User contributions
From 2010.igem.org
(Latest | Earliest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)
- 19:58, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Gibson Assembly)
- 16:16, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 16:06, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Gibson Assembly)
- 16:03, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 15:59, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Gibson Assembly)
- 15:57, 23 October 2010 (diff | hist) N File:GibsonAssembly.jpg (Figure 1 Nature Methods 6, 343 - 345 (2009) Published online: 12 April 2009 | doi:10.1038/nmeth.1318 Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & ) (top)
- 15:56, 23 October 2010 (diff | hist) N File:Nmeth.1318-F1.jpg (Figure 1 Nature Methods 6, 343 - 345 (2009) Published online: 12 April 2009 | doi:10.1038/nmeth.1318 Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & ) (top)
- 15:49, 23 October 2010 (diff | hist) Team:Cambridge/TheTeam (→Hannah Copley)
- 15:47, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 15:40, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 14:53, 23 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 19:43, 9 October 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 13:20, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/MasterMix (top)
- 13:18, 30 September 2010 (diff | hist) N Team:Cambridge/Gibson/MasterMix (New page: {|class="wikitable" |- | |Volume/µl |- |Taq ligase (40u/µl) |50 |- |5x isothermal buffer |100 |- |T5 exonuclease (1u/µl) |2 |- |Phusion polymerase (2u/µl) |6.25 |- |Nuclease-free wate...)
- 13:18, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 4) Gibson Assembly)
- 13:17, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Master mix)
- 13:16, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 4) Gibson Assembly)
- 13:14, 30 September 2010 (diff | hist) m Team:Cambridge/Gibson/Protocol (→Step 4) Gibson Assembly)
- 13:13, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 13:08, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction
- 13:08, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 13:03, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 13:03, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 13:01, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 13:00, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 12:59, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 12:58, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Introduction (→Advantages)
- 12:39, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 10:16, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 10:07, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Step 1) Design Primers)
- 10:07, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 09:56, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol (→Master mix)
- 09:54, 30 September 2010 (diff | hist) Team:Cambridge/Gibson/Protocol
- 11:10, 29 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 09:28, 29 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 15:59, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 15:54, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 15:53, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 15:33, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 15:02, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 14:39, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 14:31, 28 September 2010 (diff | hist) Team:Cambridge/LabBook/Week9
- 17:19, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:17, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:05, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:04, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:04, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:03, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:03, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:02, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 17:02, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 09:31, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 09:30, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 09:20, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 09:19, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 09:15, 9 September 2010 (diff | hist) Team:Cambridge/Notebook/9 (top)
- 09:14, 9 September 2010 (diff | hist) Team:Cambridge/Notebook/8 (top)
- 09:12, 9 September 2010 (diff | hist) Team:Cambridge/Notebook/7 (top)
- 09:05, 9 September 2010 (diff | hist) Team:Cambridge/Templates/HybridBook
- 08:45, 9 September 2010 (diff | hist) Team:Cambridge/Tools/Gibson
- 08:45, 9 September 2010 (diff | hist) Team:Cambridge/Tools/Gibson
- 11:36, 24 August 2010 (diff | hist) Team:Cambridge/OligoOrderVibrio17.08.10 (top)
- 08:59, 20 August 2010 (diff | hist) Team:Cambridge/References/ProjectBioluminescence/LightLevel (→Relevant Physics)
- 10:28, 18 August 2010 (diff | hist) N Team:Cambridge/OligoOrderVibrio17.08.10 (New page: luxCstart.r.pBadend ATTTATTCATTATTTTCCCTgctagcccaaaaaaacgggt pBADend.f.luxCstart acccgtttttttgggctagcAGGGAAAATAATGAATAAAT luxDend.f.luxAstart AATTATTAGAATTGGCTTAAATAAACAGAATCACCAAAAA luxAs...)
- 10:27, 18 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone) (top)
- 10:20, 18 August 2010 (diff | hist) Team:Cambridge/Oligos (→The Phosphoreum Lux operon)
- 09:39, 18 August 2010 (diff | hist) N Team:Cambridge/biobrickingoligosfirefly (New page: 1 ttcgctaaggatgatttctg gaattcgcggccgcttctag ag Tm:70.14 dG:1.54 2 ttgcccgtttttttgccgga ctgcagcggccgctactagta Tm:68.73 dG:-0.26 3 tactagtagcggccgctgcag Tm:68.73 dG:0.57 4 ctctagaag...) (top)
- 14:27, 17 August 2010 (diff | hist) N Team:Cambridge/mutagenesisprimers17.08.10 (New page: Melting temps set to 55deg salt conc 50mM Val239-->Ile CCGGGTACGGCTaTTCTGACTGTTGTCCCTTTTCACCATGG Tm:84.29 dG:0.38 CCATGGTGAAAAGGGACAACAGTCAGAAtAGCCGTACCCGG Tm:84.29 dG:0.48 Asn286-->...) (top)
- 14:26, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→Firefly Oligos to be ordered)
- 14:25, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→Our first attempts at oligo design (a little excessive))
- 14:25, 17 August 2010 (diff | hist) N Team:Cambridge/LuxR (New page: ATGAAAAACATAAATGCCGACGACACATACAGAATAATTAATAAAATTAA AGCTTGTAGAAGCAATAATGATATAATCAATGCTTATCTGATATGACTAA AATGGTACATTGTGAATATTATTTATTCGCGATCATTTATCCTCATTCTA TGGTTAAATCTGATATTTCAATCTAGATAATTAC...) (top)
- 14:25, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→luxR)
- 14:24, 17 August 2010 (diff | hist) N Team:Cambridge/luxICDABEoperon (New page: gtcgaccttcctggttcagagcctcatatccatattacgaccacttcaat gggcgatcaaaaagtacattacatgattttttgcccaacagaaaaagcct ctcatttagagcagcttattcgtcaagatttcatggaaatgtatgagatc aattttccacaaaaaacagagtaacaaagagaaa...) (top)
- 14:23, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→luxICDABE operon)
- 14:22, 17 August 2010 (diff | hist) N Team:Cambridge/Biobrickingluxoperon (New page: =lux oligos= ==luxI== ===forward=== gaattcgcggccgcttctagagAAGGGAGGTTGGTATGACTAT dG=0.11 Tm=58.45 ===reverse coding=== atgatcatcgccggcgacgtcTTAATTTAAGACTGCTTTTTTAAACT dG=-0.34 T...) (top)
- 14:22, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→Our first attempts at oligo design (a little excessive))
- 14:22, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→lux oligos)
- 14:17, 17 August 2010 (diff | hist) Team:Cambridge/Oligos (→Firefly Oligos to be ordered)
- 14:17, 17 August 2010 (diff | hist) Team:Cambridge/Oligos
- 11:45, 13 August 2010 (diff | hist) N Team:Cambridge/OligoOrderVibrio13.08.10 (New page: BioBrick Prefix: If following part is coding or contains ATG: gaattcgcggccgcttctag Otherwise: gaattcgcggccgcttctagag BioBrick Suffix: tactagtagcggccgctgcag Pb...)
- 11:44, 13 August 2010 (diff | hist) Team:Cambridge/Oligos
- 09:14, 13 August 2010 (diff | hist) Team:Cambridge/Oligos
- 11:33, 10 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 13:59, 9 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 13:20, 9 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 12:20, 9 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 12:12, 9 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 12:07, 9 August 2010 (diff | hist) Team:Cambridge/Oligos (→Notes on alterations to the SLOCK pHK724 clone)
- 12:03, 9 August 2010 (diff | hist) Team:Cambridge/Oligos
- 10:37, 9 August 2010 (diff | hist) Team:Cambridge/Oligos
- 10:35, 9 August 2010 (diff | hist) Team:Cambridge/Oligos
- 09:53, 9 August 2010 (diff | hist) Team:Cambridge/Templates/headerMinimalprototype
- 09:47, 9 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 09:43, 9 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 09:11, 9 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 09:07, 9 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 13:50, 6 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 13:29, 6 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 13:17, 6 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
- 13:08, 6 August 2010 (diff | hist) Team:Cambridge/LabBook/Week3
(Latest | Earliest) View (newer 100 | older 100) (20 | 50 | 100 | 250 | 500)