully metallized, active SOD1 proteins that in turn protects the cell from oxidative damage. <br />
<br />
yCCS has been shown to successfully mediate the delivery of copper ions to human SOD1 ([http://www.ncbi.nlm.nih.gov/pubmed/15358352 Ahl ''et al''. 2003]). Co-expression of SOD1 and yCCS yields proteins with higher copper contents, leading to increased activity and more stable proteins. <br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:YSOD+yCCS_interaction.jpg|250px]]<br />3D structure of yCCS interacting with yeast superoxide dismutase (ySOD) in it's monomeric form. Ions indicated as gray orbs. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/11524675 Lamb ''et al''. 2001]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|750 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/nuccore/NM_001182535.1?report=genbank&log$=seqview NM_001182535.1]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|249 aa<br />
|-<br />
|'''Size'''<br />
|27,330 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/596088?report=fasta yCCS]<br /><br />
|-<br />
|colspan="2"|First reported by [http://www.ncbi.nlm.nih.gov/pubmed/9295278 Culotta ''et al''. (1997)].<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Human basic fibroblast growth factor (bFGF) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:BFGF.jpg|250px]]<br />3D structure of bFGF. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/20133753 Bae ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|468 bp<br />
|-<br />
|'''GenBank'''<br />
|(full mRNA) [http://www.ncbi.nlm.nih.gov/nuccore/153285460 153285460]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|155 aa<br />
|-<br />
|'''Size'''<br />
|17,353 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/153285461?report=fasta bFGF]<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Protein A, z domain ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Genepart <br />
|rowspan="10" width="250"|[[Image:ProteinA_z_domain.jpg|250px]]<br />3D structure of the Z-domain of Protein A. Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/9325113 Tashiro ''et al''. 2010]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|174 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/2859152 2859152] (full protein)<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|58 aa <br />
(508 aa, full protein )<br />
|-<br />
|'''Size'''<br />
|55,439 Da (full protein)<br />
|-<br />
|'''Fasta'''<br />
|[http://www.uniprot.org/uniprot/P38507.fasta Protein A] (full protein)<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== IgG protease (IdeS) ===<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Gene (cDNA) <br />
|rowspan="10" width="250"|[[Image:IdeS.jpg|250px]]<br />Primary citation [http://www.ncbi.nlm.nih.gov/pubmed/15574492 Wenig ''et al''. 2004]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|930 bp<br />
|-<br />
|'''GenBank'''<br />
|[http://www.ncbi.nlm.nih.gov/gene/6985687 6985687]<br /><br />
|-<br />
!colspan="2"|Protein<br />
|-<br />
|'''Length'''<br />
|339 aa<br />
|-<br />
|'''Size'''<br />
|37,977 Da<br />
|-<br />
|'''Fasta'''<br />
|[http://www.ncbi.nlm.nih.gov/protein/209559219?report=fasta IdeS]<br /><br />
|-<br />
|colspan="2"|First reported by <unknown><br /><br />
|}<br />
<br />
<br />
<br />
----<br />
<br />
== Cell penetrating peptides ==<br />
<br />
This cell-penetrating peptides, (CPPs) may be used in N- and C-terminal fusions with full-length proteins to create transduction proteins with the ability to permeate the lipid bilayer of various cell types, making it a potential gene or protein delivery vector.<br />
<br />
<br />
=== TAT cell penetrating peptide (TAT) ===<br />
Purified full-length TAT fusion proteins expressed in ''Escherichia coli'' have been shown to successfully translocate into several human cell types, including all cells found in whole blood, as well as bone marrow stem cells and osteoblasts, while still retaining the fused protein's activity ([http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). The mechanism for transduction over the bilipid membrane is still a matter of debate, but has been suggested to occur through macropinocytosis, a specialized form of endocytosis ([http://www.ncbi.nlm.nih.gov/pubmed/17913584 Gump and Dowdy, 2007]).<br />
TAT is an 11-amino acid derivative from the Human Immunodeficiency Virus 1 (HIV-1) ''trans''-activating transcriptional activator (Tat) ([http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green and Loewenstein, 1988]; [http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|33 bp<br />
|-<br />
|'''Patent PCT'''<br />
|[http://v3.espacenet.com/publicationDetails/biblio;jsessionid=646EDA06997EDDFC0CC04CCE49F87F6B.espacenet_levelx_prod_5?CC=WO&NR=2005084158A2&KC=A2&FT=D&date=20050915&DB=EPODOC&locale=se_se WO 2005/084158 A2]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|11 aa<br />
|-<br />
|'''Size'''<br />
|1,560 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|YGRKKRRQRRR<br />
|-<br />
|colspan="2"|First reported by <br />
[http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green ''et al''. (1988)] and [http://www.ncbi.nlm.nih.gov/pubmed/2849510 Frankel ''et al''. (1988)]<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Low molecular weight protamine (LMWP) ===<br />
Enzymatically prepared LMWP chemically conjugated to ovalbumin (OVA) and bovine serum albumin (BSA) have previously been shown to penetrate the lipid bilayer of human keratinocytes, as well as to successfully permeate mouse skin epidermis ([http://www.ncbi.nlm.nih.gov/pubmed/20232417 Huang ''et al.'', 2010]). Furthermore, LMWP/pDNA complexes can efficiently penetrate into human embryonic kidney cells ([http://www.ncbi.nlm.nih.gov/pubmed/12898639 Park ''et al.'', 2003]). As LMWP has been shown to be neither toxic nor immunogenic ([http://www.ncbi.nlm.nih.gov/pubmed/11741268 Chang ''et al.'' a, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741269 Chang ''et al.'' b, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741270 Lee ''et al.'', 2001]), it may be used as a potential vaccine, drug or gene delivery vector.<br />
LMWP is a 14-amino acid derivative from Rainbow trout (''Oncorhynchus mykiss'') protamine, an arginine-rich protein that replaces histones in chromatin during spermatogenesis ([http://www.ncbi.nlm.nih.gov/pubmed/3755398 McKay ''et al.'', 1986]; [http://www.ncbi.nlm.nih.gov/pubmed/10213181 Byun ''et al.'', 1999]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|42 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2007/0071677.html 20070071677]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|14 aa<br />
|-<br />
|'''Size'''<br />
|1,880 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|VSRRRRRRGGRRRR<br />
|-<br />
|colspan="2"|Patent application by Park et al. (2004)<br /><br />
|}<br />
<br />
<br />
----<br />
<br />
=== Transportan 10 (Tp10) ===<br />
Chemically synthesized Tp10 peptides conjugated to different cargo, including pDNA and protein, have been shown to efficiently penetrate the lipid bilayer of both human and mouse cells ([http://www.ncbi.nlm.nih.gov/pubmed/15763630 Kilk ''et al.'', 2005]). Membrane permeation is both energy and temperature independent ([http://www.ncbi.nlm.nih.gov/pubmed/11718666 H&auml;llbrink ''et al.'', 2001]). The exact mechanism for penetration is still unclear ([http://www.ncbi.nlm.nih.gov/pubmed/17218466 Yandek ''et al.'', 2007]).<br />
Tp10 is a 21-amino acid derivative from the parent peptide transportan (originally known as galparan), which is a peptide chimera of the neuropeptide galanin and the wasp venom peptide mastoparan ([http://www.ncbi.nlm.nih.gov/pubmed/10930519 Soomets ''et al.'', 2000]; [http://www.ncbi.nlm.nih.gov/pubmed/8738882 Langel ''et al.'', 1996]). This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis.<br />
<br />
{|border="1" align="center" cellpadding="3" cellspacing="0"<br />
!colspan="2"|Sequence <br />
|rowspan="8" width="250"|[[Image:Transportan.jpg|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]<br />
|-<br />
|width="130"|'''Length'''<br />
|width="130"|63 bp<br />
|-<br />
|'''Patent Application'''<br />
|[http://www.freepatentsonline.com/y2008/0234183.html 20080234183]<br /><br />
|-<br />
!colspan="2"|Peptide<br />
|-<br />
|'''Length'''<br />
|21 aa<br />
|-<br />
|'''Size'''<br />
|2,183 Da ([http://www.scripps.edu/~cdputnam/protcalc.html calculated])<br />
|-<br />
|colspan="2" align="center"|AGYLLGKINLKALAALAKKIL<br />
|-<br />
|colspan="2"|Patent application by Hallbrink et al. (2003)<br /><br />
|}<br />
<br />
<!--|-<br />
|rowspan="8" width="250"|[[Image:Tp10_prediction.png|250px]]<br />3D structure of transportan<br /> [http://www.dbb.su.se/Faculty/Lena_M%C3%A4ler/Structural_basis_for_peptide-membrane_interactions www.dbb.su.se]--><br />
----<br />
<br />
|}<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Results/BioBricksTeam:Stockholm/Results/BioBricks2010-10-28T00:24:18Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Results}}<br />
{|width="800px"<br />
|<br />
{|align="right"<br />
| width="300"| __TOC__ <br />
|}<br />
==BioBricks==<br />
===''Trans''-Activating Transcriptional Activator (TAT)===<br />
<br />
====[http://partsregistry.org/Part:BBa_K380000 BBa_K380000]: Standard part====<br />
[[image:TAT_BioBrick.png]]<br />
<br />
:'''Part name:''' TAT cell-penetrating peptide<br /><br />
:'''Property:''' Cell-penetrating peptide ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Media:Cpp1 premix.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
<br /><br />
<br />
====[http://partsregistry.org/Part:BBa_K380001 BBa_K380001]: N-part====<br />
[[image:NTAT_BioBrick.png]]<br />
<br />
:'''Part name:''' N-part TAT cell-penetrating peptide<br /><br />
:'''Property:''' Cell-penetrating peptide ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Media:PSB1C3.nCCP_12_premix.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
<br />
<br /><br />
----<br />
<br /><br />
<br />
===Low Molecular Weight Protamine (LMWP)===<br />
<br />
====[http://partsregistry.org/Part:BBa_K380002 BBa_K380002]: Standard part)====<br />
[[image:LMWP_BioBrick.png]]<br />
<br />
:'''Part name:''' LMWP cell-penetrating peptide<br /><br />
:'''Property:''' Cell-penetrating peptide ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Media:Cpp2 premix.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
<br /><br />
<br />
====[http://partsregistry.org/Part:BBa_K380003 BBa_K380003]: N-part====<br />
[[image:nLMWP_BioBrick.png]]<br />
<br />
:'''Part name:''' N-part LMWP cell-penetrating peptide<br /><br />
:'''Property:''' Cell-penetrating peptide ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Media:PSB1C3.nCCP_11_premix.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
<br />
<br /><br />
----<br />
<br /><br />
<br />
===Transportan 10 (Tp10)===<br />
<br />
====[http://partsregistry.org/Part:BBa_K380004 BBa_K380004]: Standard part====<br />
[[image:Tp10_BioBrick.png]]<br />
<br />
:'''Part name:''' Tp10 cell-penetrating peptide<br /><br />
:'''Property:''' Cell-penetrating peptide ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Cpp12 premix.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
<br /><br />
<br />
====[http://partsregistry.org/Part:BBa_K380005 BBa_K380005]: N-part====<br />
[[image:nTp10_BioBrick.png]]<br />
<br />
:'''Part name:''' N-part Tp10 cell-penetrating peptide<br /><br />
:'''Property:''' Cell-penetrating peptide ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Media:PSB1C3.nCCP_5_premix.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
<br />
<br /><br />
----<br />
<br /><br />
<br />
===[http://partsregistry.org/Part:BBa_K380006 BBa_K380006]: Human Basic Fibroblast Growth Factor (bFGF)===<br />
[[image:BFGF_BioBrick.png]]<br />
<br />
:'''Part name:''' Human basic fibroblast growth factor, bFGF<br /><br />
:'''Property:''' Growth factor ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Media:PSB1C3.bFGF_VR_premix_fasta.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
<br />
<br /><br />
----<br />
<br /><br />
<br />
===[http://partsregistry.org/Part:BBa_K380007 BBa_K380007]: Superoxide dismutase 1 (SOD1)===<br />
[[image:SOD1_BioBrick.png]]<br />
<br />
:'''Part name:''' Superoxide dismutase 1 protein<br /><br />
:'''Property:''' Catalyzes the reaction O<sup>-</sup><sub>2</sub> + O<sup>-</sup><sub>2</sub> + 2H<sup>+</sup> → H<sub>2</sub>O<sub>2</sub> + O<sub>2</sub> ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Media:PSB1C3.SOD_VR_premix_fasta.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
<br />
<br /><br />
----<br />
<br /><br />
<br />
===[http://partsregistry.org/Part:BBa_K380008 BBa_K380008]: Yeast Copper Chaperone (yCCS)===<br />
[[image:YCCS_BioBrick.png]]<br />
<br />
:'''Part name:''' Yeast copper chaperone protein<br /><br />
:'''Property:''' Mediates the delivery of copper ions to SOD1 ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Media:PSB1C3.yCCS_VR_premix_fasta.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
<br />
<br /><br />
----<br />
<br /><br />
<br />
===[http://partsregistry.org/Part:BBa_K380009 BBa_K380009]: Protein A Z-domain (PtA-Z)===<br />
[[image:ProteinA_BioBrick.png]]<br />
<br />
:'''Part name:''' protein A<br /><br />
:'''Property:''' - ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Media:PSB1C3.ProtA VR premix fasta.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
<br />
<br /><br />
----<br />
<br /><br />
<br />
===[http://partsregistry.org/Part:BBa_K380010 BBa_K380010]: Immunoglobulin G protease (IdeS)===<br />
[[image:IdeS_BioBrick.png]]<br />
<br />
:'''Part name:''' igg protease<br /><br />
:'''Property:''' - ([[Team:Stockholm/Project Idea/Proteins|more]])<br /><br />
:'''Sequenced:''' <span style="color:green;">Yes</span> ([[Media:PSB1C3.IgGp_VR_premix_fasta.txt|fasta]])<br /><br />
:'''Works:''' <span style="color:red;">Not known</span><br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/File:Cpp12_premix.txtFile:Cpp12 premix.txt2010-10-28T00:22:35Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/File:Cpp2_premix.txtFile:Cpp2 premix.txt2010-10-28T00:20:14Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/File:Cpp1_premix.txtFile:Cpp1 premix.txt2010-10-28T00:19:14Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/IntroductionTeam:Stockholm/Project Idea/Introduction2010-10-28T00:00:48Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
<br />
{|<br />
|<br />[[image:SU_Planning_Icon.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
<div align="justify"><br />
==Introduction==<br />
Many different ideas were discussed during the startup of our iGEM project. We finally decided to focus on the skin disorder Vitiligo. We have discussed our project idea with two leading Vitiligo researchers in Sweden (Mats J. Olsson & Håkan Hedstrand, Uppsala University), both who have shown interest and encouraged us to go ahead with the project. We have also been given a grant from the [http://www.vitiligoforbundet.se Swedish Vitiligo Association].<br />
<br />
<br />
'''Vitiligo - in short'''<br />
[[Image:Vitiligohands.jpg|right|200px|Vitiligo hands. From Wikipedia, the free encyclopedia. Creative Commons Attribution-Share Alike 3.0 Unported License]]<br />
<br />
Vitiligo is a skin disorder causing affected parts of the skin to turn white. This is due to abnormal melanocyte function, resulting from the immune system mistakenly targeting the pigment cells, making Vitiligo an autoimmune disease. Vitiligo usually begins before the age of 20 and is estimated to affect 0.5-2 % of the world population. It is a very complex disorder and there is a lack of good treatments.<br />
<br />
<br />
'''<br />
== Spot on Treatment ==<br />
'''<br />
<br />
'''iGEM Stockholm on the Vitiligo project <br />
This article is an effort from us in the iGEM Stockholm team to explain our Vitiligo-treatment scientific project in words that anyone can understand, consequently we will keep the scientific explanations on a basic level. <br />
'''<br />
<br />
Our primary goal is to merge current scientific knowledge with an innovative new investigative approach known as Synthetic Biology, in order to hopefully help Vitiligo patients achieve faster and more efficient repigmentation of affected skin in the future. <br />
<br />
'''Background'''<br />
<br />
Vitiligo (leukoderma) is a skin disorder in which pigment cells known as melanocytes are destroyed, resulting in white patches of the skin1. Melanocytes are the cells responsible for creating skin color, so when these are destroyed, the normal shade of the skin turns white. Vitiligo is in itself not dangerous and does not lead to any severe health problems, but patients’ life quality may be seriously altered by the cosmetic appearance that is a result of the white spots from Vitiligo. Between 1-2 percent of the world population are estimated to be affected by Vitiligo, with varying levels of severity. The disorder is characterized by patches occurring on the skin in various parts of the body, hair growing on the patches may also turn white [1]. <br />
<br />
Population surveys have shown that Vitiligo patients first outbreak is seen before the age of 20 in 50 % of the cases, and 70-80 before the age of 30. So it is relatively uncommon with Vitiligo outbreaks in mid-age. Both sexes in adults and children are affected in equal weights; however studies have showed that females contact doctors in a larger number due to greater psychological and social impact [2].<br />
<br />
At first, vitiligo can be thought of as a minor disorder, however the effect on patient’s self-esteem and social interactions can be devastating, especially in patients with darker pigmented skin where the white patches can be more visible. There are two distinguished large sub-sets of vitiligo, called focal/segmental vitiligo and non-segmental vitiligo. The former is characterized by few numbers of small lesions while the second form by an asymmetric distribution of the skin surface. Non-segmental vitiligo is correlated to all generalized, symmetrical forms. The course of the outbreak of the disease is unpredictable with phases of stabilized depigmentation. White vitiligo patches that are in an enlarging manner or the development of new lesions are classified as in an active form of disease [3]. <br />
<br />
Currently three major hypotheses of vitiligo have been proposed. The neural hypothesis implicates an accumulation of a neurochemical substance in the form of a toxin from nerve endings. This damages melanocytes and thus decreases melanin production. The biochemical hypothesis suggests an accumulation of toxic molecules from the synthesis of melanin in melanocytes, the breakdown of antioxidant molecules, and the build-up of large amounts of reactive molecules in pigment cells. Additionally, an autoimmune response in vitiligo patients has been proposed. Studies have demonstrated that vitiligo patients have developed antibodies and an activated immune system destructive against the body’s own pigment cells. Other possible causes of vitiligo have been suggested, including impaired melanocyte migration and/or development [3]. <br />
<br />
It might be that the mentioned factors act independently or together to result in the same effect, which is the disappearance of melanocytes from the skin [3]. <br />
<br />
Our research is divided up into two areas, which are long and short time effect on the skin. The long term research is focusing on both the biochemical and autoimmune hypothesis, which is to result in a repigmentation of white skin patches after a longer time period of treatment. The complementary short term research is based on repigmenting the affected patches in the similar effect of make-up while the long term treatment is under progress. This will be carried out by bacteria producing melanin on the skin, which will be absorbed and result in colored skin. <br />
<br />
'''Our aim'''<br />
<br />
Our research project uses harmless bacteria that, in fact, are already living in the human body as biological machines. These helpful bacteria are designed in our research project to become cost efficient machines to produce molecules that are deficient in vitiligo skin compared to normal skin. The goal with our project, until November 2010, is to obtain a “proof-of-concept” by having our bacteria produce and secrete molecules that we know, through previous research, are in a deficit in vitiligo skin. The lack of these specific molecules is thought to be involved in the impaired and disappeared pigment cells in vitiligo affected skin areas, leading to white spots.<br />
<br />
Currently, there are not any treatments like ours for vitiligo skin. Our idea is to develop a treatment for vitiligo skin, where an ointment with harmless bacteria is to be produced for applying on white patched skin. The bacteria will synthesize and secrete several molecules of interest; these will be carried with a special carrier molecule through the outermost layer of the skin and further down to target specific inner skin cells with the aim of repigmentation. <br />
<br />
With our research we aim to in the future develop a treatment that works faster and more efficient in achieving a repigmentation on affected skin areas compared to current medicine. <br />
</div><br />
<br />
'''References'''<br />
<br />
1. Current remedies for vitiligo Javed Ali et al. Autoimmunity Reviews, 2010 <br />
<br />
2. Vitiligo by Mauro Picardo Springer-Verlag Berlin Heidelberg, 2010<br />
<br />
3. Autoantibody responses to melanocytes in the depigmenting skin disease vitiligo Anthony P. Weetman et al. Autoimmunity Reviews, 2007<br />
<br />
----<br />
<br />
To read more about the "special carrier molecules", also known as '''cell-penetrating peptides (cpp)''':<br />
<br />
* Happy birthday cell penetrating peptides: Already 20years, Brasseur R, Divita G, Biochim Biophys Acta, 2010 (and references within)<br />
<br />
|-<br />
|colspan="3" align="right"|<br />
<html><br />
<embed <br />
src="https://static.igem.org/mediawiki/2010/3/30/SU_animation_final_version.swf" <br />
width="700"<br />
height="500"<br />
allowscriptaccess="always"<br />
allowfullscreen="true"<br />
/><br />
</html><br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Project_Idea/IntroductionTeam:Stockholm/Project Idea/Introduction2010-10-27T23:45:05Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Project_Idea}}<br />
<br />
{|<br />
|<br />[[image:SU_Planning_Icon.gif|200px]]<br />
|width="10px"|&nbsp;<br />
|width="590px"|<br />
<div align="justify"><br />
==Introduction==<br />
Many different ideas were discussed during the startup of our iGEM project. We finally decided to focus on the skin disorder Vitiligo. We have discussed our project idea with two leading Vitiligo researchers in Sweden (Mats J. Olsson & Håkan Hedstrand, Uppsala University), both who have shown interest and encouraged us to go ahead with the project. We have also been given a grant from the [http://www.vitiligoforbundet.se Swedish Vitiligo Association].<br />
<br />
<br />
'''Vitiligo - in short'''<br />
[[Image:Vitiligohands.jpg|right|200px|Vitiligo hands. From Wikipedia, the free encyclopedia. Creative Commons Attribution-Share Alike 3.0 Unported License]]<br />
<br />
Vitiligo is a skin disorder causing affected parts of the skin to turn white. This is due to abnormal melanocyte function, resulting from the immune system mistakenly targeting the pigment cells, making Vitiligo an autoimmune disease. Vitiligo usually begins before the age of 20 and is estimated to affect 0.5-2 % of the world population. It is a very complex disorder and there is a lack of good treatments.<br />
<br />
<br />
'''<br />
== Spot on Treatment ==<br />
'''<br />
<br />
'''iGEM Stockholm on the Vitiligo project <br />
This article is an effort from us in the iGEM Stockholm team to explain our Vitiligo-treatment scientific project in words that anyone can understand, consequently we will keep the scientific explanations on a basic level. <br />
'''<br />
<br />
Our primary goal is to merge current scientific knowledge with an innovative new investigative approach known as Synthetic Biology, in order to hopefully help Vitiligo patients achieve faster and more efficient repigmentation of affected skin in the future. <br />
<br />
'''Background'''<br />
<br />
Vitiligo (leukoderma) is a skin disorder in which pigment cells known as melanocytes are destroyed, resulting in white patches of the skin1. Melanocytes are the cells responsible for creating skin color, so when these are destroyed, the normal shade of the skin turns white. Vitiligo is in itself not dangerous and does not lead to any severe health problems, but patients’ life quality may be seriously altered by the cosmetic appearance that is a result of the white spots from Vitiligo. Between 1-2 percent of the world population are estimated to be affected by Vitiligo, with varying levels of severity. The disorder is characterized by patches occurring on the skin in various parts of the body, hair growing on the patches may also turn white [1]. <br />
<br />
Population surveys have shown that Vitiligo patients first outbreak is seen before the age of 20 in 50 % of the cases, and 70-80 before the age of 30. So it is relatively uncommon with Vitiligo outbreaks in mid-age. Both sexes in adults and children are affected in equal weights; however studies have showed that females contact doctors in a larger number due to greater psychological and social impact [2].<br />
<br />
At first, vitiligo can be thought of as a minor disorder, however the effect on patient’s self-esteem and social interactions can be devastating, especially in patients with darker pigmented skin where the white patches can be more visible. There are two distinguished large sub-sets of vitiligo, called focal/segmental vitiligo and non-segmental vitiligo. The former is characterized by few numbers of small lesions while the second form by an asymmetric distribution of the skin surface. Non-segmental vitiligo is correlated to all generalized, symmetrical forms. The course of the outbreak of the disease is unpredictable with phases of stabilized depigmentation. White vitiligo patches that are in an enlarging manner or the development of new lesions are classified as in an active form of disease [3]. <br />
<br />
Currently three major hypotheses of vitiligo have been proposed. The neural hypothesis implicates an accumulation of a neurochemical substance in the form of a toxin from nerve endings. This damages melanocytes and thus decreases melanin production. The biochemical hypothesis suggests an accumulation of toxic molecules from the synthesis of melanin in melanocytes, the breakdown of antioxidant molecules, and the build-up of large amounts of reactive molecules in pigment cells. Additionally, an autoimmune response in vitiligo patients has been proposed. Studies have demonstrated that vitiligo patients have developed antibodies and an activated immune system destructive against the body’s own pigment cells. Other possible causes of vitiligo have been suggested, including impaired melanocyte migration and/or development [3]. <br />
<br />
It might be that the mentioned factors act independently or together to result in the same effect, which is the disappearance of melanocytes from the skin [3]. <br />
<br />
Our research is divided up into two areas, which are long and short time effect on the skin. The long term research is focusing on both the biochemical and autoimmune hypothesis, which is to result in a repigmentation of white skin patches after a longer time period of treatment. The complementary short term research is based on repigmenting the affected patches in the similar effect of make-up while the long term treatment is under progress. This will be carried out by bacteria producing melanin on the skin, which will be absorbed and result in colored skin. <br />
<br />
'''Our aim'''<br />
<br />
Our research project uses harmless bacteria that, in fact, are already living in the human body as biological machines. These helpful bacteria are designed in our research project to become cost efficient machines to produce molecules that are deficient in vitiligo skin compared to normal skin. The goal with our project, until November 2010, is to obtain a “proof-of-concept” by having our bacteria produce and secrete molecules that we know, through previous research, are in a deficit in vitiligo skin. The lack of these specific molecules is thought to be involved in the impaired and disappeared pigment cells in vitiligo affected skin areas, leading to white spots.<br />
<br />
Currently, there are not any treatments like ours for vitiligo skin. Our idea is to develop a treatment for vitiligo skin, where an ointment with harmless bacteria is to be produced for applying on white patched skin. The bacteria will synthesize and secrete several molecules of interest; these will be carried with a special carrier molecule through the outermost layer of the skin and further down to target specific inner skin cells with the aim of repigmentation. <br />
<br />
With our research we aim to in the future develop a treatment that works faster and more efficient in achieving a repigmentation on affected skin areas compared to current medicine. <br />
</div><br />
<br />
'''References'''<br />
<br />
1.Current remedies for vitiligo Javed Ali et al. Autoimmunity Reviews, 2010 <br />
<br />
2.Vitiligo by Mauro Picardo Springer-Verlag Berlin Heidelberg, 2010<br />
<br />
3.Autoantibody responses to melanocytes in the depigmenting skin disease vitiligo Anthony P. Weetman et al. Autoimmunity Reviews, 2007<br />
|-<br />
|colspan="3" align="right"|<br />
<html><br />
<embed <br />
src="https://static.igem.org/mediawiki/2010/3/30/SU_animation_final_version.swf" <br />
width="700"<br />
height="500"<br />
allowscriptaccess="always"<br />
allowfullscreen="true"<br />
/><br />
</html><br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Team/MembersTeam:Stockholm/Team/Members2010-10-27T22:41:35Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Team}}<br />
<br><br />
[[image:SU_Team_Icon.gif|400px|center]]<br />
<br />
{|<br />
|<br />
===Students===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Nina.jpg|100px|center]]<center><br />'''Nina Schiller'''<br />[mailto:nina@igem.se nina@igem.se]</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
I am one of the team-members of Team Stockholm, my name is Nina Schiller and I am a master student in molecular biology at Stockholm University. It is the endless possibilities and opportunities in the field of synthetic biology that has caught my attention to put together our iGEM team: Team Stockholm. To me, this field of research and iGEM competition drives science researchers and students to gain better insight and take advantage of the diverse and powerful characters of living organisms. This summer, I will together with my team mates work our hardest to combine biology, chemistry and engineering in order to understand, harness and imitate the complex phenomena of biological life and finally build innovative and useful biological systems.<br />
<br />
My goal with iGEM is to challenge myself to think “out of the box” and seek for ways to put together bits and pieces in science in order to design organisms that would prove useful in the obstacles in modern life. I look forward to build up my science knowledge and laboratory experience. Of course, with a great idea in our luggage, both my and the whole teams goal is to win the iGEM competition! <br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:2.jpg|100px|center]]<center><br />'''Andreas Constantinou'''<br />andreas (at) igem.se</center><br />
|width="590" border="0" align="justify"|I first came in contact with synthetic biology in 2008, when I heard about attempts to create a petroleum-producing bacterium to be used as an alternative energy source. Immediately fascinated by this idea and the synthetic biology concept and methodology, my aim has been to study this interesting field ever since. This has now led to the founding of a Stockholm-based team in the 2010 iGEM competition.<br />
<br />
What fascinates me most about synthetic biology is that it links biology and engineering together. With a great interest in both, I see iGEM as a unique opportunity for me to combine my creativity and knowledge in molecular biology to design and build a biological machine that can be used in every-day life.<br />
<br />
With a revolutionary idea, dedicated and hard-working team-members and a large portion of self-confidence, Team Stockholm is ready to fight for the 2010 iGEM Gold Medal!<br />
<br />
See you at the jamboree at MIT in November!<br />
|}<br />
<br /> <br />
<br />
{|<br />
|width="200"|[[Image:J.jpg|100px|center]]<center><br />'''Johan Nordholm'''<br />[mailto:johan@igem.se johan@igem.se]</center><br />
|width="590" border="0" align="justify"|Greetings!<br />
<br />
Synthetic biology is all about putting engineering into biology. And I think there is a small engineer hidden in each and every one of us. As with the ever-increasing understanding of how the building blocks of the cell function and are put together, so is our capacity to redesign the building blocks and the way they are put together. This has immense potential, I guarantee it can change our society as much as the computer industry has the last decades. This summer, I will do my best to apply existing biological knowledge to hopefully solve a scientific problem, if even a very small one. I am currently in my third and last year in the bachelor program of molecular biology at Stockholm University. As I have not yet undergone any research traineeship or degree project, my time spent in the lab is limited. I therefore find this project as a tremendous opportunity to change that. What makes this even more fun is that my teammates are some of my best friends.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Mim.jpg|100px|center]]<center><br />'''Emmelie Lidh'''</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
My name is Mimmi, right now I’m finishing my bachelor in molecular biology. <br />
<br />
I have always been fascinated by the origin of life. By how the genetic code can produce so many different life forms and make the organisms adapt to so many different niches and environments. Now, this competition is about using different traits nature invented and put them together to create new useful functions in an organism. I think this is an amazing way to study and learn more about the complex network of genes and at the same time produce a helpful organism.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Hassan.jpg|100px|center]]<center><br />'''Hassan Foroughi Asl'''<br />hassanfa (at) kth.se</center><br />
|width="590" border="0" align="justify"|Hi,<br />
<br />
I'm a Masters student in Computational and Systems Biology at Royal Institute of Technology (KTH) and a member of the Stockholm University team for iGEM competition. My first contact with iGEM and synthetic biology wasn't so long time ago. I got introduced to iGEM competitions in 2009. Then Synthetic biology attracted my attention and it became more interesting to me when I started to study about biological circuits and how these circuits are chosen by evolution. Here I will offer all my knowledge and effort to bring our ideas and plans into reality and solve the problem with a great success.<br />
|}<br />
<br /><br />
<br />
===Mentors===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Eli.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br/ >'''Prof. Elisabeth Hagg&aring;rd'''<br />Department of Genetics, Microbiology and Toxicology, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:gunnar_pic1.png|100px|center]]<br />
|width="590" border="0" align="justify"|<br>'''Prof. Gunnar von Heijne'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:Rob_Pick.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br />'''Assistant Prof. Robert Daniels'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
<br />
<br /><br />
{|<br />
|width="200"|<br />
|width="590" border="0" align="justify"|'''Co-advisors at Stockholm University:''' Prof. Lars Wieslander, Prof. Marie &Ouml;hman, Prof. Neus Visa and Prof. Roger Karlsson.<br />
<br />
===Acknowledgements===<br />
Other than valuable help from our mentors, many more people helped us both in the lab, but also helped us shape and develop our idea for the modelling part. Among these, we would like to take this opportunity to show our gratitude to the following people:<br />
<br />
'''Sergey Surkov, Jaroslav Belotserkovsky, Sridhar Mandali and Richard Odegrip.'''<br />
<br />
<br />
----<br />
<br />
The idea was fully created and shaped by the students. All lab work was performed by the students. Invaluable help and support was given from mentors and advisors, in particular Rob Daniels Elisabeth & Hagg&aring;rd, for that we are very grateful!<br />
|}<br />
<br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Team/MembersTeam:Stockholm/Team/Members2010-10-27T22:39:33Z<p>JohanNordholm: /* Acknowledgements */</p>
<hr />
<div>{{Stockholm/Team}}<br />
<br><br />
[[image:SU_Team_Icon.gif|400px|center]]<br />
<br />
{|<br />
|<br />
===Students===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Nina.jpg|100px|center]]<center><br />'''Nina Schiller'''<br />[mailto:nina@igem.se nina@igem.se]</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
I am one of the team-members of Team Stockholm, my name is Nina Schiller and I am a master student in molecular biology at Stockholm University. It is the endless possibilities and opportunities in the field of synthetic biology that has caught my attention to put together our iGEM team: Team Stockholm. To me, this field of research and iGEM competition drives science researchers and students to gain better insight and take advantage of the diverse and powerful characters of living organisms. This summer, I will together with my team mates work our hardest to combine biology, chemistry and engineering in order to understand, harness and imitate the complex phenomena of biological life and finally build innovative and useful biological systems.<br />
<br />
My goal with iGEM is to challenge myself to think “out of the box” and seek for ways to put together bits and pieces in science in order to design organisms that would prove useful in the obstacles in modern life. I look forward to build up my science knowledge and laboratory experience. Of course, with a great idea in our luggage, both my and the whole teams goal is to win the iGEM competition! <br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:2.jpg|100px|center]]<center><<br />'''Andreas Constantinou'''<br />andreas (at) igem.se</center><br />
|width="590" border="0" align="justify"|I first came in contact with synthetic biology in 2008, when I heard about attempts to create a petroleum-producing bacterium to be used as an alternative energy source. Immediately fascinated by this idea and the synthetic biology concept and methodology, my aim has been to study this interesting field ever since. This has now led to the founding of a Stockholm-based team in the 2010 iGEM competition.<br />
<br />
What fascinates me most about synthetic biology is that it links biology and engineering together. With a great interest in both, I see iGEM as a unique opportunity for me to combine my creativity and knowledge in molecular biology to design and build a biological machine that can be used in every-day life.<br />
<br />
With a revolutionary idea, dedicated and hard-working team-members and a large portion of self-confidence, Team Stockholm is ready to fight for the 2010 iGEM Gold Medal!<br />
<br />
See you at the jamboree at MIT in November!<br />
|}<br />
<br /> <br />
<br />
{|<br />
|width="200"|[[Image:J.jpg|100px|center]]<center><br />'''Johan Nordholm'''<br />[mailto:johan@igem.se johan@igem.se]</center><br />
|width="590" border="0" align="justify"|Greetings!<br />
<br />
Synthetic biology is all about putting engineering into biology. And I think there is a small engineer hidden in each and every one of us. As with the ever-increasing understanding of how the building blocks of the cell function and are put together, so is our capacity to redesign the building blocks and the way they are put together. This has immense potential, I guarantee it can change our society as much as the computer industry has the last decades. This summer, I will do my best to apply existing biological knowledge to hopefully solve a scientific problem, if even a very small one. I am currently in my third and last year in the bachelor program of molecular biology at Stockholm University. As I have not yet undergone any research traineeship or degree project, my time spent in the lab is limited. I therefore find this project as a tremendous opportunity to change that. What makes this even more fun is that my teammates are some of my best friends.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Mim.jpg|100px|center]]<center><br />'''Emmelie Lidh'''</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
My name is Mimmi, right now I’m finishing my bachelor in molecular biology. <br />
<br />
I have always been fascinated by the origin of life. By how the genetic code can produce so many different life forms and make the organisms adapt to so many different niches and environments. Now, this competition is about using different traits nature invented and put them together to create new useful functions in an organism. I think this is an amazing way to study and learn more about the complex network of genes and at the same time produce a helpful organism.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Hassan.jpg|100px|center]]<center><br />'''Hassan Foroughi Asl'''<br />hassanfa (at) kth.se</center><br />
|width="590" border="0" align="justify"|Hi,<br />
<br />
I'm a Masters student in Computational and Systems Biology at Royal Institute of Technology (KTH) and a member of the Stockholm University team for iGEM competition. My first contact with iGEM and synthetic biology wasn't so long time ago. I got introduced to iGEM competitions in 2009. Then Synthetic biology attracted my attention and it became more interesting to me when I started to study about biological circuits and how these circuits are chosen by evolution. Here I will offer all my knowledge and effort to bring our ideas and plans into reality and solve the problem with a great success.<br />
|}<br />
<br /><br />
<br />
===Mentors===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Eli.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br/ >'''Prof. Elisabeth Hagg&aring;rd'''<br />Department of Genetics, Microbiology and Toxicology, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:gunnar_pic1.png|100px|center]]<br />
|width="590" border="0" align="justify"|<br>'''Prof. Gunnar von Heijne'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:Rob_Pick.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br />'''Assistant Prof. Robert Daniels'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
<br />
<br /><br />
{|<br />
|width="200"|<br />
|width="590" border="0" align="justify"|'''Co-advisors at Stockholm University:''' Prof. Lars Wieslander, Prof. Marie &Ouml;hman, Prof. Neus Visa and Prof. Roger Karlsson.<br />
<br />
===Acknowledgements===<br />
Other than valuable help from our mentors, many more people helped us both in the lab, but also helped us shape and develop our idea for the modelling part. Among these, we would like to take this opportunity to show our gratitude to the following people:<br />
<br />
'''Sergey Surkov, Jaroslav Belotserkovsky, Sridhar Mandali and Richard Odegrip.'''<br />
<br />
<br />
----<br />
<br />
The idea was fully created and shaped by the students. All lab work was performed by the students. Invaluable help and support was given from mentors and advisors, in particular Rob Daniels Elisabeth & Hagg&aring;rd, for that we are very grateful!<br />
|}<br />
<br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Team/MembersTeam:Stockholm/Team/Members2010-10-27T22:33:17Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Team}}<br />
<br><br />
[[image:SU_Team_Icon.gif|400px|center]]<br />
<br />
{|<br />
|<br />
===Students===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Nina.jpg|100px|center]]<center><br />'''Nina Schiller'''<br />[mailto:nina@igem.se nina@igem.se]</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
I am one of the team-members of Team Stockholm, my name is Nina Schiller and I am a master student in molecular biology at Stockholm University. It is the endless possibilities and opportunities in the field of synthetic biology that has caught my attention to put together our iGEM team: Team Stockholm. To me, this field of research and iGEM competition drives science researchers and students to gain better insight and take advantage of the diverse and powerful characters of living organisms. This summer, I will together with my team mates work our hardest to combine biology, chemistry and engineering in order to understand, harness and imitate the complex phenomena of biological life and finally build innovative and useful biological systems.<br />
<br />
My goal with iGEM is to challenge myself to think “out of the box” and seek for ways to put together bits and pieces in science in order to design organisms that would prove useful in the obstacles in modern life. I look forward to build up my science knowledge and laboratory experience. Of course, with a great idea in our luggage, both my and the whole teams goal is to win the iGEM competition! <br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:2.jpg|100px|center]]<center><<br />'''Andreas Constantinou'''<br />andreas (at) igem.se</center><br />
|width="590" border="0" align="justify"|I first came in contact with synthetic biology in 2008, when I heard about attempts to create a petroleum-producing bacterium to be used as an alternative energy source. Immediately fascinated by this idea and the synthetic biology concept and methodology, my aim has been to study this interesting field ever since. This has now led to the founding of a Stockholm-based team in the 2010 iGEM competition.<br />
<br />
What fascinates me most about synthetic biology is that it links biology and engineering together. With a great interest in both, I see iGEM as a unique opportunity for me to combine my creativity and knowledge in molecular biology to design and build a biological machine that can be used in every-day life.<br />
<br />
With a revolutionary idea, dedicated and hard-working team-members and a large portion of self-confidence, Team Stockholm is ready to fight for the 2010 iGEM Gold Medal!<br />
<br />
See you at the jamboree at MIT in November!<br />
|}<br />
<br /> <br />
<br />
{|<br />
|width="200"|[[Image:J.jpg|100px|center]]<center><br />'''Johan Nordholm'''<br />[mailto:johan@igem.se johan@igem.se]</center><br />
|width="590" border="0" align="justify"|Greetings!<br />
<br />
Synthetic biology is all about putting engineering into biology. And I think there is a small engineer hidden in each and every one of us. As with the ever-increasing understanding of how the building blocks of the cell function and are put together, so is our capacity to redesign the building blocks and the way they are put together. This has immense potential, I guarantee it can change our society as much as the computer industry has the last decades. This summer, I will do my best to apply existing biological knowledge to hopefully solve a scientific problem, if even a very small one. I am currently in my third and last year in the bachelor program of molecular biology at Stockholm University. As I have not yet undergone any research traineeship or degree project, my time spent in the lab is limited. I therefore find this project as a tremendous opportunity to change that. What makes this even more fun is that my teammates are some of my best friends.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Mim.jpg|100px|center]]<center><br />'''Emmelie Lidh'''</center><br />
|width="590" border="0" align="justify"|Hi!<br />
<br />
My name is Mimmi, right now I’m finishing my bachelor in molecular biology. <br />
<br />
I have always been fascinated by the origin of life. By how the genetic code can produce so many different life forms and make the organisms adapt to so many different niches and environments. Now, this competition is about using different traits nature invented and put them together to create new useful functions in an organism. I think this is an amazing way to study and learn more about the complex network of genes and at the same time produce a helpful organism.<br />
|}<br />
<br /><br />
<br />
{|<br />
|width="200"|[[Image:Hassan.jpg|100px|center]]<center><br />'''Hassan Foroughi Asl'''<br />hassanfa (at) kth.se</center><br />
|width="590" border="0" align="justify"|Hi,<br />
<br />
I'm a Masters student in Computational and Systems Biology at Royal Institute of Technology (KTH) and a member of the Stockholm University team for iGEM competition. My first contact with iGEM and synthetic biology wasn't so long time ago. I got introduced to iGEM competitions in 2009. Then Synthetic biology attracted my attention and it became more interesting to me when I started to study about biological circuits and how these circuits are chosen by evolution. Here I will offer all my knowledge and effort to bring our ideas and plans into reality and solve the problem with a great success.<br />
|}<br />
<br /><br />
<br />
===Mentors===<br />
<br /><br />
<br /><br />
{|<br />
|width="200"|[[Image:Eli.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br/ >'''Prof. Elisabeth Hagg&aring;rd'''<br />Department of Genetics, Microbiology and Toxicology, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:gunnar_pic1.png|100px|center]]<br />
|width="590" border="0" align="justify"|<br>'''Prof. Gunnar von Heijne'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
{|<br />
|width="200"|[[Image:Rob_Pick.jpg|100px|center]]<br />
|width="590" border="0" align="justify"|<br />'''Assistant Prof. Robert Daniels'''<br />Department of Biochemistry and Biophysics, Stockholm University<br />
|}<br />
<br />
<br /><br />
{|<br />
|width="200"|<br />
|width="590" border="0" align="justify"|'''Co-advisors at Stockholm University:''' Prof. Lars Wieslander, Prof. Marie &Ouml;hman, Prof. Neus Visa and Prof. Roger Karlsson.<br />
<br />
===Acknowledgements===<br />
Other than valuable help from our mentors, many more people helped us both in the lab, but also helped us shape and develop our idea for the modelling part. Among these, we would like to take this opportunity to show our gratitude to the following people:<br />
<br />
'''Sergey Surkov, Jaroslav Belotserkovsky, Sridhar Mandali and Richard Odegrip.'''<br />
<br />
<br />
----<br />
<br />
The idea was fully created and shaped by the students. All lab work was performed by the students. Invaluable help and support was given from mentors and advisors, in particular Rob Daniels Elisabeth Hagg&aring;rd, for that we are very grateful!<br />
|}<br />
<br />
|}<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/23_September_2010Team:Stockholm/23 September 20102010-10-27T22:15:13Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
<br />
===BL21(DE3) clone verification===<br />
Attempted to verify BL21 clones from 21/9 transformations for correct plasmid (pEX) and insert.<br />
<br />
====Colony PCR====<br />
*pEX.SOD: 1 & 2<br />
*pEX.SOD&sdot;His (pEX.SH): 1 & 2<br />
*pEX.His&sdot;SOD (pEX.HS): 1 & 2<br />
*pEX.yCCS 5: 1 & 2<br />
*pEX.His&sdot;SOD plasmid (PC)<br />
<br />
PCR settings according to standard colony PCR protocol.<br />
*Elongation time: 1:30<br />
<br />
====Gel verification====<br />
[[image:ColPCR_BL21_clones_23sep.png|200px|thumb|right|'''Colony PCR gel verification of BL21 clones transformed with pEX.SOD, pEX.SOD&sdot;His, pEX.His&sdot;SOD or pEX.yCCS 5.'''<br />4 &mu;l &lambda;; 5 &mu;l sample.<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
<br />
1 % agarose, 120 V<br />
<br />
'''Expected bands'''<br />
*pEX.SOD: 678 bp<br />
*pEX.SOD&sdot;His (pEX.SH): 702 bp<br />
*pEX.His&sdot;SOD (pEX.HS): 702 bp<br />
*pEX.yCCS: 963 bp<br />
<br />
'''Results'''<br /><br />
Very weak but correct-sized bands for all clones but pEX.yCCS 5 #1. Clones verified.<br />
<br />
====ON cultures====<br />
One verified clone of each BL21 construct was chosen for preparation of glycerol stocks:<br />
*3 ml LB + 100 Amp; 30 &deg;C<br />
**pEX.SOD: clone 1<br />
**pEX.SOD&sdot;His (pEX.SH): clone 1<br />
**pEX.His&sdot;SOD (pEX.HS): clone 1<br />
**pEX.yCCS: clone 2<br />
<br />
===Plasmid prep===<br />
''From 22/9 ON cultures''<br />
<br />
Using Omega E.Z.N.A. Plasmid Miniprep kit I.<br />
<br />
No growth in cultures pSB1K3.N-LMWP&sdot;SOD&sdot;His and pEX.N-TAT&sdot;SOD&sdot;His 4.<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!colspan="3"|DNA concentration<br />
|-<br />
!Sample<br />
!width="60"|Conc [ng/&mu;l]<br />
!width="60"|A<sub>260</sub>/A<sub>280</sub><br />
|-<br />
|pSB1C3.N-LMWP&sdot;SOD&sdot;His 1<br />
|align="center"|35.06<br />
|align="center"|1.68<br />
|-<br />
|pSB1C3.N-LMWP&sdot;SOD&sdot;His 4<br />
|align="center"|46.85<br />
|align="center"|1.68<br />
|-<br />
|pSB1A2.RBS.yCCS 3<br />
|align="center"|39.64<br />
|align="center"|1.59<br />
|-<br />
|pSB1A2.RBS.yCCS 4<br />
|align="center"|87.01<br />
|align="center"|1.49<br />
|-<br />
|pEX.N-TAT&sdot;SOD&sdot;His 3<br />
|align="center"|66.22<br />
|align="center"|1.67<br />
|}<br />
<br />
Very low DNA concentrations and low purity. Possibly something wrong with the plasmid miniprep kit. New plasmid preps will be prepared tomorrow, using brand new kit solutions.<br />
<br />
====ON cultures====<br />
*5 ml LB + antibiotic (100 Amp, 50 Km or 25 Cm); 37 &deg;C 200 rpm<br />
**pEX.N-TAT&sdot;SOD&sdot;His 3 (100 Amp)<br />
**pEX.N-TAT&sdot;SOD&sdot;His 4 (100 Amp)<br />
**pSB1C3.N-LMWP&sdot;SOD&sdot;His 1 (25 Cm)<br />
**pSB1C3.N-LMWP&sdot;SOD&sdot;His 4 (25 Cm)<br />
**pSB1A2.RBS.yCCS 3 (100 Amp)<br />
**pSB1A2.RBS.yCCS 4 (100 Amp)<br />
**pSB1K3.N-LMWP&sdot;SOD&sdot;His 1 (50 Km)<br />
**pSB1K3.N-TAT&sdot;SOD&sdot;His 4 (50 Km)<br />
**pSB1K3.N-TAT&sdot;SOD&sdot;His 5 (50 Km)<br />
**pSB1K3.N-Tra10&sdot;SOD&sdot;His 5 (50 Km)<br />
<br />
==Johan==<br />
<br />
===Cut===<br />
<br />
bFGF with EcoRI and AgeI<br />
<br />
bFGF with NgoMIV and SpeI<br />
<br />
pMA with EcoRI and NgoMIV<br />
<br />
pMA with AgeI and SpeI<br />
<br />
5 µl DNA<br />
<br />
1 µl of both enzymes<br />
<br />
2 µl 10x fastbuffer<br />
<br />
11 µl H2O<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/24_September_2010Team:Stockholm/24 September 20102010-10-27T22:13:30Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
===Plasmid prep===<br />
''From 23/9 ON cultures''<br />
<br />
Omega E.Z.N.A. Plasmid Miniprep kit I.<br />
:New plasmid prep buffers<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!colspan="3"|DNA concentration<br />
|+align="bottom"|&dagger; = ''unsure value due to bad blank sample.''<br />
|-<br />
!Sample<br />
!width="60"|Conc [ng/&mu;l]<br />
!width="60"|A<sub>260</sub>/A<sub>280</sub><br />
|-<br />
|pSB1A2.RBS.yCCS 3<br />
|align="center"|195.5<br />
|align="center"|1.81<br />
|-<br />
|pSB1A2.RBS.yCCS 4<br />
|align="center"|165.7<br />
|align="center"|1.85<br />
|-<br />
|pEX.N-TAT&sdot;SOD&sdot;His 3&dagger;<br />
|align="center"|60.00<br />
|align="center"|1.83<br />
|-<br />
|pEX.N-TAT&sdot;SOD&sdot;His 4&dagger;<br />
|align="center"|90.00<br />
|align="center"|1.73<br />
|-<br />
|pSB1K3.N-TAT&sdot;SOD&sdot;His 4<br />
|align="center"|130.5<br />
|align="center"|1.84<br />
|-<br />
|pSB1K3.N-TAT&sdot;SOD&sdot;His 5&dagger;<br />
|align="center"|60.00<br />
|align="center"|1.88<br />
|-<br />
|pSB1K3.N-Tra10&sdot;SOD&sdot;His 5&dagger;<br />
|align="center"|90.00<br />
|align="center"|1.93<br />
|-<br />
|pSB1K3.N-LMWP&sdot;SOD&sdot;His 1<br />
|align="center"|258.2<br />
|align="center"|1.87<br />
|-<br />
|pSB1C3.N-LMWP&sdot;SOD&sdot;His 1<br />
|align="center"|155.4<br />
|align="center"|1.82<br />
|-<br />
|pSB1C3.N-LMWP&sdot;SOD&sdot;His 4<br />
|align="center"|331.9<br />
|align="center"|1.80<br />
|}<br />
<br />
===Cloning and assembly===<br />
<br />
====Digestions====<br />
<br />
[pEX.RFP] = 44.0 ng/&mu;l<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
|&nbsp;<br />
!width="70"|pA.RBS. yCCS (3) X+P<br />
!width="70"|pEX.N-TAT. SH (4) X+P<br />
!width="70"|pK.N-TAT. SH (4) S+P<br />
!width="70"|pK.N-Tra10. SH (5) X+P<br />
!width="70"|pK.N-Tra10. SH (5) S+P<br />
!width="70"|pC.N-LMWP. SH (4) X+P<br />
!width="70"|pC.N-LMWP. SH (4) S+P<br />
!width="70"|pEX.RFP X+P<br />
|-<br />
|10X FastDigest buffer<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|3<br />
|-<br />
|DNA (1 &mu;g)<br />
|align="center"|5<br />
|align="center"|12.5<br />
|align="center"|8<br />
|align="center"|12.5<br />
|align="center"|12.5<br />
|align="center"|4<br />
|align="center"|4<br />
|align="center"|22<br />
|-<br />
|dH<sub>2</sub>O<br />
|align="center"|11<br />
|align="center"|3.5<br />
|align="center"|7<br />
|align="center"|3.5<br />
|align="center"|3.5<br />
|align="center"|12<br />
|align="center"|12<br />
|align="center"|3<br />
|-<br />
|FD XbaI<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|-<br />
|FD PstI<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|-<br />
|FD SpeI<br />
|align="center"|0<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|-<br />
|&nbsp;<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!30 &mu;l<br />
|}<br />
*Incubation: 37 &deg;C, 1 h<br />
<br />
====Gel verification====<br />
[[image:Gelver_digestions_24sep.png|200px|thumb|right|'''Gel verification of sample digestions.'''<br />4 &mu;l &lambda;; 3 &mu;l sample.<br />1 kb &lambda; = O'GeneRuler 1 kb DNA ladder. 50 bp &lambda; = GeneRuler 50 bp DNA ladder.]]<br />
''Due to the risk of pSB1A2.RBS.yCCS and pEX.N-TAT&sdot;SOD&sdot;His having previously been mixed up, a gel was run on the digested samples (after 15 min incubation) to verify the excised insert size. Remaining samples were also run on the gel to verify digestion.<br />
<br />
1 % agarose, 120 V<br />
<br />
'''Expected bands'''<br />
#'''pSB1A2.RBS.yCCS X+P:''' 806 bp, 2061 bp<br />
#'''pEX.N-TAT&sdot;SOD&sdot;His X+P:''' 558 bp, 4453 bp<br />
#'''pSB1K3.N-TAT&sdot;SOD&sdot;His S+P:''' &asymp;2730 bp<br />
#'''pSB1K3.N-Tra10&sdot;SOD&sdot;His X+P:''' 588 bp, 2188 bp<br />
#'''pSB1K3.N-Tra10&sdot;SOD&sdot;His S+P:''' &asymp;2760 bp<br />
#'''pSB1C3.N-LMWP&sdot;SOD&sdot;His X+P:''' 567 bp, 2054 bp<br />
#'''pSB1C3.N-LMWP&sdot;SOD&sdot;His S+P:''' &asymp;2610 bp<br />
#'''pEX.RFP X+P:''' 1095 bp, 4453 bp<br />
<br />
'''Results'''<br /><br />
Seemingly correct bands for samples 1, 3, 4, 5 and 8. More unsure results for 6 and 7, while 2 seems to contain more than one insert, or has been digested at several places.<br />
<br />
==Nina==<br />
<br />
===Overnight culture===<br />
<br />
I inoculated protein A#5_TAT, _LMWP & _Tra10 all from colony #1 on each dish. <br />
<br />
12 ml LB + 24 ul chloramphenicol. <br />
<br />
===Concentration measurement===<br />
<br />
*Protein A#5_CPP_TAT_C cons: 95ng/ul 95/10 = 9.5ng/ul λ260 0.019 λ280 0.009 λ315 -0.002<br />
<br />
*Vector with CPP_TAT_C conc: 95 ng/ul<br />
<br />
95ng/ul * Volume = 25ng/ul * 5 ul<br />
<br />
Volume = 1.3 ul sample and fill up to 5 ml with H2O.<br />
<br />
*IgG N+P cons: 30ng/ul 30/2.5 = 12ng/ul λ260 0.007 λ280 0.006 λ315 0.000<br />
<br />
*IgG A+E cons: 40ng/ul 40/2.5 = 16ng/ul λ260 0.007 λ280 0.007 λ315 0.001<br />
<br />
===Ligation===<br />
<br />
*Vector CPP_TAT_C 1 ul<br />
*Protein A gene 21 ul<br />
*Quick ligase 1 ul<br />
*Quicke ligase buffer 2X 23 ul<br />
<br />
<br />
<br />
<br />
*Vector LMWP, TAT & Tra10 0.5 ul each<br />
*gene IgG (N+P) 7.5 ul each<br />
*Quick ligation 1 ul<br />
*Quick ligation buffer 2X 9 ul each<br />
<br />
<br />
<br />
<br />
<br />
*Vector CPP_TAT_C 1 ul <br />
*gene IgG (A+E) 17 ul <br />
*Quick ligation 1 ul<br />
*Quick ligation buffer 2X 19 ul<br />
<br />
===Transformation===<br />
<br />
I transformed the ligations with 10 ul in 100 ul Top 10 cloning cells. <br />
<br />
===Digestion===<br />
<br />
*H2O 15 ul<br />
*Fastdigest buffer 10X 2 ul<br />
*DNA 2 ul<br />
*Restriction enzyme NgoMIV 1 ul<br />
*Restriction enzyme PstI 1 ul (Add after 1.5 h incubation in 37 °C and incubate in 30 min)<br />
<br />
Inactivate in 80 °C for 30 min.<br />
<br />
Added CIAP 1 ul and incubate 1 h in 37 °C. <br />
<br />
<br />
<br />
==Johan==<br />
<br />
===Gel purification===<br />
<br />
A gel was run with pMA (vector with histag) cut before and after his, and bFGF cut before and after<br />
<br />
A gel purification was then performed on all samples.<br />
<br />
Abs:<br />
<br />
bFGF-his: 14 ng/µl<br />
his-bFGF: 18 ng/µl<br />
pMA before: 22 ng/µl<br />
pMA after: 30 ng /µl<br />
<br />
===Ligation===<br />
<br />
bFGF after & pMA before<br />
<br />
bFGF before & pMA after<br />
<br />
5 µl insert<br />
<br />
3 µl vector<br />
<br />
1 µl T4 ligase<br />
<br />
2 µl 10x buffer<br />
<br />
9 µl H2O<br />
<br />
===Transformation===<br />
<br />
3 µl of all constructs was transformed into top10 cells.<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/24_September_2010Team:Stockholm/24 September 20102010-10-27T22:10:07Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
===Plasmid prep===<br />
''From 23/9 ON cultures''<br />
<br />
Omega E.Z.N.A. Plasmid Miniprep kit I.<br />
:New plasmid prep buffers<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!colspan="3"|DNA concentration<br />
|+align="bottom"|&dagger; = ''unsure value due to bad blank sample.''<br />
|-<br />
!Sample<br />
!width="60"|Conc [ng/&mu;l]<br />
!width="60"|A<sub>260</sub>/A<sub>280</sub><br />
|-<br />
|pSB1A2.RBS.yCCS 3<br />
|align="center"|195.5<br />
|align="center"|1.81<br />
|-<br />
|pSB1A2.RBS.yCCS 4<br />
|align="center"|165.7<br />
|align="center"|1.85<br />
|-<br />
|pEX.N-TAT&sdot;SOD&sdot;His 3&dagger;<br />
|align="center"|60.00<br />
|align="center"|1.83<br />
|-<br />
|pEX.N-TAT&sdot;SOD&sdot;His 4&dagger;<br />
|align="center"|90.00<br />
|align="center"|1.73<br />
|-<br />
|pSB1K3.N-TAT&sdot;SOD&sdot;His 4<br />
|align="center"|130.5<br />
|align="center"|1.84<br />
|-<br />
|pSB1K3.N-TAT&sdot;SOD&sdot;His 5&dagger;<br />
|align="center"|60.00<br />
|align="center"|1.88<br />
|-<br />
|pSB1K3.N-Tra10&sdot;SOD&sdot;His 5&dagger;<br />
|align="center"|90.00<br />
|align="center"|1.93<br />
|-<br />
|pSB1K3.N-LMWP&sdot;SOD&sdot;His 1<br />
|align="center"|258.2<br />
|align="center"|1.87<br />
|-<br />
|pSB1C3.N-LMWP&sdot;SOD&sdot;His 1<br />
|align="center"|155.4<br />
|align="center"|1.82<br />
|-<br />
|pSB1C3.N-LMWP&sdot;SOD&sdot;His 4<br />
|align="center"|331.9<br />
|align="center"|1.80<br />
|}<br />
<br />
===Cloning and assembly===<br />
<br />
====Digestions====<br />
<br />
[pEX.RFP] = 44.0 ng/&mu;l<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
|&nbsp;<br />
!width="70"|pA.RBS. yCCS (3) X+P<br />
!width="70"|pEX.N-TAT. SH (4) X+P<br />
!width="70"|pK.N-TAT. SH (4) S+P<br />
!width="70"|pK.N-Tra10. SH (5) X+P<br />
!width="70"|pK.N-Tra10. SH (5) S+P<br />
!width="70"|pC.N-LMWP. SH (4) X+P<br />
!width="70"|pC.N-LMWP. SH (4) S+P<br />
!width="70"|pEX.RFP X+P<br />
|-<br />
|10X FastDigest buffer<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|3<br />
|-<br />
|DNA (1 &mu;g)<br />
|align="center"|5<br />
|align="center"|12.5<br />
|align="center"|8<br />
|align="center"|12.5<br />
|align="center"|12.5<br />
|align="center"|4<br />
|align="center"|4<br />
|align="center"|22<br />
|-<br />
|dH<sub>2</sub>O<br />
|align="center"|11<br />
|align="center"|3.5<br />
|align="center"|7<br />
|align="center"|3.5<br />
|align="center"|3.5<br />
|align="center"|12<br />
|align="center"|12<br />
|align="center"|3<br />
|-<br />
|FD XbaI<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|-<br />
|FD PstI<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|-<br />
|FD SpeI<br />
|align="center"|0<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|align="center"|1<br />
|align="center"|0<br />
|-<br />
|&nbsp;<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!30 &mu;l<br />
|}<br />
*Incubation: 37 &deg;C, 1 h<br />
<br />
====Gel verification====<br />
[[image:Gelver_digestions_24sep.png|200px|thumb|right|'''Gel verification of sample digestions.'''<br />4 &mu;l &lambda;; 3 &mu;l sample.<br />1 kb &lambda; = O'GeneRuler 1 kb DNA ladder. 50 bp &lambda; = GeneRuler 50 bp DNA ladder.]]<br />
''Due to the risk of pSB1A2.RBS.yCCS and pEX.N-TAT&sdot;SOD&sdot;His having previously been mixed up, a gel was run on the digested samples (after 15 min incubation) to verify the excised insert size. Remaining samples were also run on the gel to verify digestion.<br />
<br />
1 % agarose, 120 V<br />
<br />
'''Expected bands'''<br />
#'''pSB1A2.RBS.yCCS X+P:''' 806 bp, 2061 bp<br />
#'''pEX.N-TAT&sdot;SOD&sdot;His X+P:''' 558 bp, 4453 bp<br />
#'''pSB1K3.N-TAT&sdot;SOD&sdot;His S+P:''' &asymp;2730 bp<br />
#'''pSB1K3.N-Tra10&sdot;SOD&sdot;His X+P:''' 588 bp, 2188 bp<br />
#'''pSB1K3.N-Tra10&sdot;SOD&sdot;His S+P:''' &asymp;2760 bp<br />
#'''pSB1C3.N-LMWP&sdot;SOD&sdot;His X+P:''' 567 bp, 2054 bp<br />
#'''pSB1C3.N-LMWP&sdot;SOD&sdot;His S+P:''' &asymp;2610 bp<br />
#'''pEX.RFP X+P:''' 1095 bp, 4453 bp<br />
<br />
'''Results'''<br /><br />
Seemingly correct bands for samples 1, 3, 4, 5 and 8. More unsure results for 6 and 7, while 2 seems to contain more than one insert, or has been digested at several places.<br />
<br />
==Nina==<br />
<br />
===Overnight culture===<br />
<br />
I inoculated protein A#5_TAT, _LMWP & _Tra10 all from colony #1 on each dish. <br />
<br />
12 ml LB + 24 ul chloramphenicol. <br />
<br />
===Concentration measurement===<br />
<br />
*Protein A#5_CPP_TAT_C cons: 95ng/ul 95/10 = 9.5ng/ul λ260 0.019 λ280 0.009 λ315 -0.002<br />
<br />
*Vector with CPP_TAT_C conc: 95 ng/ul<br />
<br />
95ng/ul * Volume = 25ng/ul * 5 ul<br />
<br />
Volume = 1.3 ul sample and fill up to 5 ml with H2O.<br />
<br />
*IgG N+P cons: 30ng/ul 30/2.5 = 12ng/ul λ260 0.007 λ280 0.006 λ315 0.000<br />
<br />
*IgG A+E cons: 40ng/ul 40/2.5 = 16ng/ul λ260 0.007 λ280 0.007 λ315 0.001<br />
<br />
===Ligation===<br />
<br />
*Vector CPP_TAT_C 1 ul<br />
*Protein A gene 21 ul<br />
*Quick ligase 1 ul<br />
*Quicke ligase buffer 2X 23 ul<br />
<br />
<br />
<br />
<br />
*Vector LMWP, TAT & Tra10 0.5 ul each<br />
*gene IgG (N+P) 7.5 ul each<br />
*Quick ligation 1 ul<br />
*Quick ligation buffer 2X 9 ul each<br />
<br />
<br />
<br />
<br />
<br />
*Vector CPP_TAT_C 1 ul <br />
*gene IgG (A+E) 17 ul <br />
*Quick ligation 1 ul<br />
*Quick ligation buffer 2X 19 ul<br />
<br />
===Transformation===<br />
<br />
I transformed the ligations with 10 ul in 100 ul Top 10 cloning cells. <br />
<br />
===Digestion===<br />
<br />
*H2O 15 ul<br />
*Fastdigest buffer 10X 2 ul<br />
*DNA 2 ul<br />
*Restriction enzyme NgoMIV 1 ul<br />
*Restriction enzyme PstI 1 ul (Add after 1.5 h incubation in 37 °C and incubate in 30 min)<br />
<br />
Inactivate in 80 °C for 30 min.<br />
<br />
Added CIAP 1 ul and incubate 1 h in 37 °C. <br />
<br />
<br />
<br />
==Johan==<br />
<br />
===Gel purification===<br />
<br />
A gel was run with pMA (vector with histag) cut before and after his, and his-bFGF and bFGF-his<br />
<br />
A gel purification was then performed on all samples.<br />
<br />
Abs:<br />
<br />
bFGF-his: 14 ng/µl<br />
his-bFGF: 18 ng/µl<br />
pMA before: 22 ng/µl<br />
pMA after: 30 ng /µl<br />
<br />
===Ligation===<br />
<br />
bFGF-his & pMA before<br />
<br />
his-bFGF & pMA after<br />
<br />
5 µl insert<br />
<br />
3 µl vector<br />
<br />
1 µl T4 ligase<br />
<br />
2 µl 10x buffer<br />
<br />
9 µl H2O<br />
<br />
===Transformation===<br />
<br />
3 µl of all constructs was transformed into top10 cells.<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/26_September_2010Team:Stockholm/26 September 20102010-10-27T22:03:54Z<p>JohanNordholm: New page: {{Stockholm/Top2}} =Johan= ==Colony PCR screen== bFGF-his and his-bFGF in pMA (vector with histag) 0,5 µl pol 0,5 µl dNTP 5 µl 10x buffer 1,5 µl pMA for primer 1,5 µl pMA rev ...</p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
=Johan=<br />
<br />
==Colony PCR screen==<br />
<br />
bFGF-his and his-bFGF in pMA (vector with histag)<br />
<br />
0,5 µl pol<br />
<br />
0,5 µl dNTP<br />
<br />
5 µl 10x buffer<br />
<br />
1,5 µl pMA for primer<br />
<br />
1,5 µl pMA rev primer<br />
<br />
16 µl H2O<br />
<br />
10 colonies from both plates<br />
<br />
==Gel==<br />
<br />
[[Image:SU 26sepgels.png]]<br />
<br />
[[Image:SU 26sepgels 1.png]]<br />
<br />
Results: All colonies correct! Expected as both insert and vector had been gel purified.<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/File:SU_26sepgels_1.pngFile:SU 26sepgels 1.png2010-10-27T22:03:18Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/File:SU_26sepgels.pngFile:SU 26sepgels.png2010-10-27T22:02:56Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/Team/GalleryTeam:Stockholm/Team/Gallery2010-10-27T21:57:50Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Team}}<br />
<br />
{| width="90%"<br />
|[[Image:Bildlabbet.JPG|400px|thumb|left|Group picture for the reportage by the national radio station P1]]<br />
|[[Image:Bildlabbet1.JPG|400px|thumb|left|Group picture for the reportage by the national radio station P1]]<br />
|-<br />
|[[Image:Vetenskapsradion-artikel.jpg|400px|thumb|left|Our website after the reportage by the national radio station P1]]<br />
|[[Image:Vitiligo_007.JPG|400px|thumb|left|Chairman of Vitiligo association Peter Björk and Nina]]<br />
|}<br />
<br />
{| width="90%"<br />
|[[Image:a.jpg|200px|thumb|center]]<br />
|[[Image:rör.jpg|200px|thumb|center]] <br />
|[[Image:3a.jpg|200px|thumb|center]] <br />
|[[Image:N.jpg|200px|thumb|center]]<br />
|-<br />
|[[Image:M.jpg|200px|thumb|center]]<br />
|[[Image:C.jpg|200px|thumb|center]]<br />
|[[Image:D.jpg|200px|thumb|center]]<br />
|[[Image:X.jpg|200px|thumb|center]]<br />
|-<br />
|[[Image:7.jpg|200px|thumb|center]]<br />
|[[Image:o.jpg|200px|thumb|center]]<br />
|[[Image:p.jpg|200px|thumb|center]]<br />
|[[Image:BL21_fluo_restreak_18jul.png|200px|thumb|center]]<br />
|-<br />
|[[Image:8.jpg|200px|thumb|center]]<br />
|[[Image:1a.jpg|200px|thumb|center]] <br />
|[[Image:2a.jpg|200px|thumb|center]]<br />
|[[Image:4.jpg|200px|thumb|center]]<br />
|}<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/27_September_2010Team:Stockholm/27 September 20102010-10-27T21:53:22Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
<br />
===Cloning and assembly===<br />
====Transformation results====<br />
''From 25/9 transformations''<br />
<br />
Good colony yield on all plates. Good white:red colony ratio on pEX plates (Constructs 1, 2, 3 and 4).<br />
<br />
====Colony PCR====<br />
Picked colonies for colony PCR.<br />
#'''pEX.N-LMWP&sdot;SOD&sdot;His (K):''' 1-2<br />
#'''pEX.N-TAT&sdot;SOD&sdot;His:''' 1-2<br />
#'''pEX.N-Tra10&sdot;SOD&sdot;His:''' 1-2<br />
#'''pEX.N-LMWP&sdot;SOD&sdot;His (C):''' 1-2<br />
#'''pSB1K3.N-LMWP&sdot;SOD&sdot;His.RBS.yCCS:''' 1-4<br />
#'''pSB1K3.N-TAT&sdot;SOD&sdot;His.RBS.yCCS:''' 1-4<br />
#'''pSB1K3.N-Tra10&sdot;SOD&sdot;His.RBS.yCCS:''' 1-4<br />
#'''pSB1C3.N-LMWP&sdot;SOD&sdot;His.RBS.yCCS:''' 1-4<br />
#'''BL21 pEX.N-TAT&sdot;SOD&sdot;His 3:''' 1-2<br />
#'''BL21 pEX.N-TAT&sdot;SOD&sdot;His 4:''' 1-2<br />
<br />
Standard colony PCR protocol.<br />
*Elongation time: 2:00<br />
<br />
====Gel verification====<br />
<br />
'''Gel 1'''<br /><br />
1 % agarose, 110 V<br />
<br />
'''Gel 2'''<br /><br />
0.8 % agarose, 90 V<br />
<br />
'''Expected bands'''<br /><br />
#744 bp<br />
#735 bp<br />
#765 bp<br />
#744 bp<br />
#1645 bp<br />
#1636 bp<br />
#1666 bp<br />
#1645 bp<br />
#735 bp<br />
#735 bp<br />
<br />
'''Results'''<br /><br />
Gels run too far (no data). New gels will be run tomorrow.<br />
<br />
===Sequencing===<br />
Samples prepared 25/9 were sent for sequencing. Sequencing information added to the 25/9 notebook page.<br />
<br />
<br />
<br />
<br />
== Mimmi ==<br />
<br />
=== Over expression ===<br />
<br />
{|<br />
| Start cultures<br />
|-<br />
| *3ml LB<sub>AMP</sub> + tip from glycerol stock<br />
|-<br />
| *Grow ON in 37&deg;C, 225rpm<br />
|-<br />
| '''DNA'''<br />
|-<br />
| pEX.SOD<br />
|-<br />
| pEX.yCCS<br />
|-<br />
| pEX.SOD.his<br />
|-<br />
| pEX.his.SOD<br />
|}<br />
<br />
==Nina==<br />
<br />
===Sequencing===<br />
<br />
I send two samples for sequencing. 15 ul sample and 1.5 ul Forward primer.<br />
<br />
*pMa #3 Tyrosinase_N ASB0045 694<br />
*Tyrosinase in bank vector K ASB0045 695<br />
<br />
===Digestion===<br />
<br />
Digestion of Fusion (1/9):<br />
<br />
*H2O 15 ul<br />
*DNA 2 ul<br />
*Fastdigest buffer 10X 2 ul<br />
*Restriction enzyme NgoMIV 1 ul<br />
*Restriction enzyme SpeI 1 ul (Add after 1.5 h in 37 °C & incubate in additional 30 min)<br />
<br />
Digestion of Fusion (1/9):<br />
<br />
*H2O 15 ul<br />
*DNA 2 ul<br />
*Fastdigest buffer 10X 2 ul<br />
*Restriction enzyme AgeI 1 ul<br />
*Restriction enzyme EcoRI 1 ul (Add after 1.5 h in 37 °C & incubate in additional 30 min)<br />
<br />
Inactivate 20 min 80 °C all samples<br />
<br />
Digestion of IgG #5_E_pMa:<br />
<br />
*H2O 15 ul<br />
*DNA 2 ul<br />
*Fastdigest buffer 10X 2 ul<br />
*Restriction enzyme NgoMIV 1 ul<br />
*Restriction enzyme PstI 1 ul (Add after 1.5 h in 37 °C & incubate in additional 30 min)<br />
<br />
<br />
Digestion of IgG #5_E_pMa:<br />
<br />
*H2O 15 ul<br />
*DNA 2 ul<br />
*Fastdigest buffer 10X 2 ul<br />
*Restriction enzyme AgeI 1 ul<br />
*Restriction enzyme EcoRI 1 ul (Add after 1.5 h in 37 °C & incubate in additional 30 min)<br />
<br />
<br />
Digestion of Protein A#5_E_pMa:<br />
<br />
*H2O 15 ul<br />
*DNA 2 ul<br />
*Fastdigest buffer 10X 2 ul<br />
*Restriction enzyme AgeI 1 ul<br />
*Restriction enzyme EcoRI 1 ul (Add after 1.5 h in 37 °C & incubate in additional 30 min)<br />
<br />
Digestion of Protein A#5_CPPs_N:<br />
<br />
*H2O 15 ul<br />
*DNA 2 ul<br />
*Fastdigest buffer 10X 2 ul<br />
*Restriction enzyme XbaI 1 ul<br />
*Restriction enzyme PstI 1 ul <br />
<br />
Incubate in 37 °C for 30 min.<br />
<br />
===Concentration measurement===<br />
<br />
I measured conc of the samples for preparation of the following ligation.<br />
<br />
[[Image:Aq31.jpg|300px]]<br />
<br />
===Ligation===<br />
<br />
The ligation was according to:<br />
<br />
[[Image:Aq32.jpg|700px]]<br />
<br />
I incubated the ligations in a water bath, 22 °C in 15 min. <br />
<br />
==Johan==<br />
<br />
===MIniprep===<br />
Two his-bFGF and two bFGF-his samples.<br />
<br />
All ~400 ng/µl<br />
<br />
===Digestion===<br />
<br />
2 µl DNA<br />
2 µl 10x fastbuffer<br />
(1 µl BamHI)<br />
15 µl H2O<br />
<br />
===Gel===<br />
<br />
Cut & uncut<br />
<br />
[[Image:SU 27sepgel.png]]<br />
<br />
Results: All showed good results<br />
<br />
===Cut bFGF-his===<br />
<br />
3 µl DNA<br />
<br />
1 µl NgoMIV<br />
<br />
1 µl PstI<br />
<br />
2 µl 10x fastbuffer<br />
<br />
13 µl H2O<br />
<br />
Then heat-inactivation<br />
<br />
===Ligation===<br />
<br />
Of cut bFGF-his into already cut TAT_N vector<br />
<br />
5 µl bFGF<br />
<br />
1 µl vector<br />
<br />
2 µl 10x fastbuffer<br />
<br />
1 µl T4 ligase<br />
<br />
11 µl H2O<br />
<br />
1h 37 °C<br />
<br />
===Transformation<br />
<br />
3 µl of all constructs was transformed into top10 cells<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/File:SU_27sepgel.pngFile:SU 27sepgel.png2010-10-27T21:48:57Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/29_September_2010Team:Stockholm/29 September 20102010-10-27T21:40:34Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
<br />
===Sequencing results===<br />
Sequencing results from 27/9 samples arrived and were analyzed by nucleotide BLAST.<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!Construct<br />
!Sequencing<br />result<br />
!Blastn<br />result<br />
!Comment<br />
|-<br />
|pEX.N-TAT&sdot;SOD&sdot;His 3<br />
|[[media:PEX.nTAT.SOD.his3_premix_fasta_29sep.txt|pEX.nTAT.SOD.his 3_premix]]<br />
|[[media:Blastn_pEX.nTAT.SOD.his_3_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:green">Verified'''</span>. Three silent mutations in His tag; does not alter a.a. sequence.<br />
|-<br />
|pEX.N-TAT&sdot;SOD&sdot;His 4<br />
|[[media:PEX.nTAT.SOD.his4_premix_fasta_29sep.txt|pEX.nTAT.SOD.his 4_premix]]<br />
|[[media:Blastn_pEX.nTAT.SOD.his_4_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:red;">Not verified</span>'''. Incorrect construct.<br />
|-<br />
|pSB1A2.RBS.yCCS 3<br />
|[[media:PSB1A2.RBS.yCCS3_premix_fasta_29sep.txt|pSB1A2.RBS.yCCS 3_premix]]<br />
|[[media:Blastn_pSB1A2.RBS.yCCS3_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:orange">Partly verified</span>'''. Three mutations found: (1) Single base deletion in yCCS sequence, causing a frame shift and an extended open reading frame; (2) Insertion between SpeI and PstI, not affecting expression of cloning; (3) Point mutation in PstI site, disabling PstI restriction. Mutations (1) and (3) are both quite unsure, as the sequencing quality in this area is very low. New sequencing from VR will be sent.<br />
|-<br />
|pSB1A2.RBS.yCCS 4<br />
|[[media:PSB1A2.RBS.yCCS4_premix_fasta_29sep.txt|pSB1A2.RBS.yCCS 4_premix]]<br />
|[[media:Blastn_pSB1A2.RBS.yCCS4_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:orange">Partly verified</span>'''. Four mutations found: (1) Point mutation changing a K codon to T; (2) Single base deletion in yCCS sequence, causing frame shift; (3) Insertion between SpeI and PstI, not affecting expression of cloning; (4) Point mutation in PstI site, disabling PstI restriction. See comment <br />
|-<br />
|pSB1K3.N-TAT&sdot;SOD&sdot;His 4<br />
|[[media:Blastn_pSB1K3.nTAT.SOD.his4_premix_29sep.txt|pSB1K3.nTAT.SOD.his4_premix]]<br />
|[[media:Blastn_pSB1K3.nTAT.SOD.his4_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:green">Verified</span>'''. Three silent mutations in His tag; does not alter a.a. sequence.<br />
|-<br />
|pSB1K3.N-TAT&sdot;SOD&sdot;His 5<br />
|[[media:Blastn_pSB1K3.nTAT.SOD.his5_premix_29sep.txt|pSB1K3.nTAT.SOD.his5_premix]]<br />
|[[media:Blastn_pSB1K3.nTAT.SOD.his5_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:green">Verified</span>'''. Three silent mutations in His tag; does not alter a.a. sequence.<br />
|-<br />
|pSB1K3.N-Tra10&sdot;SOD&sdot;His 5<br />
|[[media:PSB1K3.nTra10.SOD.his5_premix_fasta_29sep.txt|pSB1K3.nTra10.SOD.his5_premix]]<br />
|[[media:Blastn_pSB1K3.nTra10.SOD.h5_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:green">Verified</span>'''. Three silent mutations in His tag; does not alter a.a. sequence.<br />
|-<br />
|-<br />
|pSB1K3.N-LMWP&sdot;SOD&sdot;His 1<br />
|[[media:PSB1K3.nLMWP.SOD.his1_premix_fasta_29sep.txt|pSB1K3.nLMWP.SOD.his1_premix]]<br />
|[[media:Blastn_pSB1K3.nLMWP.SOD.hi1_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:green">Verified</span>'''. Three silent mutations in His tag; does not alter a.a. sequence.<br />
|-<br />
|-<br />
|pSB1C3.N-LMWP&sdot;SOD&sdot;His 1<br />
|[[media:PSB1C3.nLMWP.SOD.his1_premix_fasta_29sep.txt|pSB1C3.nLMWP.SOD.his1_premix]]<br />
|[[media:Blastn_pSB1C3.nLMWP.SOD.hi1_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:red">Not verified'''</span>. Incorrect construct.<br />
|-<br />
|pSB1C3.N-LMWP&sdot;SOD&sdot;His 4<br />
|[[media:PSB1C3.nLMWP.SOD.his4_premix_fasta_29sep.txt|pSB1C3.nLMWP.SOD.his4_premix]]<br />
|[[media:Blastn_pSB1C3.nLMWP.SOD.hi4_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:red">Not verified'''</span>. Incorrect construct.<br />
|-<br />
|pEX.SOD<br />
|[[media:PEX.SOD_premix_fasta_29sep.txt|pEX.SOD_premix]]<br />
|[[media:Blastn_pEX.SOD_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:orange">Partly verified'''</span>. Insertion found between SpeI and PstI; does not affect expression.<br />
|-<br />
|pEX.yCCS 5<br />
|[[media:PEX.yCCS_5_premix_fasta.txt|pEX.yCCS 5_premix]]<br />
|[[media:Blastn_pEX.yCCS_5_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:orange">Partly verified'''</span>. Insertion found between SpeI and PstI; does not affect expression.<br />
|-<br />
|pEX.SOD&sdot;His<br />
|[[media:PEX.SOD.his_premix_fasta_29sep.txt|pEX.SOD.his_premix]]<br />
|[[media:Blastn_pEX.SOD.his_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:green">Verified'''</span>. Three silent mutations in His tag; does not alter a.a. sequence.<br />
|-<br />
|pEX.His&sdot;SOD<br />
|[[media:PEX.his.SOD_premix_29sep.txt|pEX.his.SOD_premix]]<br />
|[[media:Blastn_pEX.his.SOD_premix_29sep.txt|Blastn]]<br />
|'''<span style="color:green">Verified'''</span>. Three silent mutations in His tag; does not alter a.a. sequence.<br />
|}<br />
<br />
===Plasmid prep===<br />
''From 28/9 ON cultures''<br />
<br />
Spun down ON cultures 10 min, 3000 x ''g''. Decanted supernatant and stored pellets in -20 &deg;C ON for later plasmid prep.<br />
<br />
===Sorting glycerol stocks===<br />
Started sorting our glycerol stocks into a spreadsheet for future reference.<br />
<br />
==Nina==<br />
<br />
===Agarose gel verificaion===<br />
<br />
I ran an agarose gel 1 % 100 V on the colony PCR products from yesterday to check if I had any inserts.<br />
<br />
Ladder: MassRuler™ DNA Ladder Mix, ready-to-use, 80-10,000 bp <br />
<br />
[[Image:laddermixmassruler.jpg|200px]]<br />
<br />
Arrangement on gel:<br />
<br />
[[Image:Aq20.jpg]] <br />
<br />
From left to right: 1-5 fusion EA, 1-5 Fusion NS, 1-5 IgG LMWP, 1-5 IgG_TAT_N, 1-5 IgG_Tra10_N, 1-5 IgG_TAT_C, 1-5 Protein A_TAT_C, 1-5 pEX, 1-9 pEX<br />
<br />
[[Image:Aq21.jpg|200px]] <br />
<br />
[[Image:Aq22.jpg|200px]]<br />
<br />
[[Image:Aq23.jpg|200px]]<br />
<br />
===Colony PCR===<br />
<br />
I ran a new colony PCR on the samples I did not have a possitive result on from the gel above. <br />
<br />
The samples for this screen are: <br />
<br />
IgG_LMWP_N, _TAT_N, _Tra10_N, protein A_LMWP_N_pex, _TAT_N_pex & _Tra10_N_pex<br />
<br />
I screened 8 colonies/dish. <br />
<br />
PCR master mix:<br />
<br />
*MgCl2 8ul<br />
*phusion buffer 5X 80ul<br />
*dNTP 8ul<br />
*primerR 24ul<br />
*primerF 24ul<br />
*polymerase 8ul<br />
*H2O 240ul<br />
<br />
===Agarose gel verificaion===<br />
<br />
I ran an agarose gel 1 % 100 V on the colony PCR products from yesterday to check if I had any inserts.<br />
<br />
Ladder: MassRuler™ DNA Ladder Mix, ready-to-use, 80-10,000 bp <br />
<br />
[[Image:laddermixmassruler.jpg|200px]]<br />
<br />
Arrangement on gel:<br />
<br />
[[Image:Aq24.jpg]]<br />
<br />
[[Image:Aq25.jpg|200px]]<br />
<br />
[[Image:Aq26.jpg|200px]]<br />
<br />
[[Image:Aq27.jpg|200px]]<br />
<br />
===Overnight culture===<br />
<br />
I inoculated Fusion EA colony 1 & 3 and Fusion NS colony 1 & 2 each in 12 ml LB with 24 ul chloramphenicol resistance. <br />
<br />
===Digestion===<br />
<br />
I digested IgG protease and protein A in the bank vector C in order to perform a gel clean up of the genes and insert them into a pMa-His AS vector. <br />
<br />
Digestion:<br />
<br />
*H2O 15 ul<br />
*DNA 2 ul<br />
*Fastdigest buffer 10X 2 ul<br />
*Restriction enzyme NgoMIV 1 ul<br />
*Restriction enzyme SpeI 1 ul (Add after 1.5h incubation in 37 °C)<br />
<br />
<br />
<br />
== Mimmi ==<br />
<br />
=== Over expression ===<br />
<br />
*Load gel <br />
***dilute 3h samples 1:4<br />
***load 8µl in the pre-wells<br />
***the comb takes up 4µl to load on the gel<br />
***run PhastGel 20%<br />
<br />
{| <br />
! well<br />
! sample<br />
| rowspan="6" | [[Image:Place_for_picture.jpg|100px|thumb|left|]]<br />
! well<br />
! sample<br />
| rowspan="6" | [[Image:Place_for_picture.jpg|100px|thumb|left|]]<br />
|-<br />
| 1<br />
| ladder<br />
| 1<br />
| ladder<br />
|-<br />
| 2<br />
| SOD 0h<br />
| 2<br />
| SOD.his 0h<br />
|-<br />
| 3<br />
| SOD 3h<br />
| 3<br />
| SOD.his 3h<br />
|-<br />
| 4<br />
| yCCS 0h<br />
| 4<br />
| his.SOD 0h<br />
|-<br />
| 5<br />
| yCCS 3h<br />
| 5<br />
| his.SOD 3h<br />
|}<br />
<br />
==Johan==<br />
<br />
===Cut CPP-vector===<br />
<br />
5 µl vector ~1µg<br />
<br />
1 µl NgoMIV<br />
<br />
1 µl EcoRI<br />
<br />
2 µl 10x fastbuffer<br />
<br />
12 µl H2O<br />
<br />
Then heat-inactivation of enzymes<br />
<br />
===Cut his-bFGF ===<br />
<br />
5 µl his-bFGF (1,5 µl -> 0,3 µg bFGF)<br />
<br />
1 µl AgeI<br />
<br />
1 µl EcoRI<br />
<br />
2 µl 10x fastbuffer<br />
<br />
12 µl H2O<br />
<br />
Then heat-inactivation of enzymes<br />
<br />
===Ligation his-bFGF into CPP-vector===<br />
<br />
5 µl his-bFGF<br />
<br />
0,5 µl cpp-vector<br />
<br />
2 µl buffer<br />
<br />
1 µl T4 ligase<br />
<br />
11,5 µl H2O<br />
<br />
===Transformation===<br />
<br />
3 µl of all constructs was transformed into top10 cells<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/30_September_2010Team:Stockholm/30 September 20102010-10-27T21:20:51Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
<br />
===Transfer of nCPP&sdot;SOD&sdot;His.RBS.yCCS operon to pEX===<br />
<br />
====Digestions====<br />
#pSB1K3.nTAT&sdot;SOD&sdot;His.RBS.yCCS<br />
#*Clones 2 & 3<br />
#pSB1K3.nTra10&sdot;SOD&sdot;His.RBS.yCCS<br />
#*Clones 1 & 2<br />
#pSB1K3.nLMWP&sdot;SOD&sdot;His.RBS.yCCS<br />
#*Clones 2 & 3<br />
<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
|&nbsp;<br />
|align="center" width="50"|'''1''':2<br />
|align="center" width="50"|'''1''':3<br />
|align="center" width="50"|'''2''':1<br />
|align="center" width="50"|'''2''':2<br />
|align="center" width="50"|'''3''':2<br />
|align="center" width="50"|'''3''':3<br />
|-<br />
|10X FastDigest buffer<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|-<br />
|DNA (1 &mu;g)<br />
|align="center"|5.2<br />
|align="center"|4.1<br />
|align="center"|2.5<br />
|align="center"|3.3<br />
|align="center"|4<br />
|align="center"|4.1<br />
|-<br />
|dH<sub>2</sub>O<br />
|align="center"|10.8<br />
|align="center"|11.9<br />
|align="center"|13.5<br />
|align="center"|12.7<br />
|align="center"|12<br />
|align="center"|11.9<br />
|-<br />
|FD XbaI<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|-<br />
|FD PstI<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|-<br />
|&nbsp;<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
|}<br />
*Incubation: 37 &deg;C, 1.45<br />
*Inactivation: 80 &deg;C, 20 min<br />
<br />
====Ligations====<br />
*Vector: [Dig pEX.RFP X+P<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
|&nbsp;<br />
|align="center" width="50"|pEX.'''1''':2<br />
|align="center" width="50"|pEX.'''1''':3<br />
|align="center" width="50"|pEX.'''2''':1<br />
|align="center" width="50"|pEX.'''2''':2<br />
|align="center" width="50"|pEX.'''3''':2<br />
|align="center" width="50"|pEX.'''3''':3<br />
|-<br />
|10X T4 Ligase buffer<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|-<br />
|Vector DNA<br />
|align="center"|1.5<br />
|align="center"|1.5<br />
|align="center"|1.5<br />
|align="center"|1.5<br />
|align="center"|1.5<br />
|align="center"|1.5<br />
|-<br />
|Insert DNA<br />
|align="center"|8<br />
|align="center"|8<br />
|align="center"|8<br />
|align="center"|8<br />
|align="center"|8<br />
|align="center"|8<br />
|-<br />
|dH<sub>2</sub>O<br />
|align="center"|7.5<br />
|align="center"|7.5<br />
|align="center"|7.5<br />
|align="center"|7.5<br />
|align="center"|7.5<br />
|align="center"|7.5<br />
|-<br />
|T4 DNA ligase<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|-<br />
|&nbsp;<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
|}<br />
*Incubation: 22 &deg;C, 15 min<br />
<br />
====Transformation====<br />
Quick transformation<br />
*1 &mu;l ligation mix<br />
*50 &mu;l 0.1 M IPTG<br />
**pEX.1:2 (pEX.nTAT&sdot;SOD&sdot;His.RBS.yCCS 2)<br />
**pEX.1:3 (pEX.nTAT&sdot;SOD&sdot;His.RBS.yCCS 2)<br />
**pEX.2:1 (pEX.nTra10&sdot;SOD&sdot;His.RBS.yCCS 1)<br />
**pEX.2:2 (pEX.nTra10&sdot;SOD&sdot;His.RBS.yCCS 2)<br />
**pEX.3:2 (pEX.nLMWP&sdot;SOD&sdot;His.RBS.yCCS 2)<br />
**pEX.3:3 (pEX.nLMWP&sdot;SOD&sdot;His.RBS.yCCS 3)<br />
<br />
===Transformation of BL21===<br />
Quick transformation<br />
*50 &mu;l competent cells<br />
*0.5 &mu;l plasmid<br />
**pEX.nTra10&sdot;SOD&sdot;His<br />
**pEX.nLMWP&sdot;SOD&sdot;His<br />
<br />
===ON cultures===<br />
*3 ml LB + appropriate antibiotic; 30 &deg;C<br />
**pEX.nTAT&sdot;SOD&sdot;His (Top10; Amp 100)<br />
**pSB1K3.BBa_J04450 (Top10; Km 50)<br />
<br />
----<br />
==Nina==<br />
<br />
===Send for sequencing===<br />
<br />
I sent samples for sequencing and the mixtures were 15 ul sample and 1.5 ul forward bank vector verification primer.<br />
<br />
*Protein A in LMWP_Ntermin ASB0045 680<br />
*Protein A in TAT_Ntermin ASB0045 679<br />
*Protein A in Tra10_Ntermin ASB0045 678<br />
<br />
===Digestion of protein A and peX vector===<br />
<br />
I got a mini prep of the peX vector from Andreas with a concentration of 55.52 ng/ul. I cut this vector and protein A in CPPs_N vectors.<br />
<br />
peX:<br />
<br />
*Fast digest buffer 10X 3.4 ul<br />
*DNA 30 ul<br />
*Restriction enzyme XbaI 2 ul<br />
*Restriction enzyme PstI 2 ul <br />
<br />
Incubated in 37 °C for 30 min.<br />
<br />
Protein A:<br />
<br />
*Fast digest buffer 10X 2.2 ul<br />
*DNA 20 ul<br />
*Restriction enzyme XbaI 1 ul<br />
*Restriction enzyme PstI 1 ul <br />
<br />
Incubated in 37 °C for 30 min.<br />
<br />
===Agarose gel on digests===<br />
<br />
I ran the digested products on an agarose gel 1 % 100 V. <br />
<br />
Ladder: MassRuler™ DNA Ladder Mix, ready-to-use, 80-10,000 bp <br />
<br />
[[Image:laddermixmassruler.jpg|200px]]<br />
<br />
Arrangement on gel:<br />
<br />
[[Image:B1.jpg]]<br />
<br />
===Gel clean up===<br />
<br />
I performed a gel clean up according to the procedures described in protocols. <br />
<br />
On the gel it looked like it was only the peX vector that had been cut correctly and thus the protein A didn't seem to have been previously inserted correctly into the vectors holding the CPPs on the N-terminal. Therefore I only cut out and gel clean the peX vector for later use in overexpressions of our proteins. <br />
<br />
The measurements of the cut gel bands, addition of kit solutions and incubation time:<br />
<br />
*All bands had a weight of approximately 300 mg. 300 mg * 3 = 900 ul QXI <br />
<br />
*I added 30 ul of QIAEXII to all samples <br />
<br />
*All samples were incubated for 5 minutes at 50 °C<br />
<br />
===Miniprep===<br />
<br />
I performed a mini prep on Fusion EA # 1 and 3. Fusion AS I have to put a new overnight culture of since I accidentally dropped the solution and the material is now lost. <br />
<br />
The procedure was according to the method described in protocols.<br />
<br />
===Overnight culture===<br />
<br />
I inoculated IgG protease_Tra10 # 4 & 6 in each 12 ml LB falcon tubes with 24 ul chloramphenicol.<br />
<br />
===Digestion of vectors with CPP===<br />
<br />
I digested bank vectors holding LMWP_N, TAT_N, Tra10_N, CPP1_C, TAT_C and CPP3_C to become followed by a gel clean up. <br />
<br />
Digestion:<br />
<br />
*DNA 20 ul<br />
*Fast digest buffer 10X 2.2 ul<br />
<br />
CPPs-Ntermin:<br />
<br />
*Restriction enzyme AgeI 1 ul<br />
*Restriction enzyme PstI 1 ul (Added after 1.5 h in 37 °C)<br />
<br />
CPPs-Ctermin:<br />
<br />
*Restriction enzyme NgoMIV 1 ul<br />
*Restriction enzyme EcoRI 1 ul (Added after 1.5 h in 37 °C)<br />
<br />
===Agarose gel on digests===<br />
<br />
I ran the digests on an agarose 1 % gel 80 V.<br />
<br />
Ladder: MassRuler™ DNA Ladder Mix, ready-to-use, 80-10,000 bp <br />
<br />
[[Image:laddermixmassruler.jpg|200px]]<br />
<br />
Arragement on gel: <br />
<br />
[[Image:Ss.jpg]] <br />
<br />
===Gel clean up===<br />
<br />
I performed a gel clean up according to the procedure described in protocols.<br />
<br />
The measurements of the cut gel bands, addition of kit solutions and incubation time:<br />
<br />
*All bands had a weight of approximately 150 mg. 150 mg * 3 = 450 ul QXI <br />
<br />
*I added 30 ul of QIAEXII to all samples <br />
<br />
*All samples were incubated for 5 minutes at RT<br />
<br />
===Concentration measurments===<br />
<br />
I measured with a spectrophotometer the concentration of the gel clean up samples. <br />
<br />
[[Image:Ss1.jpg]]<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
== Mimmi ==<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
----<br />
=== Expression ===<br />
<br />
*yCCS expression looks very fine!<br />
<br />
*no SOD<br />
**much to low concentration loaded?<br />
**try E-colves for more air<br />
**taking samples after both 0.5h and 3h if the protein becomes degraded after time<br />
----<br />
<br />
<br />
=== SOD operon ===<br />
<br />
==== Plasmid prep. and sequencing ====<br />
<br />
*Follow E.T.Z.N.A plasmid prep. protocol<br />
**wash 1x wash buffer<br />
**eluate in 50µl<br />
<br />
*Measure DNA concentration<br />
<br />
<br />
pSB1K3.nLMWP.SOD.his.RBS.yCCS 2<br />
<br />
pSB1K3.nLMWP.SOD.his.RBS.yCCS 3<br />
<br />
pSB1K3.nTAT.SOD.his.RBS.yCCS 2<br />
<br />
pSB1K3.nTAT.SOD.his.RBS.yCCS 3<br />
<br />
pSB1K3.nTra10.SOD.his.RBS.yCCS 1<br />
<br />
pSB1K3.nTra10.SOD.his.RBS.yCCS 2<br />
<br />
<br />
*Send for sequencing...<br />
<br />
<br />
<br />
=== Over expression === <br />
<br />
*Start ON culture<br />
**SOD<br />
**SOD.his<br />
**his.SOD<br />
**nTAT.SOD.his<br />
<br />
==Johan==<br />
<br />
===Colony PCR screen===<br />
<br />
Of all constructs in the CPP-vector. tra10-bFGF-his, tat-bFGF-his, lmwp-bFGF-his, his-bFGF-tra10, his-bFGF-tat, his-bFGF-lmwp<br />
<br />
0,5 µl pol<br />
<br />
0,5 µl dNTP<br />
<br />
5 µl 5x buffer<br />
<br />
2 µl VF2 primer<br />
<br />
2 µl VR primer<br />
<br />
15 µl H2O<br />
<br />
40 colonies in total, 40x mastermix<br />
<br />
===Gel===<br />
<br />
[[Image:SU 30sepgels.png]]<br />
<br />
[[Image:SU 30sepgels 1.png]]<br />
<br />
[[Image:SU 30sepgels 2.png]]<br />
<br />
Compilation of all constructs. All construct had at least one band of correct size. One of each and two for tat-bFGF-his was put for overnight culture.<br />
<br />
===Ligation for Nina===<br />
<br />
Did a ligation for Nina<br />
<br />
One cut construct of IgG, and two cut constructs of Protein A. All had a concentration of ~50 ng/µl.<br />
<br />
19 µl insert<br />
<br />
0,5 µl pMA (vector with histag) -> 25 ng<br />
<br />
2 µl ligase<br />
<br />
2 µl buffer<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/File:SU_30sepgels_2.pngFile:SU 30sepgels 2.png2010-10-27T21:13:53Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/File:SU_30sepgels_1.pngFile:SU 30sepgels 1.png2010-10-27T21:13:31Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/File:SU_30sepgels.pngFile:SU 30sepgels.png2010-10-27T21:12:58Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/1_October_2010Team:Stockholm/1 October 20102010-10-27T21:07:08Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
===LB agar plates===<br />
*20 x 100 &mu;g/ml Amp LB agar plates<br />
<br />
===Assembly of His&sdot;SOD&sdot;cCPP constructs===<br />
Digested pMA.His&sdot;SOD constructs for later assembly into cCPP plasmids, digested by Johan.<br />
<br />
====Digestion====<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
|&nbsp;<br />
!width="50"|pMA.His&sdot; SOD<br />
|-<br />
|10X FastDigest buffer<br />
|align="center"|3<br />
|-<br />
|DNA (3 &mu;g)<br />
|align="center"|7.5<br />
|-<br />
|dH<sub>2</sub>O<br />
|align="center"|17.5<br />
|-<br />
|FD EcoRI<br />
|align="center"|1<br />
|-<br />
|FD AgeI<br />
|align="center"|1<br />
|-<br />
|&nbsp;<br />
!30 &mu;l<br />
|}<br />
*Incubation: 37 &deg;C, 0:30<br />
*Inactivation: 80 &deg;C, 20 min<br />
<br />
Stored in -20 &deg;C for later ligation.<br />
<br />
----<br />
==Nina==<br />
<br />
===Miniprep===<br />
<br />
I performed a miniprep on IgG protease_Tra10_Ntermin#4 and Fusion_NS#2 according to the procedure that is described in protocols. <br />
<br />
===Send for sequencing===<br />
<br />
I sent two samples for seqeuncing. The mixture was 15 ul sample and 1.5 ul forward bank vector verification primer VF.<br />
<br />
*IgG protease_Tra10_Ntermin#4 ASB0045 682 <br />
<br />
*Fusion_NS#2 ASB0045 681<br />
<br />
===Overnight culture===<br />
<br />
I inoculated 12 ml LB and 24 ul chloramphenicol with IgG protease_Tra10_Ntermin#6 again since I acidentally droped the previous sample and therefore lost it. <br />
<br />
===iGEM Uppsala collaboration===<br />
<br />
I drove to Uppsala and started a collaboration with their team. I obtained a construct that they want me/our group to PCR with verification primers (VF2 & VR) and run on an agarose gel. I in turn gave them the tyrosinase gene to also amplify via PCR but with own designed primers. <br />
<br />
*Uppsala iGEM team's PCR master mix and prgm:<br />
<br />
[[Image:Pq.jpg]]<br />
<br />
<br />
<br />
<br />
<br />
<br />
== Mimmi ==<br />
<br />
=== Over expression === <br />
<br />
*Start culture (9:30)<br />
**20ml LB + 200µl culture from ON<br />
<br />
*At OD=0.6 add IPTG 1mM (checked at 12:00, allready too high OD, had to dilute...)<br />
<br />
*Take samples at<br />
**0h<br />
**30min (50min)<br />
**3h<br />
<br />
*Spinn down and resuspend in 100µl SDS-buffer<br />
**dilute 3h samples 1:4<br />
**heat at 95&deg;C for 10min<br />
**freeze<br />
<br />
*Save pellet from the culture to purify protein<br />
<br />
==Johan==<br />
<br />
Realized I had put in the wrong antibiotic in my overnight cultures (doh!). Made new overnight cultures for tomorrow.<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/4_October_2010Team:Stockholm/4 October 20102010-10-27T21:05:02Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
===Transfer of pEX.nCPP⋅SOD⋅His to BL21===<br />
====Gel verification====<br />
[[image:ColPCR_BL21CPP_4oct.png|200px|thumb|right|'''Colony PCR gel verification of BL21 clones carrying pEX.nLMWP&sdot;SOD&sdot;His (1) and pEX.nTra10&sdot;SOD&sdot;His (2) plasmids.'''<br />4 &mu;l &lambda;; 5 &mu;l sample;<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
''Re-run of 2/10 BL21 samples''<br />
<br />
#BL21 pEX.nLMWP⋅SOD⋅His: A & B <br />
#BL21 pEX.nTra10⋅SOD⋅His: A & B <br />
<br />
1 % agarose, 120 V<br />
<br />
'''Expected bands:'''<br />
#744 bp<br />
#765 bp<br />
<br />
'''Results'''<br />
#Both clones verified<br />
#Clone A verified; weak band for clone B<br />
<br />
====ON cultures====<br />
*3 ml LB, 30 &deg;C<br />
*# A (BL21 pEX.nLMWP&sdot;SOD&sdot;His)<br />
*# A (BL21 pEX.nTra10&sdot;SOD&sdot;His)<br />
<br />
===Transfer of nCPP⋅SOD⋅His.RBS.yCCS operon to pEX===<br />
====Colony PCR====<br />
Picked 2 new colonies of each of the two constructs transformed 30/8:<br />
*5. pEX.nTra10⋅SOD⋅His.RBS.yCCS 1: A & B<br />
*6. pEX.nTra10⋅SOD⋅His.RBS.yCCS 2: A & B <br />
<br />
Standard colony PCR settings<br />
*Elongation time: 2:00<br />
<br />
====Gel verification====<br />
[[image:ColPCR_CPP-SH-Ry_operon_4oct.png|200px|thumb|right|'''Colony PCR gel verification of pEX.nCPP&sdot;SOD&sdot;His.RBS.yCCS operon clones.'''<br />4 &mu;l &lambda;; 5 &mu;l sample;<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
0.8 % agarose, 100 V<br />
<br />
'''Expected bands:'''<br />
*5. 1553 bp<br />
*6. 1553 bp<br />
<br />
'''Results'''<br />
*5. Relevant band for clone B; too large insert (double?) for clone A.<br />
*6. Relevant band for clone B; too large insert (double?) for clone A.<br />
<br />
====ON cultures====<br />
*5 ml LB, 37 &deg;C, 250 rpm<br />
** pEX.nTAT⋅SOD⋅His.RBS.yCCS 2: A<br />
** pEX.nTAT⋅SOD⋅His.RBS.yCCS 3: B<br />
** pEX.nTra10⋅SOD⋅His.RBS.yCCS 1: B<br />
** pEX.nTra10⋅SOD⋅His.RBS.yCCS 2: B<br />
** pEX.nLMWP⋅SOD⋅His.RBS.yCCS 2: B<br />
** pEX.nLMWP⋅SOD⋅His.RBS.yCCS 3: B<br />
<br />
===Verification of pSB1x3 plasmids===<br />
Due to some strange growth results with our stock plasmids (pSB1x3.BBa_J04450), I decided to verify their antibiotic resistance. Restreaked clones of the following plasmids (w/ BBa_J04450 inserts) onto Amp 100, Km 50 and Cm 25 plates:<br />
*pSB1A3<br />
*pSB1C3<br />
*pSB1K3<br />
*pSB1AC3<br />
*pSB1AK3<br />
<br />
===Assembly of His⋅SOD⋅cCPP constructs===<br />
''Continued from 1/10''<br />
<br />
Received cCPPs (cTra10, cTAT and cLMWP) in pSB1C3 plasmids, digested with EcoRI and NgoMIV, from Johan.<br />
<br />
====Ligations====<br />
<br />
*Vectors:<br />
*#Dig pSB1C3.cTra10 E+N<br />
*#Dig pSB1C3.cTAT E+N<br />
*#Dig pSB1C3.cLMWP E+N<br />
*Insert: Dig pMA.His&sdot;SOD E+A<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
|&nbsp;<br />
!width="50"|1<br />
!width="50"|2<br />
!width="50"|3<br />
|-<br />
|10X T4 Ligase buffer<br />
|align="center"|2<br />
|align="center"|2<br />
|align="center"|2<br />
|-<br />
|Vector DNA<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|-<br />
|Insert DNA<br />
|align="center"|5<br />
|align="center"|5<br />
|align="center"|5<br />
|-<br />
|dH<sub>2</sub>O<br />
|align="center"|11<br />
|align="center"|11<br />
|align="center"|11<br />
|-<br />
|T4 DNA ligase<br />
|align="center"|1<br />
|align="center"|1<br />
|align="center"|1<br />
|-<br />
|&nbsp;<br />
!20 &mu;l<br />
!20 &mu;l<br />
!20 &mu;l<br />
|}<br />
*Incubation: 22 &deg;C, 15 min<br />
<br />
====Transformations====<br />
#pSB1C3.His&sdot;SOD&sdot;cTra10<br />
#pSB1C3.His&sdot;SOD&sdot;cTAT<br />
#pSB1C3.His&sdot;SOD&sdot;cLMWP<br />
<br />
*Standard transformation<br />
**1 &mu;l<br />
**Cm 25<br />
<br />
----<br />
<br />
----<br />
==Nina==<br />
<br />
===Mini prep on IgG_Tra10_N#6===<br />
<br />
I performed a mini prep on yesterday's inoculated IgG_Tra10_N colony # 6 in 12 ml LB with 24 ul chloramphenicol. The procedure was according to the method described in protocols. <br />
<br />
===Overday culture of SOD===<br />
<br />
I put an overday culture of SOD-peX, His-SOD, SOD-His, SOD_TAT_Ntermin and as a positive control yCC-peX from Andrea's glycerol stocks in 12 ml LB with 24 ul amphicillin. I inoculated with a big pipett tip amount in order to have the culture reaching OD 0.6 during the day of laboration. <br />
<br />
The reason for why I did this culture was because I had talked to Mimmi about her overexpressions about these constructs and she hadn't got any satisfying results on her gels beside from the yCC sample (which became my positive control). I wanted therefore to check if I would also obtain her type of outcome when overexpressing the proteins of interest. <br />
<br />
===Gene digestions===<br />
<br />
I performed digestions of my genes of interest in order to do a gel clean up and follow with a ligation that should yield many positive cloning results. <br />
<br />
Digestions:<br />
<br />
*Fusion_EA_His # 1 & 3 10 ul<br />
*Fast digestion buffer 10 X 2 ul<br />
*H2O 6 ul<br />
*Restriction enzyme NgoMVI 1 ul<br />
*Restriction enzyme PstI 1 ul (Added after 1.5 h in 37 °C)<br />
<br />
<br />
*Fusion_NS_His # 2 10 ul<br />
*Fast digestion buffer 10 X 2 ul<br />
*H2O 6 ul<br />
*Restriction enzyme AgeI 1 ul<br />
*Restriction enzyme EcoRI 1 ul (Added after 1.5 h in 37 °C)<br />
<br />
<br />
*Protein A_EA_His # 5 10 ul<br />
*Fast digestion buffer 10 X 2 ul<br />
*H2O 6 ul<br />
*Restriction enzyme NgoMVI 1 ul<br />
*Restriction enzyme PstI 1 ul (Added after 1.5 h in 37 °C)<br />
<br />
<br />
*IgG protease_EA_His # 5 10 ul<br />
*Fast digestion buffer 10 X 2 ul<br />
*H2O 6 ul<br />
*Restriction enzyme NgoMVI 1 ul<br />
*Restriction enzyme PstI 1 ul (Added after 1.5 h in 37 °C)<br />
<br />
<br />
*IgG protease_Tra10_Ntermin # 4 & 6 10 ul<br />
*Fast digestion buffer 10 X 2 ul<br />
*H2O 6 ul<br />
*Restriction enzyme XbaI 1 ul<br />
*Restriction enzyme PstI 1 ul <br />
<br />
Incubate in 37 °C for 30 minutes.<br />
<br />
===Agarose gel on digests===<br />
<br />
I ran an agarose gel 1 % 100 V on the digested samples in order to check if they have been digested by the enzymes and followed by cutting the bands of interest out of the gel with a scalpel over a UV-lamp for a gel clean up. <br />
<br />
Ladder: MassRuler™ DNA Ladder Mix, ready-to-use, 80-10,000 bp <br />
<br />
[[Image:laddermixmassruler.jpg|200px]]<br />
<br />
Arrangement on gels:<br />
<br />
[[Image:Az.jpg]]<br />
<br />
===Gel clean up===<br />
<br />
I performed a gel clean up of the digested genes. All except IgGEA#5 were digested and cut out of the gel. <br />
<br />
[[Image:XD.jpg|250px]]<br />
<br />
I performed the clean up according to the method described in protocols.<br />
<br />
The measurements of the cut gel bands, addition of kit solutions and incubation time:<br />
<br />
*All bands had a weight of aproximately 0.12 g (120 mg). 120 mg * 3 = 360 ul QXI<br />
<br />
*I added 10 ul of QIAEXII to all samples<br />
<br />
*All samples were incubated for 5 minutes at RT<br />
<br />
*I performed step 11 in the procedure description<br />
<br />
===Concentration measurments===<br />
<br />
I measured with a spectrophotometer the concentration of the gel clean up samples. <br />
<br />
[[Image:Nm.jpg]]<br />
<br />
===Sending for sequencing===<br />
<br />
I sent IgG_Tra10_Ntermin#6 for sequencing. I mixed 15 ul of the miniprep sample and 1.5 ul of Forward bank vector verification primer (VF). <br />
<br />
* ASB0045 898<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
== Mimmi ==<br />
<br />
=== Protein purification === <br />
<br />
*Using Qiagen Ni-NTA Spin Kit<br />
<br />
'''Buffers'''<br />
{| border="1"<br />
| Lysis buffer NPI-10<br />
<br />
Wash buffer NPI-20<br />
<br />
| NaH<sub>2</sub>PO<sub>4</sub>&bull;H<sub>2</sub>O<br />
NaCl<br />
<br />
+<br />
imidazole<br />
|3.45g<br />
8.77g<br />
<br />
6.8g<br />
| 50mM<br />
300mM<br />
<br />
2M<br />
| \<br />
/ 500ml<br />
<br />
100ml<br />
|-<br />
| <br />
Elution buffer<br />
<br />
| NaH<sub>2</sub>PO<sub>4</sub>&bull;H<sub>2</sub>O<br />
NaCl<br />
<br />
imidazole<br />
|3.45g<br />
8.77g<br />
<br />
17g<br />
| 50mM<br />
300mM<br />
<br />
500mM<br />
| )<br />
> 500ml<br />
<br />
)<br />
|-<br />
| Lysosyme <br />
| <br />
| 0.1g<br />
| 10mg/ml<br />
| 10ml<br />
|}<br />
<br />
==Johan==<br />
<br />
===Miniprep===<br />
<br />
tra10-bFGF-his, tat-bFGF-his, tat-bFGF-his, lmwp-bFGF-his, his-bFGF-tra10, his-bFGF-lmwp<br />
<br />
All ~300 ng/µl<br />
<br />
===Digest miniprep===<br />
<br />
2 µl DNA<br />
<br />
(1 µl BamHI)<br />
<br />
2 µl 10x buffer<br />
<br />
15 µl H2O<br />
<br />
===Gel===<br />
<br />
tra10-bFGF-his, tat-bFGF-his, tat-bFGF-his, lmwp-bFGF-his, his-bFGF-tra10, his-bFGF-lmwp<br />
<br />
[[Image:SU 4oktgels.png]]<br />
<br />
Results: All constructs had one correct miniprep<br />
<br />
===Cut===<br />
<br />
The parts was cut from its vector to be ligated into pEX vector<br />
<br />
5 µl bFGF<br />
<br />
2 µl 10x buffer<br />
<br />
1 µl XbaI<br />
<br />
1 µl PstI<br />
<br />
11 µl H2O<br />
<br />
===Ligation===<br />
<br />
The vector was first treated with alkaline phosphatase for 60 min.<br />
<br />
7 µl bFGF<br />
<br />
1 µl pEX<br />
<br />
2 µl 10x buffer<br />
<br />
1 µl ligase<br />
<br />
9 µl H2O<br />
<br />
===Transformation===<br />
<br />
3 µl from all constructs was then transformed into top10 cells.<br />
<br />
===Coomassie gels===<br />
<br />
I made 2 coomassie gels to be used tomorrow<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/File:SU_4oktgels.pngFile:SU 4oktgels.png2010-10-27T20:55:42Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/5_October_2010Team:Stockholm/5 October 20102010-10-27T20:47:20Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
===Transfer of pEX.nCPP⋅SOD⋅His to BL21===<br />
====Glycerol stocks====<br />
*BL21 pEX.nLMWP⋅SOD⋅His<br />
*BL21 pEX.nTra10⋅SOD⋅His <br />
<br />
===Assembly of His⋅SOD⋅cCPP constructs===<br />
====Colony PCR====<br />
#pSB1C3.His&sdot;SOD&sdot;cTra10 A-D<br />
#pSB1C3.His&sdot;SOD&sdot;cTAT A-D<br />
#pSB1C3.His&sdot;SOD&sdot;cLMWP A-D<br />
<br />
Standard colony PCR settings<br />
*Elongation time: 1:30<br />
<br />
====Gel verification====<br />
[[image:ColPCR_HS*cCPP_5oct.png|200px|thumb|right|'''Colony PCR gel verification of His&sdot;SOD&sdot;cCPP constructs in pSB1C3.'''<br />4 &mu;l &lambda;; 5 &mu;l sample.<br />&lambda; = O'GeneRuler 1 kb DNA ladder.]]<br />
1 % agarose, 120 V<br />
<br />
'''Expected bands'''<br />
#884 bp<br />
#854 bp<br />
#863 bp<br />
<br />
'''Results'''<br /><br />
Varying band sized, with the following clones seeming correct:<br />
#A<br />
#D<br />
#B & C<br />
<br />
===Transfer of nCPP⋅SOD⋅His.RBS.yCCS operon to pEX===<br />
====Plasmid preps====<br />
''From 4/10 ON cultures''<br />
<br />
As I'm still waiting for sequencing results of the operons in pSB1K3, I spun down cells (4,400 x ''g'', 10 min), and saved pellets in -20 &deg;C ON.<br />
<br />
* pEX.nTAT⋅SOD⋅His.RBS.yCCS 2: A<br />
* pEX.nTAT⋅SOD⋅His.RBS.yCCS 3: B<br />
* pEX.nTra10⋅SOD⋅His.RBS.yCCS 1: B<br />
* pEX.nTra10⋅SOD⋅His.RBS.yCCS 2: B<br />
* pEX.nLMWP⋅SOD⋅His.RBS.yCCS 2: B<br />
* pEX.nLMWP⋅SOD⋅His.RBS.yCCS 3: B<br />
<br />
----<br />
==Nina==<br />
<br />
===Ligation of proteins into peX and CPP containing vectors===<br />
<br />
Ligations:<br />
<br />
*Fusion protein-His into three vectors each containing all N-terminal CPPs LMWP, TAT and Tra10.<br />
<br />
* Gene: 10 ul <br />
* Vector: LMWP 0.5 ul (25ng), TAT 1 ul (20 ng) and Tra10 1 ul (20 ng)<br />
* Quick Ligation buffer 2X: LMWP 11.5 ul, TAT 12 ul and Tra10 12 ul<br />
* Quick Ligase: 1 ul<br />
<br />
*His-Fusion protein into three vectors each containing all C-terminal CPPs LMWP, TAT and Tra10.<br />
<br />
* Gene: 6 ul <br />
* Vector: CPP1 0.5 ul (25ng), TAT 1 ul (20 ng) and CPP3 1 ul (20 ng)<br />
* Quick Ligation buffer 2X: CPP1 7.5 ul, TAT 8 ul and CPP3 8 ul<br />
* Quick Ligase: 1 ul<br />
<br />
*Protein A-His into three vectors each containing all N-terminal CPPs LMWP, TAT and Tra10.<br />
<br />
* Gene: 12.5 ul <br />
* Vector: LMWP 0.5 ul (25ng), TAT 1 ul (20 ng) and Tra10 1 ul (20 ng)<br />
* Quick Ligation buffer 2X: LMWP 14 ul, TAT 14.5 ul and Tra10 14.5 ul<br />
* Quick Ligase: 1 ul<br />
<br />
*IgG protease_Tra10_Ntermin_#6 into peX vector<br />
<br />
* Gene: 7 ul <br />
* Vector: peX 1 (25ng)<br />
* Quick Ligation buffer 2X: 9 ul<br />
* Quick Ligase: 1 ul<br />
<br />
All ligation mixtures were incubated in 22 °C (in a water bath) for 15 minutes. During these minutes I also thawed competent Top 10 cells (100 ul) on ice for transformation of the ligation samples. <br />
<br />
===Transformation of ligation products===<br />
<br />
The procedure was according to the method decribed in protocols. However I thawed Top 10 cells (100 ul) in 15 minutes instead of 10. I added 3 ul of ligation samples into each 100 of Top 10 cells.<br />
<br />
<br />
<br />
<br />
<br />
== Mimmi ==<br />
<br />
=== Protein purification === <br />
<br />
*Resuspend pellet in <br />
{| <br />
! mix<br />
| <br />
| <br />
|-<br />
| 626.85µl<br />
| NPI-10/20<br />
|-<br />
| 3.15µl<br />
| imidazole 2M<br />
|}<br />
<br />
*Add 70µl lysozyme<br />
**Add 14µl DNase 20µg/ml -> 14µg<br />
**Add 0.7µl PMSF 1mM<br />
**Inbcubate on ice for 15-30min<br />
<br />
*Centrifuge lysate at 12,000xg for 20min at 4&deg;C<br />
**Collect supernatant<br />
**Save 20µl for SDS-Page<br />
<br />
*PhastGel<br />
<br />
{|<br />
! well<br />
! sample<br />
| rowspan="7" | [[Image:Place_for_picture.jpg|150px|thumb|left|]]<br />
|-<br />
| 1<br />
| ladder<br />
|-<br />
| 2<br />
| SOD 3h<br />
|-<br />
| 3<br />
| SOD.his 0h<br />
|-<br />
| 4<br />
| SOD.his sup.<br />
|-<br />
| 5<br />
| his.SOD 0h<br />
|-<br />
| 6<br />
| his.SOD sup.<br />
|}<br />
<br />
==Johan==<br />
<br />
===What went wrong===<br />
I got NO colonies on all plates, something is wrong. <br />
====Cut====<br />
* vector with insert, to see if its ligated<br />
* vector with insert + BamHI<br />
* vector with insret - BamHI<br />
* 2 µl pEX vector<br />
<br />
[[Image:SU 5oktgels.png]]<br />
<br />
While running, I talked to Rickard, the guy that yesterday told me that it works to use invitrogen ligase enzyme with fermentas buffer. Further research showed that invitrogen buffer has Pog8000 which fermentas buffer dont have, which probably means that invitrogen ligase needs Pog8000 - which it didnt have in the fermentas buffer<br />
<br />
====Ligation & transformation====<br />
Did another ligation into pEX with fermentas ligase AND buffer, I then transformed 3 µl of all ligations into top10 cells.<br />
<br />
====Coomassie====<br />
Did a coomassie of some constructs from Andreas & Mimmi. SOD, tat-SOD-his, SOD-his, his-SOD and yCCS. 0, 1, 2 and 3h after IPTG induction for all samples.<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholmhttp://2010.igem.org/File:SU_5oktgels.pngFile:SU 5oktgels.png2010-10-27T20:38:38Z<p>JohanNordholm: </p>
<hr />
<div></div>JohanNordholmhttp://2010.igem.org/Team:Stockholm/6_October_2010Team:Stockholm/6 October 20102010-10-27T20:26:53Z<p>JohanNordholm: </p>
<hr />
<div>{{Stockholm/Top2}}<br />
<br />
==Andreas==<br />
<br />
===Sequencing results===<br />
Received sequencing results for the following samples ([[media:Sequencings_fasta_6oct.txt|fasta]]):<br />
*pSB1K3.nTra10&sdot;SOD&sdot;His.RBS.yCCS 1 (VF2 & VR)<br />
*pSB1K3.nTra10&sdot;SOD&sdot;His.RBS.yCCS 2 (VF2 & VR)<br />
*pSB1K3.nTAT&sdot;SOD&sdot;His.RBS.yCCS 2 (VF2 & VR)<br />
*pSB1K3.nTAT&sdot;SOD&sdot;His.RBS.yCCS 3 (VF2 & VR)<br />
*pSB1K3.nLMWP&sdot;SOD&sdot;His.RBS.yCCS 2 (VF2 & VR)<br />
*pSB1K3.nLMWP&sdot;SOD&sdot;His.RBS.yCCS 3 (VF2 & VR)<br />
*pEX.nTra10&sdot;SOD&sdot;His (pEXf) ([[media:PEX.nT10SH_VF_premix_fasta_6oct.txt|fasta]])<br />
*pEX.nLMWP&sdot;SOD&sdot;His (pEXf) ([[media:PEX.nLSH_VF_premix_fasta_6oct.txt|fasta]])<br />
<br />
Sequences aligned using Geneious software, showing correct sequences for all constructs. Operon constructs all had an insertion between SpeI and PstI; this will not affect expression.<br />
<br />
===Plasmid prep===<br />
''Of stored pellets and ON cultures from 5/10''<br />
<br />
*E.Z.N.A. Plasmid Miniprep kit<br />
**50 &mu; elution volume (elution buffer)<br />
<br />
{|border="1" cellpadding="1" cellspacing="0"<br />
!colspan="3"|DNA concentration<br />
|-<br />
!Sample<br />
!width="60"|Conc [ng/&mu;l]<br />
!width="60"|A<sub>260</sub>/A<sub>280</sub><br />
|-<br />
|pEX.nTAT&sdot;SOD&sdot;His.RBS.yCCS<br />
|align="center"|107.5<br />
|align="center"|1.96<br />
|-<br />
|pEX.nTra10&sdot;SOD&sdot;His.RBS.yCCS<br />
|align="center"|108.7<br />
|align="center"|1.93<br />
|-<br />
|pEX.nLMWP&sdot;SOD&sdot;His.RBS.yCCS<br />
|align="center"|84.35<br />
|align="center"|1.97<br />
|-<br />
|pSB1C3.His&sdot;SOD&sdot;cLMWP B<br />
|align="center"|255.4<br />
|align="center"|1.94<br />
|-<br />
|pSB1C3.His&sdot;SOD&sdot;cLMWP C<br />
|align="center"|201.2<br />
|align="center"|1.94<br />
|-<br />
|pSB1C3.His&sdot;SOD&sdot;cTAT D<br />
|align="center"|369.5<br />
|align="center"|1.92<br />
|-<br />
|pSB1C3.His&sdot;SOD&sdot;cTra10 A<br />
|align="center"|188.6<br />
|align="center"|1.95<br />
|}<br />
<br />
===BL21 transformation===<br />
Quick transformation w/ 30 min on ice, 50 sec heat-shock.<br />
*30 &mu;l competent BL21(DE3)<br />
*1 &mu;l plasmid<br />
**pEX.nTra10&sdot;SOD&sdot;His.RBS.yCCS<br />
**pEX.nTAT&sdot;SOD&sdot;His.RBS.yCCS<br />
**pEX.nLMWP&sdot;SOD&sdot;His.RBS.yCCS<br />
<br />
----<br />
<br />
==Nina==<br />
<br />
===Colony PCR on Fusion protein and protein A===<br />
<br />
I screened four colonies per dish.<br />
<br />
*Master mix with shipping vector verification primers (VF2 and VR):<br />
<br />
[[Image:Z.jpg]]<br />
<br />
*Master mix with peX verification primers:<br />
<br />
[[Image:Xz.jpg]]<br />
<br />
===Agarose gel===<br />
<br />
I ran the PCR products on an 1 % agarose gel (110 V) in order to confirm the inserts in the desired vectors.<br />
<br />
Ladder: MassRuler™ DNA Ladder Mix, ready-to-use, 80-10,000 bp<br />
<br />
[[Image:Laddermixmassruler.jpg]]<br />
<br />
Arrengement on the gels:<br />
<br />
[[Image:Zxc.jpg|20px]]<br />
<br />
*Results of the gels:<br />
<br />
[[Image:As.jpg|300px]]<br />
[[Image:Ad.jpg|300px]]<br />
<br />
All the Fusion and protein A bands look great, however the IgG protease bands look like they have not any insert which is bad. Tomorrow I'll run an agarose gel on my saved ligation sample of IgG protease in the gel cleaned peX vector. This will allow me to check for vector formation with a correct size and see if there has at least occured a ligation, if so I will run a new colony screen.<br />
<br />
===Mini prep on His-IgG protease and His-Protein A===<br />
<br />
I performed a mini prep on the inoculated colonies # 1, 2, 3 and 4 of N-terminal His-IgG protease and inoculated colonies # 1, 2, 3 and 4 of N-terminal His-Protein A.<br />
<br />
<br />
<br />
<br />
== Mimmi ==<br />
<br />
=== Protein purification === <br />
<br />
{| <br />
! mix<br />
| <br />
| x2<br />
|-<br />
| NPI<br />
| 597<br />
| 1194<br />
|-<br />
| imidazole<br />
| 3<br />
| 6<br />
|-<br />
| align="right" | tot<br />
| 600µl<br />
| 1200µl<br />
|}<br />
<br />
*Equilibrate column with 600µl buffer NPI-10<br />
**Centrifuge at 2900rpm for 2min<br />
<br />
*Load lysate in the column (max. 600µl)<br />
**Centrifuge at 1600rpm for 5min (up to 10min)<br />
<br />
{| <br />
! mix<br />
| <br />
| x7<br />
|-<br />
| NPI<br />
| 594<br />
| 4158<br />
|-<br />
| imidazole<br />
| 6<br />
| 42<br />
|-<br />
| align="right" | tot<br />
| 600µl<br />
| 4200µl<br />
|}<br />
<br />
*Wash 2x (3x) with 600µl buffer NPI-20<br />
**Centrifuge at 2900rpm for 2min<br />
<br />
*Elute 2x with 300µl buffer NPI-500<br />
**Centrifuge at 2900rpm for 2min<br />
**Eluate in two different tubes<br />
<br />
<br />
==== PhastGel ====<br />
<br />
{|<br />
! well<br />
! sample<br />
| rowspan="7" | [[Image:Place_for_picture.jpg|150px|thumb|left|]]<br />
|-<br />
| 1<br />
| ladder<br />
|-<br />
| 2<br />
| SOD.his eluate 3h<br />
|-<br />
| 3<br />
| SOD.his 3h<br />
|-<br />
| 4<br />
| SOD.his 0h.<br />
|-<br />
| 5<br />
| his.SOD 3h<br />
|-<br />
| 6<br />
| his.SOD eluate 3h<br />
|}<br />
<br />
==Johan==<br />
<br />
===Colony PCR screen===<br />
<br />
tra10-bFGF-his, tat-bFGF-his, lmwp-bFGF-his, his-bFGF-tra10, his-bFGF-tat, his-bFGF-lmwp in pEX<br />
<br />
5 colonies from each plate<br />
<br />
0,5 µl Pol<br />
0,5 µl dNTP<br />
5 µl 5x buffer<br />
1,5 µl pex for primer<br />
1,5 µl pex rev primer<br />
16 µl H2O<br />
<br />
30x mastermix<br />
<br />
===Gel of PCR screen===<br />
<br />
Top & bottom lanes<br />
<br />
[[Image:SU 6oktgels 1.png]]<br />
<br />
Top lanes<br />
<br />
[[Image:SU 6oktgels.png]]<br />
<br />
Compilation of all constructs. One or more bands of correct sizes for all constructs, nice!<br />
<br />
<br />
{{Stockholm/Footer}}</div>JohanNordholm