User contributions
From 2010.igem.org
(Latest | Earliest) View (newer 500 | older 500) (20 | 50 | 100 | 250 | 500)
- 20:29, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→conclusion) (top)
- 20:28, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Correlations)
- 20:22, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Data)
- 20:18, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Data)
- 20:09, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Urban authority)
- 20:03, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→University)
- 19:54, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Oktoberfest)
- 19:49, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Evaluation)
- 19:44, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 17:39, 27 October 2010 (diff | hist) N File:Tu.jpg (top)
- 17:38, 27 October 2010 (diff | hist) Team:LMU-Munich/Team (→Where we are from)
- 17:37, 27 October 2010 (diff | hist) Team:LMU-Munich/Team (→Where we are from)
- 17:37, 27 October 2010 (diff | hist) Team:LMU-Munich/Team (→Where we are from)
- 17:36, 27 October 2010 (diff | hist) Team:LMU-Munich/Team (→Where we are from)
- 17:35, 27 October 2010 (diff | hist) Team:LMU-Munich/Team (→Where we are from)
- 16:04, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 16:02, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→conclusion)
- 15:57, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Oktoberfest)
- 15:56, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Oktoberfest)
- 15:38, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 15:23, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 15:13, 27 October 2010 (diff | hist) Team:LMU-Munich/Sponsoring (→Sponsoring) (top)
- 21:04, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Correlations)
- 20:45, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Correlations)
- 20:44, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Correlations)
- 20:16, 26 October 2010 (diff | hist) N File:Offendedbecause.jpg (top)
- 20:16, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Data)
- 20:13, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Correlations)
- 20:10, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Correlations)
- 19:52, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 19:51, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 19:49, 26 October 2010 (diff | hist) N File:Informed.jpg (top)
- 19:49, 26 October 2010 (diff | hist) N File:Offended.jpg (top)
- 19:48, 26 October 2010 (diff | hist) N File:Fear.jpg (top)
- 19:44, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 19:33, 26 October 2010 (diff | hist) N File:Profession.jpg (top)
- 19:32, 26 October 2010 (diff | hist) N File:Religious.jpg (top)
- 19:30, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 19:29, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 19:07, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 19:06, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 19:01, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:49, 26 October 2010 (diff | hist) Team:LMU-Munich/Notebook (→Notebook)
- 18:48, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:43, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:43, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:42, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:42, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:41, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:41, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:22, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 18:20, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Evaluation)
- 18:16, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:15, 26 October 2010 (diff | hist) N File:Stamp.jpg (top)
- 18:15, 26 October 2010 (diff | hist) N File:Hat.jpg (top)
- 18:14, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:02, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:02, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 18:01, 26 October 2010 (diff | hist) N File:Beer.jpg (top)
- 18:00, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 17:59, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 17:51, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 17:50, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 17:46, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 17:45, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 17:44, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 17:43, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 17:42, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 17:41, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 17:40, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 17:40, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 17:37, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice
- 17:36, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice (→Human Practice)
- 15:09, 25 October 2010 (diff | hist) Team:LMU-Munich/ApoControl
- 15:08, 25 October 2010 (diff | hist) Team:LMU-Munich/ApoControl
- 15:05, 25 October 2010 (diff | hist) Team:LMU-Munich/ApoControl
- 14:45, 25 October 2010 (diff | hist) Team:LMU-Munich/ProSearch/Schedule (top)
- 14:44, 25 October 2010 (diff | hist) N File:ProsearchZelle.jpg (top)
- 14:43, 25 October 2010 (diff | hist) Team:LMU-Munich/ProSearch (top)
- 14:39, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle (top)
- 14:38, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive (top)
- 14:38, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:38, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:37, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:37, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:36, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:35, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences (top)
- 14:35, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences
- 14:34, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences
- 14:33, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences
- 14:32, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (top)
- 14:31, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule
- 14:30, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle
- 14:30, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle
- 14:28, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:27, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:26, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:26, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:25, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:24, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:24, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:23, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:22, 25 October 2010 (diff | hist) N File:CnsZelle.png (top)
- 14:22, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 14:05, 25 October 2010 (diff | hist) Team:LMU-Munich/Safety (→Safety)
- 13:52, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle (→Case b) cells incorporated with construct 2)
- 13:50, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→Transfection possibilities)
- 13:50, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle (→d) both constructs 2 and 3 enter the cell)
- 10:17, 22 October 2010 (diff | hist) Team:LMU-Munich/ApoControl
- 14:18, 28 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-27-2010)
- 15:03, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 14:42, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-21-2010)
- 13:49, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle (→The Chemistry)
- 13:49, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle (→The Chemistry)
- 13:49, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle (→The Chemistry)
- 13:49, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle (→The Chemistry)
- 13:48, 21 September 2010 (diff | hist) N File:BMCAzo.gif (top)
- 13:48, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle (→The Chemistry)
- 13:47, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle (→The Chemistry)
- 10:34, 21 September 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule
- 10:34, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
- 10:30, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
- 10:30, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
- 10:24, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule
- 10:20, 21 September 2010 (diff | hist) N File:J3S.jpg (top)
- 10:19, 21 September 2010 (diff | hist) N File:J2S.jpg (top)
- 10:19, 21 September 2010 (diff | hist) N File:J1S.jpg (top)
- 10:19, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Assembling Biobricks)
- 10:18, 21 September 2010 (diff | hist) N File:N2S.jpg (top)
- 10:17, 21 September 2010 (diff | hist) N File:N1S.jpg (top)
- 10:17, 21 September 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Assembling Biobricks)
- 10:15, 21 September 2010 (diff | hist) File:N1.jpg (uploaded a new version of "Image:N1.jpg") (top)
- 10:14, 21 September 2010 (diff | hist) File:N1.jpg (uploaded a new version of "Image:N1.jpg")
- 09:48, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-20-2010)
- 09:45, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-17-2010)
- 07:53, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-15-2010)
- 17:35, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-16-2010)
- 17:31, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-15-2010)
- 17:30, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 17:25, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 17:23, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-14-2010)
- 17:19, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-13-2010)
- 17:19, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 17:17, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 17:15, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-10-2010)
- 17:12, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-17-2010)
- 17:05, 20 September 2010 (diff | hist) N File:17 9 10apo.jpg (top)
- 17:05, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-17-2010)
- 16:20, 20 September 2010 (diff | hist) N File:9 17 10apo2.jpg (top)
- 16:19, 20 September 2010 (diff | hist) N File:9 17 10apo.jpg (top)
- 16:19, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-17-2010)
- 16:17, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-17-2010)
- 16:17, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-17-2010)
- 16:07, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-16-2010)
- 16:06, 20 September 2010 (diff | hist) N File:9 16 10.jpg (top)
- 16:05, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-16-2010)
- 16:02, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-15-2010)
- 16:02, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-15-2010)
- 16:02, 20 September 2010 (diff | hist) N File:9 15 2010.jpg (top)
- 16:01, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-15-2010)
- 15:52, 20 September 2010 (diff | hist) N File:9.1.10apo.jpg (top)
- 15:47, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→9-01-2010)
- 18:44, 13 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-24-2010)
- 16:30, 21 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive (→Cut'N'survive System)
- 16:23, 20 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 2: Assembling Biobricks)
- 16:22, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 2: Assembling Biobricks)
- 16:21, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/13 3A Method for Biobrick assembly (→Materials) (top)
- 16:20, 20 August 2010 (diff | hist) N File:A32.jpg (top)
- 16:19, 20 August 2010 (diff | hist) N File:3A1.jpg (top)
- 16:18, 20 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/13 3A Method for Biobrick assembly (New page: {{:Team:LMU-Munich/Templates/Page Header}} <b>3A Method for Biobrick assembly</b> Source: http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly ==Introduction== 3A assembly (...)
- 16:08, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook (→Protocols)
- 13:40, 20 August 2010 (diff | hist) Team:LMU-Munich/Sequences/LctO (top)
- 13:39, 20 August 2010 (diff | hist) Team:LMU-Munich/Sequences/AurF (top)
- 13:38, 20 August 2010 (diff | hist) Team:LMU-Munich/Sequences/PduC (top)
- 13:37, 20 August 2010 (diff | hist) Team:LMU-Munich/Sequences/PduD (top)
- 13:02, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 13:00, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 12:58, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 12:57, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 11:56, 20 August 2010 (diff | hist) Team:LMU-Munich/Functional Principle
- 11:24, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 11:16, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 11:15, 20 August 2010 (diff | hist) N File:PCR131517P.jpg (top)
- 11:14, 20 August 2010 (diff | hist) N File:PCR16bP.jpg (top)
- 11:14, 20 August 2010 (diff | hist) N File:PCR16aP.jpg (top)
- 11:14, 20 August 2010 (diff | hist) N File:PCR14bP.jpg (top)
- 11:13, 20 August 2010 (diff | hist) N File:PCR14aP.jpg (top)
- 11:13, 20 August 2010 (diff | hist) N File:PCR12bP.jpg (top)
- 11:12, 20 August 2010 (diff | hist) N File:PCR12aP.jpg (top)
- 11:12, 20 August 2010 (diff | hist) N File:PCR11P.jpg (top)
- 11:12, 20 August 2010 (diff | hist) N File:PCR10P.jpg (top)
- 11:11, 20 August 2010 (diff | hist) N File:PCR9P.jpg (top)
- 11:11, 20 August 2010 (diff | hist) N File:PCR8bP.jpg (top)
- 11:10, 20 August 2010 (diff | hist) N File:PCR8aP.jpg (top)
- 11:10, 20 August 2010 (diff | hist) N File:PCR7P.jpg (top)
- 11:10, 20 August 2010 (diff | hist) N File:PCR6bP.jpg (top)
- 11:10, 20 August 2010 (diff | hist) N File:PCR6aP.jpg (top)
- 11:09, 20 August 2010 (diff | hist) N File:PCR5P.jpg (top)
- 11:09, 20 August 2010 (diff | hist) N File:PCR4P.jpg (top)
- 11:08, 20 August 2010 (diff | hist) N File:PCR3bP.jpg (top)
- 11:08, 20 August 2010 (diff | hist) N File:PCR3aP.jpg (top)
- 11:08, 20 August 2010 (diff | hist) N File:PCR2P.jpg (top)
- 11:07, 20 August 2010 (diff | hist) N File:PCR1bP.jpg (top)
- 11:07, 20 August 2010 (diff | hist) N File:PCR1aP.jpg (top)
- 11:05, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule (→PCR and mutagenisis of the digestion sites)
- 09:40, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive
- 08:23, 20 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 08:21, 20 August 2010 (diff | hist) Team:LMU-Munich/Team
- 08:21, 20 August 2010 (diff | hist) N File:Maria.jpg (top)
- 08:20, 20 August 2010 (diff | hist) N Team:LMU-Munich/Team/Maria (New page: {{:Team:LMU-Munich/Templates/Page Header}} Maria Drexler ==Contact Info== *Maria Drexler *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in Bi...)
- 07:46, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 07:45, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 18:57, 19 August 2010 (diff | hist) Team:LMU-Munich/Schedule
- 18:56, 19 August 2010 (diff | hist) Team:LMU-Munich/Functional Principle
- 18:55, 19 August 2010 (diff | hist) Team:LMU-Munich/Functional Principle
- 18:52, 19 August 2010 (diff | hist) N Team:LMU-Munich/Sequences/LctO (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 18:52, 19 August 2010 (diff | hist) N Team:LMU-Munich/Sequences/AurF (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 18:51, 19 August 2010 (diff | hist) N Team:LMU-Munich/Sequences/PduC (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 18:51, 19 August 2010 (diff | hist) N Team:LMU-Munich/Sequences/PduD (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 18:51, 19 August 2010 (diff | hist) N Team:LMU-Munich/Sequences/Pdu Operon (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 18:50, 19 August 2010 (diff | hist) Team:LMU-Munich/Sequences
- 18:46, 19 August 2010 (diff | hist) Team:LMU-Munich/Schedule
- 18:22, 19 August 2010 (diff | hist) N Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
- 18:21, 19 August 2010 (diff | hist) Team:LMU-Munich/Schedule
- 18:21, 19 August 2010 (diff | hist) Team:LMU-Munich/Sequences
- 18:11, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 18:10, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 18:04, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 15:45, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 14:05, 19 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule
- 13:40, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up (top)
- 13:10, 19 August 2010 (diff | hist) Team:LMU-Munich/Team
- 13:10, 19 August 2010 (diff | hist) N File:Erik2.jpg (top)
- 13:09, 19 August 2010 (diff | hist) Team:LMU-Munich/Team/Erik
- 13:09, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Erik (New page: {{:Team:LMU-Munich/Templates/Page Header}} Erik Fumi ==Contact Info== *Erik Fumi *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in Biology, LM...)
- 13:05, 19 August 2010 (diff | hist) Team:LMU-Munich/Team
- 13:04, 19 August 2010 (diff | hist) N File:Marisa.jpg (top)
- 13:03, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Marisa (New page: {{:Team:LMU-Munich/Templates/Page Header}} Marisa Kurz ==Contact Info== *Marisa Kurz *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in Chemi...) (top)
- 12:57, 19 August 2010 (diff | hist) Team:LMU-Munich/Team
- 12:55, 19 August 2010 (diff | hist) N File:Nicolas.jpg (top)
- 12:55, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Nicky (New page: {{:Team:LMU-Munich/Templates/Page Header}} Nicolas Keller ==Contact Info== *Nicolas Keller *Ludwig Maximilians University (LMU) ==Education== * 2012 (expe...) (top)
- 12:46, 19 August 2010 (diff | hist) Team:LMU-Munich/Team
- 12:44, 19 August 2010 (diff | hist) N File:Laura2.jpg (top)
- 12:44, 19 August 2010 (diff | hist) Team:LMU-Munich/Team/Laura (top)
- 12:42, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Laura (New page: {{:Team:LMU-Munich/Templates/Page Header}} Laura Kleinknecht ==Contact Info== *Laura Kleinknecht *Ludwig Maximilians University (LMU) ==Education== * 2010 B...)
- 12:36, 19 August 2010 (diff | hist) Team:LMU-Munich/Team/Corinna (top)
- 12:35, 19 August 2010 (diff | hist) Team:LMU-Munich/Team/Corinna
- 12:35, 19 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 12:34, 19 August 2010 (diff | hist) N File:Corinna.jpg (top)
- 12:33, 19 August 2010 (diff | hist) Team:LMU-Munich/Team
- 12:31, 19 August 2010 (diff | hist) Team:LMU-Munich/Team
- 12:31, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Corinna (New page: {{:Team:LMU-Munich/Templates/Page Header}} Corrina Hofer ==Contact Info== *Corrina Hofer *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in...)
- 12:28, 19 August 2010 (diff | hist) N File:Corrina.jpg (top)
- 12:23, 19 August 2010 (diff | hist) Team:LMU-Munich/Team/Jens (top)
- 12:21, 19 August 2010 (diff | hist) Team:LMU-Munich/Team
- 12:15, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Franzi (New page: {{:Team:LMU-Munich/Templates/Page Header}} Franziska Häfele ==Contact Info== *Franziska Häfele *Ludwig Maximilians University (LMU) ==Education== * 2011 ...) (top)
- 12:13, 19 August 2010 (diff | hist) N File:Franzi.jpg
- 11:37, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 11:34, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 11:33, 19 August 2010 (diff | hist) N File:19 8 10 apo.jpg (top)
- 11:33, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 11:32, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 11:31, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 09:45, 19 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation
- 09:44, 19 August 2010 (diff | hist) N Team:LMU-Munich/Outer BMC (Team:LMU-Munich/Outer BMC moved to Team:LMU-Munich/Sequences) (top)
- 09:44, 19 August 2010 (diff | hist) m Team:LMU-Munich/Sequences (Team:LMU-Munich/Outer BMC moved to Team:LMU-Munich/Sequences)
- 09:43, 19 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation
- 09:42, 19 August 2010 (diff | hist) N Team:LMU-Munich/work progress (Team:LMU-Munich/work progress moved to Team:LMU-Munich/Schedule) (top)
- 09:42, 19 August 2010 (diff | hist) m Team:LMU-Munich/Schedule (Team:LMU-Munich/work progress moved to Team:LMU-Munich/Schedule)
- 09:41, 19 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation
- 09:40, 19 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation (Undo revision 53189 by JB (Talk))
- 09:38, 19 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation
- 09:37, 19 August 2010 (diff | hist) N Team:LMU-Munich/BMC (Team:LMU-Munich/BMC moved to Team:LMU-Munich/Functional Principle) (top)
- 09:37, 19 August 2010 (diff | hist) m Team:LMU-Munich/Functional Principle (Team:LMU-Munich/BMC moved to Team:LMU-Munich/Functional Principle)
- 09:05, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/2 Highly competent cells (→Preparing seed stocks) (top)
- 09:03, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/2 Highly competent cells (→Preparing competent cells)
- 08:20, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-19-2010)
- 08:17, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-18-2010)
- 16:51, 18 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 16:47, 18 August 2010 (diff | hist) N User:JB (New page: {{:Team:LMU-Munich/Templates/Page Header}} Julia Bartels ==Contact Info== *Julia Bartels *Ludwig Maximilians University (LMU) ==Education== * 2011 (expecte...) (top)
- 16:29, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-18-2010)
- 16:28, 18 August 2010 (diff | hist) N File:18 8 10 apo.jpg (top)
- 16:20, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-18-2010)
- 16:19, 18 August 2010 (diff | hist) N File:18 8 10 apo.Tif (top)
- 16:06, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis (→8-18-2010)
- 15:50, 18 August 2010 (diff | hist) Team:LMU-Munich/Team/Grace (→(Research) Interests)
- 15:49, 18 August 2010 (diff | hist) Team:LMU-Munich/Team/Grace (→Education)
- 15:13, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule
- 15:12, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 15:12, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule
- 15:11, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/PCR key (top)
- 15:10, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/PCR key
- 15:08, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/PCR key
- 15:01, 18 August 2010 (diff | hist) N File:Mutation.jpg (top)
- 15:00, 18 August 2010 (diff | hist) N File:Template.jpg (top)
- 15:00, 18 August 2010 (diff | hist) N File:Primer.jpg (top)
- 14:59, 18 August 2010 (diff | hist) N File:Overhang.jpg (top)
- 14:56, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/PCR key (New page: {{:Team:LMU-Munich/Templates/Page Header}} {| |- |1TreF 56°C: |#Number: consecutive numbering on PCR plan |- | |#Tre: Abbreviation of gene of interest |- | |#F: Forward Primer |- | |#56°...)
- 14:42, 18 August 2010 (diff | hist) Team:LMU-Munich/Team (→Undergrads)
- 14:38, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Grace (New page: {{:Team:LMU-Munich/Templates/Page Header}} Mengzhe Wang ==Contact Info== *Mengzhe Wang (Grace) *Ludwig Maximilians University (LMU) ==Education== * 2011 (ex...)
- 13:38, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 13:37, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 13:37, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule
- 13:34, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/Primer16 (top)
- 13:33, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/Primer20 (top)
- 13:32, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/Primer19 (top)
- 13:32, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer19 (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="# FF6600">CGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACC</font> C TCTAGA A GCGGCCGC GAATTC {{:Team:LMU-Munich/Te...)
- 13:31, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/Primer18 (top)
- 13:31, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/Primer18
- 13:30, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer18 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FFFF00">GGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCG</font> T ACTAGT A GCGGCCG CTGCAG {{:Team:LMU-Munich/Temp...)
- 13:28, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer23 (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">TCATCACACTTTCCGCTTTTTC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 13:27, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer22 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">ATGGATACCTACGCCGGAGC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 13:25, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer21 (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">TTACTTGTACAGCTCGTCCATG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 13:25, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer20 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G CCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGG <font color="#FF0000">GTAAGCAAGGGCGAGGAGC</font> {{:Team:LMU-Munich/Templa...)
- 13:23, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA replication+PCR)
- 13:21, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 13:20, 18 August 2010 (diff | hist) N File:PCR10.jpg (top)
- 13:20, 18 August 2010 (diff | hist) N File:PCR9.jpg (top)
- 13:17, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 13:12, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule (→Aim 1: DNA reproduction+PCR)
- 13:08, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule
- 13:07, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer16 (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A GAATTGGAAGTACAAGTTTC <font color="#FF0000">CCCTTGCGAGTACACCAATTC</font> {{:Team:LMU-Munich/Templates/Page Footer}})
- 13:06, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer15 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GGTGTCAGACAC<font color="#009933">G</font>AGTTGCACATTCCCTTCATCTG {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 13:04, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer14 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCAACT<font color="#009933">C</font>GTGTCTGACACCATGCTAGAC {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:37, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer13 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">ATGGCGATGCAAGCGGCC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:36, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer12 (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">GCAGTGAAAAAAATGCTTTATTTG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:35, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer11 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">GATCATAATCAGCCATACCAC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:34, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer10 (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A TCA<font color="#FF0000">TCATGATTTGAAGAATCTTCG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:32, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer9 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GTTGCAGCACCT<font color="#009933">A</font>CAGCCCACGGCAGAGAATGCC {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:31, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer8 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GGCTG<font color="#009933">T</font>AGGTGCTGCAACATGGTCTGG {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:30, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer7 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">GCTTCGGGGCAAGGCCC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:28, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer6 (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">GGATCCTTTATGACCTAATTTAG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:11, 18 August 2010 (diff | hist) Team:LMU-Munich/Team
- 12:10, 18 August 2010 (diff | hist) N File:Christina.jpg (top)
- 12:07, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Christina (New page: {{:Team:LMU-Munich/Templates/Page Header}} Christina Krönauer ==Contact Info== *Christina Krönauer *Ludwig Maximilians University (LMU) ==Education== ...) (top)
- 12:02, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer5 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GGATCG <font color="#009933">G</font>ATTCC <font color="#009933">G</font>GCAGTAGCAGGTGCTGGTGC {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 12:00, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer4 (New page: {{:Team:LMU-Munich/Templates/Page Header}} CTGC <font color="#009933">C</font>GGAAT <font color="#009933">C</font>CGATCCATATGAGCTGGAGTTCG {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 11:58, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer3 (New page: {{:Team:LMU-Munich/Templates/Page Header}} GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">ATGGATGAATTGTACAAATC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
- 11:57, 18 August 2010 (diff | hist) N File:PCR8.jpg (top)
- 11:56, 18 August 2010 (diff | hist) N File:PCR7b.jpg (top)
- 11:56, 18 August 2010 (diff | hist) N File:PCR7a.jpg (top)
- 11:56, 18 August 2010 (diff | hist) N File:PCR6.jpg (top)
- 11:55, 18 August 2010 (diff | hist) N File:PCR5.jpg (top)
- 11:55, 18 August 2010 (diff | hist) N File:PCR4b.jpg (top)
- 11:55, 18 August 2010 (diff | hist) N File:PCR4a.jpg (top)
- 11:55, 18 August 2010 (diff | hist) N File:PCR3.jpg (top)
- 11:54, 18 August 2010 (diff | hist) N File:PCR2b.jpg (top)
- 11:54, 18 August 2010 (diff | hist) N File:PCR2a.jpg (top)
- 11:49, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule (→Aim 1: DNA reproduction+PCR)
- 11:38, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer2 (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">CCGCGGAGGCTGGATCG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
(Latest | Earliest) View (newer 500 | older 500) (20 | 50 | 100 | 250 | 500)