User contributions

From 2010.igem.org

• 20:29, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→conclusion) (top)
• 20:28, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Correlations)
• 20:22, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Data)
• 20:18, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Data)
• 20:09, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Urban authority)
• 20:03, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→University)
• 19:54, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Oktoberfest)
• 19:49, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Evaluation)
• 19:44, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 17:39, 27 October 2010 (diff | hist) N File:Tu.jpg ‎ (top)
• 17:38, 27 October 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Where we are from)
• 17:37, 27 October 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Where we are from)
• 17:37, 27 October 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Where we are from)
• 17:36, 27 October 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Where we are from)
• 17:35, 27 October 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Where we are from)
• 16:04, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 16:02, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→conclusion)
• 15:57, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Oktoberfest)
• 15:56, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Oktoberfest)
• 15:38, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 15:23, 27 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 15:13, 27 October 2010 (diff | hist) Team:LMU-Munich/Sponsoring ‎ (→Sponsoring) (top)
• 21:04, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Correlations)
• 20:45, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Correlations)
• 20:44, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Correlations)
• 20:16, 26 October 2010 (diff | hist) N File:Offendedbecause.jpg ‎ (top)
• 20:16, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Data)
• 20:13, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Correlations)
• 20:10, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Correlations)
• 19:52, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 19:51, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 19:49, 26 October 2010 (diff | hist) N File:Informed.jpg ‎ (top)
• 19:49, 26 October 2010 (diff | hist) N File:Offended.jpg ‎ (top)
• 19:48, 26 October 2010 (diff | hist) N File:Fear.jpg ‎ (top)
• 19:44, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 19:33, 26 October 2010 (diff | hist) N File:Profession.jpg ‎ (top)
• 19:32, 26 October 2010 (diff | hist) N File:Religious.jpg ‎ (top)
• 19:30, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 19:29, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 19:07, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 19:06, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 19:01, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:49, 26 October 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Notebook)
• 18:48, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:43, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:43, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:42, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:42, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:41, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:41, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:22, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 18:20, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Evaluation)
• 18:16, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:15, 26 October 2010 (diff | hist) N File:Stamp.jpg ‎ (top)
• 18:15, 26 October 2010 (diff | hist) N File:Hat.jpg ‎ (top)
• 18:14, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:02, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:02, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 18:01, 26 October 2010 (diff | hist) N File:Beer.jpg ‎ (top)
• 18:00, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 17:59, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 17:51, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 17:50, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 17:46, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 17:45, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 17:44, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 17:43, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 17:42, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 17:41, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 17:40, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 17:40, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 17:37, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎
• 17:36, 26 October 2010 (diff | hist) Team:LMU-Munich/HumanPractice ‎ (→Human Practice)
• 15:09, 25 October 2010 (diff | hist) Team:LMU-Munich/ApoControl ‎
• 15:08, 25 October 2010 (diff | hist) Team:LMU-Munich/ApoControl ‎
• 15:05, 25 October 2010 (diff | hist) Team:LMU-Munich/ApoControl ‎
• 14:45, 25 October 2010 (diff | hist) Team:LMU-Munich/ProSearch/Schedule ‎ (top)
• 14:44, 25 October 2010 (diff | hist) N File:ProsearchZelle.jpg ‎ (top)
• 14:43, 25 October 2010 (diff | hist) Team:LMU-Munich/ProSearch ‎ (top)
• 14:39, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle ‎ (top)
• 14:38, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎ (top)
• 14:38, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:38, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:37, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:37, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:36, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:35, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences ‎ (top)
• 14:35, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences ‎
• 14:34, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences ‎
• 14:33, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Sequences ‎
• 14:32, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (top)
• 14:31, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎
• 14:30, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle ‎
• 14:30, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle ‎
• 14:28, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:27, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:26, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:26, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:25, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:24, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:24, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:23, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:22, 25 October 2010 (diff | hist) N File:CnsZelle.png ‎ (top)
• 14:22, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 14:05, 25 October 2010 (diff | hist) Team:LMU-Munich/Safety ‎ (→Safety)
• 13:52, 25 October 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Functional Principle ‎ (→Case b) cells incorporated with construct 2)
• 13:50, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle ‎ (→Transfection possibilities)
• 13:50, 25 October 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Functional Principle ‎ (→d) both constructs 2 and 3 enter the cell)
• 10:17, 22 October 2010 (diff | hist) Team:LMU-Munich/ApoControl ‎
• 14:18, 28 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-27-2010)
• 15:03, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-21-2010)
• 14:42, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-21-2010)
• 13:49, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle ‎ (→The Chemistry)
• 13:49, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle ‎ (→The Chemistry)
• 13:49, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle ‎ (→The Chemistry)
• 13:49, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle ‎ (→The Chemistry)
• 13:48, 21 September 2010 (diff | hist) N File:BMCAzo.gif ‎ (top)
• 13:48, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle ‎ (→The Chemistry)
• 13:47, 21 September 2010 (diff | hist) Team:LMU-Munich/Functional Principle ‎ (→The Chemistry)
• 10:34, 21 September 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎
• 10:34, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule ‎ (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
• 10:30, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule ‎ (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
• 10:30, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule ‎ (→Aim 2: Inserting PCR Products in pSB1C3 and verifying Sequenz)
• 10:24, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule ‎
• 10:20, 21 September 2010 (diff | hist) N File:J3S.jpg ‎ (top)
• 10:19, 21 September 2010 (diff | hist) N File:J2S.jpg ‎ (top)
• 10:19, 21 September 2010 (diff | hist) N File:J1S.jpg ‎ (top)
• 10:19, 21 September 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule ‎ (→Aim 2: Assembling Biobricks)
• 10:18, 21 September 2010 (diff | hist) N File:N2S.jpg ‎ (top)
• 10:17, 21 September 2010 (diff | hist) N File:N1S.jpg ‎ (top)
• 10:17, 21 September 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 2: Assembling Biobricks)
• 10:15, 21 September 2010 (diff | hist) File:N1.jpg ‎ (uploaded a new version of "Image:N1.jpg") (top)
• 10:14, 21 September 2010 (diff | hist) File:N1.jpg ‎ (uploaded a new version of "Image:N1.jpg")
• 09:48, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-20-2010)
• 09:45, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-17-2010)
• 07:53, 21 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-15-2010)
• 17:35, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-16-2010)
• 17:31, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-15-2010)
• 17:30, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 17:25, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 17:23, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-14-2010)
• 17:19, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-13-2010)
• 17:19, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 17:17, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 17:15, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-10-2010)
• 17:12, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-17-2010)
• 17:05, 20 September 2010 (diff | hist) N File:17 9 10apo.jpg ‎ (top)
• 17:05, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-17-2010)
• 16:20, 20 September 2010 (diff | hist) N File:9 17 10apo2.jpg ‎ (top)
• 16:19, 20 September 2010 (diff | hist) N File:9 17 10apo.jpg ‎ (top)
• 16:19, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-17-2010)
• 16:17, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-17-2010)
• 16:17, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-17-2010)
• 16:07, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-16-2010)
• 16:06, 20 September 2010 (diff | hist) N File:9 16 10.jpg ‎ (top)
• 16:05, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-16-2010)
• 16:02, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-15-2010)
• 16:02, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-15-2010)
• 16:02, 20 September 2010 (diff | hist) N File:9 15 2010.jpg ‎ (top)
• 16:01, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-15-2010)
• 15:52, 20 September 2010 (diff | hist) N File:9.1.10apo.jpg ‎ (top)
• 15:47, 20 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→9-01-2010)
• 18:44, 13 September 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-24-2010)
• 16:30, 21 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎ (→Cut'N'survive System)
• 16:23, 20 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule ‎ (→Aim 2: Assembling Biobricks)
• 16:22, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 2: Assembling Biobricks)
• 16:21, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/13 3A Method for Biobrick assembly ‎ (→Materials) (top)
• 16:20, 20 August 2010 (diff | hist) N File:A32.jpg ‎ (top)
• 16:19, 20 August 2010 (diff | hist) N File:3A1.jpg ‎ (top)
• 16:18, 20 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/13 3A Method for Biobrick assembly ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} <b>3A Method for Biobrick assembly</b> Source: http://openwetware.org/wiki/Synthetic_Biology:BioBricks/3A_assembly ==Introduction== 3A assembly (...)
• 16:08, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 13:40, 20 August 2010 (diff | hist) Team:LMU-Munich/Sequences/LctO ‎ (top)
• 13:39, 20 August 2010 (diff | hist) Team:LMU-Munich/Sequences/AurF ‎ (top)
• 13:38, 20 August 2010 (diff | hist) Team:LMU-Munich/Sequences/PduC ‎ (top)
• 13:37, 20 August 2010 (diff | hist) Team:LMU-Munich/Sequences/PduD ‎ (top)
• 13:02, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule ‎ (→PCR and mutagenisis of the digestion sites)
• 13:00, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule ‎ (→PCR and mutagenisis of the digestion sites)
• 12:58, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule ‎ (→PCR and mutagenisis of the digestion sites)
• 12:57, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule ‎ (→PCR and mutagenisis of the digestion sites)
• 11:56, 20 August 2010 (diff | hist) Team:LMU-Munich/Functional Principle ‎
• 11:24, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA replication+PCR)
• 11:16, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule ‎ (→PCR and mutagenisis of the digestion sites)
• 11:15, 20 August 2010 (diff | hist) N File:PCR131517P.jpg ‎ (top)
• 11:14, 20 August 2010 (diff | hist) N File:PCR16bP.jpg ‎ (top)
• 11:14, 20 August 2010 (diff | hist) N File:PCR16aP.jpg ‎ (top)
• 11:14, 20 August 2010 (diff | hist) N File:PCR14bP.jpg ‎ (top)
• 11:13, 20 August 2010 (diff | hist) N File:PCR14aP.jpg ‎ (top)
• 11:13, 20 August 2010 (diff | hist) N File:PCR12bP.jpg ‎ (top)
• 11:12, 20 August 2010 (diff | hist) N File:PCR12aP.jpg ‎ (top)
• 11:12, 20 August 2010 (diff | hist) N File:PCR11P.jpg ‎ (top)
• 11:12, 20 August 2010 (diff | hist) N File:PCR10P.jpg ‎ (top)
• 11:11, 20 August 2010 (diff | hist) N File:PCR9P.jpg ‎ (top)
• 11:11, 20 August 2010 (diff | hist) N File:PCR8bP.jpg ‎ (top)
• 11:10, 20 August 2010 (diff | hist) N File:PCR8aP.jpg ‎ (top)
• 11:10, 20 August 2010 (diff | hist) N File:PCR7P.jpg ‎ (top)
• 11:10, 20 August 2010 (diff | hist) N File:PCR6bP.jpg ‎ (top)
• 11:10, 20 August 2010 (diff | hist) N File:PCR6aP.jpg ‎ (top)
• 11:09, 20 August 2010 (diff | hist) N File:PCR5P.jpg ‎ (top)
• 11:09, 20 August 2010 (diff | hist) N File:PCR4P.jpg ‎ (top)
• 11:08, 20 August 2010 (diff | hist) N File:PCR3bP.jpg ‎ (top)
• 11:08, 20 August 2010 (diff | hist) N File:PCR3aP.jpg ‎ (top)
• 11:08, 20 August 2010 (diff | hist) N File:PCR2P.jpg ‎ (top)
• 11:07, 20 August 2010 (diff | hist) N File:PCR1bP.jpg ‎ (top)
• 11:07, 20 August 2010 (diff | hist) N File:PCR1aP.jpg ‎ (top)
• 11:05, 20 August 2010 (diff | hist) Team:LMU-Munich/Schedule ‎ (→PCR and mutagenisis of the digestion sites)
• 09:40, 20 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive ‎
• 08:23, 20 August 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Undergrads)
• 08:21, 20 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 08:21, 20 August 2010 (diff | hist) N File:Maria.jpg ‎ (top)
• 08:20, 20 August 2010 (diff | hist) N Team:LMU-Munich/Team/Maria ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Maria Drexler ==Contact Info== *Maria Drexler *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in Bi...)
• 07:46, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 07:45, 20 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 18:57, 19 August 2010 (diff | hist) Team:LMU-Munich/Schedule ‎
• 18:56, 19 August 2010 (diff | hist) Team:LMU-Munich/Functional Principle ‎
• 18:55, 19 August 2010 (diff | hist) Team:LMU-Munich/Functional Principle ‎
• 18:52, 19 August 2010 (diff | hist) N Team:LMU-Munich/Sequences/LctO ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
• 18:52, 19 August 2010 (diff | hist) N Team:LMU-Munich/Sequences/AurF ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
• 18:51, 19 August 2010 (diff | hist) N Team:LMU-Munich/Sequences/PduC ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
• 18:51, 19 August 2010 (diff | hist) N Team:LMU-Munich/Sequences/PduD ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
• 18:51, 19 August 2010 (diff | hist) N Team:LMU-Munich/Sequences/Pdu Operon ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 18:50, 19 August 2010 (diff | hist) Team:LMU-Munich/Sequences ‎
• 18:46, 19 August 2010 (diff | hist) Team:LMU-Munich/Schedule ‎
• 18:22, 19 August 2010 (diff | hist) N Team:LMU-Munich/Azo Switch/crosslinks/Picture gallery ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} {{:Team:LMU-Munich/Templates/Page Footer}})
• 18:21, 19 August 2010 (diff | hist) Team:LMU-Munich/Schedule ‎
• 18:21, 19 August 2010 (diff | hist) Team:LMU-Munich/Sequences ‎
• 18:11, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 18:10, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 18:04, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 15:45, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 14:05, 19 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎
• 13:40, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up ‎ (top)
• 13:10, 19 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 13:10, 19 August 2010 (diff | hist) N File:Erik2.jpg ‎ (top)
• 13:09, 19 August 2010 (diff | hist) Team:LMU-Munich/Team/Erik ‎
• 13:09, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Erik ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Erik Fumi ==Contact Info== *Erik Fumi *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in Biology, LM...)
• 13:05, 19 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 13:04, 19 August 2010 (diff | hist) N File:Marisa.jpg ‎ (top)
• 13:03, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Marisa ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Marisa Kurz ==Contact Info== *Marisa Kurz *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in Chemi...) (top)
• 12:57, 19 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 12:55, 19 August 2010 (diff | hist) N File:Nicolas.jpg ‎ (top)
• 12:55, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Nicky ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Nicolas Keller ==Contact Info== *Nicolas Keller *Ludwig Maximilians University (LMU) ==Education== * 2012 (expe...) (top)
• 12:46, 19 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 12:44, 19 August 2010 (diff | hist) N File:Laura2.jpg ‎ (top)
• 12:44, 19 August 2010 (diff | hist) Team:LMU-Munich/Team/Laura ‎ (top)
• 12:42, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Laura ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Laura Kleinknecht ==Contact Info== *Laura Kleinknecht *Ludwig Maximilians University (LMU) ==Education== * 2010 B...)
• 12:36, 19 August 2010 (diff | hist) Team:LMU-Munich/Team/Corinna ‎ (top)
• 12:35, 19 August 2010 (diff | hist) Team:LMU-Munich/Team/Corinna ‎
• 12:35, 19 August 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Undergrads)
• 12:34, 19 August 2010 (diff | hist) N File:Corinna.jpg ‎ (top)
• 12:33, 19 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 12:31, 19 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 12:31, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Corinna ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Corrina Hofer ==Contact Info== *Corrina Hofer *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in...)
• 12:28, 19 August 2010 (diff | hist) N File:Corrina.jpg ‎ (top)
• 12:23, 19 August 2010 (diff | hist) Team:LMU-Munich/Team/Jens ‎ (top)
• 12:21, 19 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 12:15, 19 August 2010 (diff | hist) N Team:LMU-Munich/Team/Franzi ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Franziska Häfele ==Contact Info== *Franziska Häfele *Ludwig Maximilians University (LMU) ==Education== * 2011 ...) (top)
• 12:13, 19 August 2010 (diff | hist) N File:Franzi.jpg ‎
• 11:37, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 11:34, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 11:33, 19 August 2010 (diff | hist) N File:19 8 10 apo.jpg ‎ (top)
• 11:33, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 11:32, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 11:31, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 09:45, 19 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation ‎
• 09:44, 19 August 2010 (diff | hist) N Team:LMU-Munich/Outer BMC ‎ (Team:LMU-Munich/Outer BMC moved to Team:LMU-Munich/Sequences) (top)
• 09:44, 19 August 2010 (diff | hist) m Team:LMU-Munich/Sequences ‎ (Team:LMU-Munich/Outer BMC moved to Team:LMU-Munich/Sequences)
• 09:43, 19 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation ‎
• 09:42, 19 August 2010 (diff | hist) N Team:LMU-Munich/work progress ‎ (Team:LMU-Munich/work progress moved to Team:LMU-Munich/Schedule) (top)
• 09:42, 19 August 2010 (diff | hist) m Team:LMU-Munich/Schedule ‎ (Team:LMU-Munich/work progress moved to Team:LMU-Munich/Schedule)
• 09:41, 19 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation ‎
• 09:40, 19 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation ‎ (Undo revision 53189 by JB (Talk))
• 09:38, 19 August 2010 (diff | hist) Team:LMU-Munich/Templates/Pathway Navigation ‎
• 09:37, 19 August 2010 (diff | hist) N Team:LMU-Munich/BMC ‎ (Team:LMU-Munich/BMC moved to Team:LMU-Munich/Functional Principle) (top)
• 09:37, 19 August 2010 (diff | hist) m Team:LMU-Munich/Functional Principle ‎ (Team:LMU-Munich/BMC moved to Team:LMU-Munich/Functional Principle)
• 09:05, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/2 Highly competent cells ‎ (→Preparing seed stocks) (top)
• 09:03, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/2 Highly competent cells ‎ (→Preparing competent cells)
• 08:20, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-19-2010)
• 08:17, 19 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-18-2010)
• 16:51, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Undergrads)
• 16:47, 18 August 2010 (diff | hist) N User:JB ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Julia Bartels ==Contact Info== *Julia Bartels *Ludwig Maximilians University (LMU) ==Education== * 2011 (expecte...) (top)
• 16:29, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-18-2010)
• 16:28, 18 August 2010 (diff | hist) N File:18 8 10 apo.jpg ‎ (top)
• 16:20, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-18-2010)
• 16:19, 18 August 2010 (diff | hist) N File:18 8 10 apo.Tif ‎ (top)
• 16:06, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-18-2010)
• 15:50, 18 August 2010 (diff | hist) Team:LMU-Munich/Team/Grace ‎ (→(Research) Interests)
• 15:49, 18 August 2010 (diff | hist) Team:LMU-Munich/Team/Grace ‎ (→Education)
• 15:13, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎
• 15:12, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA replication+PCR)
• 15:12, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎
• 15:11, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/PCR key ‎ (top)
• 15:10, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/PCR key ‎
• 15:08, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/PCR key ‎
• 15:01, 18 August 2010 (diff | hist) N File:Mutation.jpg ‎ (top)
• 15:00, 18 August 2010 (diff | hist) N File:Template.jpg ‎ (top)
• 15:00, 18 August 2010 (diff | hist) N File:Primer.jpg ‎ (top)
• 14:59, 18 August 2010 (diff | hist) N File:Overhang.jpg ‎ (top)
• 14:56, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/PCR key ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} {| |- |1TreF 56°C: |#Number: consecutive numbering on PCR plan |- | |#Tre: Abbreviation of gene of interest |- | |#F: Forward Primer |- | |#56°...)
• 14:42, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Undergrads)
• 14:38, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Grace ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Mengzhe Wang ==Contact Info== *Mengzhe Wang (Grace) *Ludwig Maximilians University (LMU) ==Education== * 2011 (ex...)
• 13:38, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 13:37, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA replication+PCR)
• 13:37, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎
• 13:34, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/Primer16 ‎ (top)
• 13:33, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/Primer20 ‎ (top)
• 13:32, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/Primer19 ‎ (top)
• 13:32, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer19 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="# FF6600">CGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACC</font> C TCTAGA A GCGGCCGC GAATTC {{:Team:LMU-Munich/Te...)
• 13:31, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/Primer18 ‎ (top)
• 13:31, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule/Primer18 ‎
• 13:30, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer18 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FFFF00">GGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCG</font> T ACTAGT A GCGGCCG CTGCAG {{:Team:LMU-Munich/Temp...)
• 13:28, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer23 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">TCATCACACTTTCCGCTTTTTC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 13:27, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer22 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">ATGGATACCTACGCCGGAGC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 13:25, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer21 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">TTACTTGTACAGCTCGTCCATG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 13:25, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer20 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G CCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGG <font color="#FF0000">GTAAGCAAGGGCGAGGAGC</font> {{:Team:LMU-Munich/Templa...)
• 13:23, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA replication+PCR)
• 13:21, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 13:20, 18 August 2010 (diff | hist) N File:PCR10.jpg ‎ (top)
• 13:20, 18 August 2010 (diff | hist) N File:PCR9.jpg ‎ (top)
• 13:17, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 13:12, 18 August 2010 (diff | hist) Team:LMU-Munich/Jump-or-die/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 13:08, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎
• 13:07, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer16 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A GAATTGGAAGTACAAGTTTC <font color="#FF0000">CCCTTGCGAGTACACCAATTC</font> {{:Team:LMU-Munich/Templates/Page Footer}})
• 13:06, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer15 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GGTGTCAGACAC<font color="#009933">G</font>AGTTGCACATTCCCTTCATCTG {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 13:04, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer14 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCAACT<font color="#009933">C</font>GTGTCTGACACCATGCTAGAC {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 12:37, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer13 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">ATGGCGATGCAAGCGGCC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 12:36, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer12 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">GCAGTGAAAAAAATGCTTTATTTG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 12:35, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer11 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">GATCATAATCAGCCATACCAC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 12:34, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer10 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A TCA<font color="#FF0000">TCATGATTTGAAGAATCTTCG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 12:32, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer9 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GTTGCAGCACCT<font color="#009933">A</font>CAGCCCACGGCAGAGAATGCC {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 12:31, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer8 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GGCTG<font color="#009933">T</font>AGGTGCTGCAACATGGTCTGG {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 12:30, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer7 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">GCTTCGGGGCAAGGCCC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 12:28, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer6 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">GGATCCTTTATGACCTAATTTAG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 12:11, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 12:10, 18 August 2010 (diff | hist) N File:Christina.jpg ‎ (top)
• 12:07, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Christina ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Christina Krönauer ==Contact Info== *Christina Krönauer *Ludwig Maximilians University (LMU) ==Education== ...) (top)
• 12:02, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer5 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GGATCG <font color="#009933">G</font>ATTCC <font color="#009933">G</font>GCAGTAGCAGGTGCTGGTGC {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 12:00, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer4 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} CTGC <font color="#009933">C</font>GGAAT <font color="#009933">C</font>CGATCCATATGAGCTGGAGTTCG {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 11:58, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer3 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">ATGGATGAATTGTACAAATC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 11:57, 18 August 2010 (diff | hist) N File:PCR8.jpg ‎ (top)
• 11:56, 18 August 2010 (diff | hist) N File:PCR7b.jpg ‎ (top)
• 11:56, 18 August 2010 (diff | hist) N File:PCR7a.jpg ‎ (top)
• 11:56, 18 August 2010 (diff | hist) N File:PCR6.jpg ‎ (top)
• 11:55, 18 August 2010 (diff | hist) N File:PCR5.jpg ‎ (top)
• 11:55, 18 August 2010 (diff | hist) N File:PCR4b.jpg ‎ (top)
• 11:55, 18 August 2010 (diff | hist) N File:PCR4a.jpg ‎ (top)
• 11:55, 18 August 2010 (diff | hist) N File:PCR3.jpg ‎ (top)
• 11:54, 18 August 2010 (diff | hist) N File:PCR2b.jpg ‎ (top)
• 11:54, 18 August 2010 (diff | hist) N File:PCR2a.jpg ‎ (top)
• 11:49, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 11:38, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer2 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} AGC CTGCAG CGGCCGC T ACTAGT A <font color="#FF0000">CCGCGGAGGCTGGATCG</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 11:36, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 10:40, 18 August 2010 (diff | hist) N Team:LMU-Munich/Cut'N'survive/Schedule/Primer1 ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} GCA GAATTC GCGGCCGC T TCTAGA G <font color="#FF0000">CTCGAGTTTACCACTCCC</font> {{:Team:LMU-Munich/Templates/Page Footer}}) (top)
• 10:37, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 10:37, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 10:36, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 10:34, 18 August 2010 (diff | hist) N File:PCR1.jpg ‎ (top)
• 10:30, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 10:30, 18 August 2010 (diff | hist) Team:LMU-Munich/Cut'N'survive/Schedule ‎ (→Aim 1: DNA reproduction+PCR)
• 10:20, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 10:17, 18 August 2010 (diff | hist) N File:Benny.jpg ‎ (top)
• 10:16, 18 August 2010 (diff | hist) Team:LMU-Munich/Team/Benny ‎
• 10:16, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Benny ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Julia Bartels ==Contact Info== *Benny Clanner *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in Ch...)
• 09:59, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 09:58, 18 August 2010 (diff | hist) N File:Emanuel.jpg ‎ (top)
• 09:58, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Emanuel ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Emanuel Stiegler ==Contact Info== *Emanuel *Ludwig Maximilians University (LMU) ==Education== * 2010 BSc in Bio...) (top)
• 09:29, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 09:29, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 09:27, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 09:26, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎
• 09:24, 18 August 2010 (diff | hist) N File:TeamLMU.JPG ‎ (top)
• 09:07, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Undergrads)
• 09:07, 18 August 2010 (diff | hist) Team:LMU-Munich/Team ‎ (→Undergrads)
• 09:06, 18 August 2010 (diff | hist) N File:Julia3.jpg ‎ (top)
• 09:04, 18 August 2010 (diff | hist) N File:Julia2.jpg ‎ (top)
• 09:04, 18 August 2010 (diff | hist) N Team:LMU-Munich/Team/Julia ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Julia Bartels ==Contact Info== *Julia Bartels *Ludwig Maximilians University (LMU) ==Education== * 2011 (expecte...) (top)
• 08:50, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-18-2010)
• 07:22, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 07:22, 18 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 18:45, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 18:37, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 18:37, 17 August 2010 (diff | hist) N File:17.8.2010 PCR6.jpg ‎ (top)
• 18:26, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 18:24, 17 August 2010 (diff | hist) N File:17.8.2010PCR6.jpg ‎ (top)
• 16:42, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 16:34, 17 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences ‎ (top)
• 16:34, 17 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences ‎
• 16:33, 17 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Seqences ‎ (top)
• 16:33, 17 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Seqences ‎
• 16:32, 17 August 2010 (diff | hist) Team:LMU-Munich/Jump-In-Variety/Genomic Map/Seqences ‎
• 16:29, 17 August 2010 (diff | hist) Team:LMU-Munich/TEV-System/Genomic Map/Sequences ‎
• 16:23, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up ‎
• 16:20, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 15:21, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up ‎
• 15:20, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up ‎
• 15:20, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up ‎
• 15:19, 17 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/12 Gel extraction or PCR Clean up ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} <b>Gel extraction or PCR Clean Up</b> Source:http://www.biodee.net/UploadFile/Up-2009-11-26_633948249752287808-a9281.pdf <b>Gel Slice and PCR Pr...)
• 15:16, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 14:54, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:53, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:49, 17 August 2010 (diff | hist) N File:Metabion.jpg ‎ (top)
• 14:46, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:45, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:44, 17 August 2010 (diff | hist) N File:Fermentas.gif ‎
• 14:41, 17 August 2010 (diff | hist) N File:Gbo logo.png ‎ (top)
• 14:40, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:11, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:10, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:09, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:08, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:07, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:04, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 14:01, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:57, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:56, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:53, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:52, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:50, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:44, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:44, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:42, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:41, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:40, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:35, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:34, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:33, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:30, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:29, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:28, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:21, 17 August 2010 (diff | hist) Team:LMU-Munich ‎
• 13:18, 17 August 2010 (diff | hist) N File:Eurofins.jpg ‎ (top)
• 13:13, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 13:12, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-13-2010)
• 13:10, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/11 Agarose gel electrophoresis ‎
• 13:09, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/11 Agarose gel electrophoresis ‎
• 13:07, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/11 Agarose gel electrophoresis ‎
• 13:06, 17 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/11 Agarose gel electrophoresis ‎ (New page: 1kb DNA Ladder used from Promega)
• 13:04, 17 August 2010 (diff | hist) N File:DNALadder.gif ‎ (top)
• 13:01, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 12:55, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 12:55, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 12:54, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 12:53, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 12:52, 17 August 2010 (diff | hist) N File:17 8 10 2 apo.jpg ‎ (top)
• 12:51, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 12:50, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 12:49, 17 August 2010 (diff | hist) File:17 8 10 1 apo.jpg ‎ (uploaded a new version of "Image:17 8 10 1 apo.jpg") (top)
• 12:46, 17 August 2010 (diff | hist) N File:17 8 10 1 apo.jpg ‎
• 12:45, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 12:39, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-17-2010)
• 09:43, 17 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/10 PCR with Pfu ‎ (top)
• 18:49, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 18:47, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/10 PCR with Pfu ‎
• 18:47, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/10 PCR with Pfu ‎
• 18:47, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/10 PCR with Pfu ‎
• 18:46, 16 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/10 PCR with Pfu ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Source: Promega Usage Information for the Pfu Polymerase In a sterile, nuclease free PCR-tube mix following components: {| |- |Component |Volume...)
• 18:31, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 18:27, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 18:26, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 18:25, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 18:24, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 18:22, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 18:20, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 18:18, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 18:17, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 18:16, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 18:07, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 17:57, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-16-2010)
• 17:52, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-15-2010)
• 17:52, 16 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-14-2010)
• 20:28, 14 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-13-2010)
• 20:04, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎
• 14:47, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-13-2010)
• 14:02, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-12-2010)
• 14:02, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-12-2010)
• 14:01, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-13-2010)
• 13:57, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-13-2010)
• 13:21, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/7 Measurement of competence ‎ (→Measurement of competence) (top)
• 13:21, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/7 Measurement of competence ‎ (→Measurement of competence)
• 13:20, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/7 Measurement of competence ‎ (→Measurement of competence)
• 13:19, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/8 SOC medium ‎ (top)
• 13:17, 13 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/8 SOC medium ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Source: http://partsregistry.org/SOC == Summary == SOC Medium. Used in bacterial transformation. == Ingredients == *SOB *20 mM glucose ==...)
• 13:16, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 13:15, 13 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/7 Measurement of competence ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Source:http://partsregistry.org/Help:Protocols/Competent_Cells ===Measurement of competence=== * Transform 50 μl of cells with 1 μl of stan...)
• 13:13, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 13:12, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/2 Highly competent cells ‎
• 13:11, 13 August 2010 (diff | hist) N Team:LMU-Munich/Notebook/Protocols/6 SOB medium ‎ (New page: {{:Team:LMU-Munich/Templates/Page Header}} Source:http://partsregistry.org/SOB == Summary == SOB Medium. Used in growing bacteria for preparing chemically competent cells == Ingredients...) (top)
• 13:09, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook ‎ (→Protocols)
• 13:07, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/2 Highly competent cells ‎
• 12:57, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-10-2010)
• 12:56, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-12-2010)
• 12:55, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-13-2010)
• 12:53, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-13-2010)
• 12:53, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-13-2010)
• 12:52, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-12-2010)
• 12:52, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-12-2010)
• 12:50, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-10-2010)
• 12:48, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎ (→8-10-2010)
• 12:47, 13 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Apoptosis ‎
• 11:15, 12 August 2010 (diff | hist) Team:LMU-Munich/Pathway ‎
• 08:36, 12 August 2010 (diff | hist) Team:LMU-Munich/Notebook/Protocols/4 Plasmid extraction from cells ‎ (top)