Data
pDRAW32
pDRAW32 is a program which draws plasmid or linear gene, and it scans restriction enzyme site of its own DB.
You can see RFLP pattern.
You can download it at http://www.acaclone.com/
Protein information for virus-inspired Drug delivery system.
HNMT
Entrez ID : 3176
- related mRNA or protein sequence
NM_001024074.2 → NP_001019245.1
- histamine N-methyltransferase isoform 2
NM_001024075.1 → NP_001019246.1
- histamine N-methyltransferase isoform 3
NM_006895.2 → NP_008826.1
- histamine N-methyltransferase isoform 1
(3 kinds of isoform is obtained by alternative splicing)
Human Coronaviral Spike protein.
- NL63 strain
Nucleotide sequence is in
- http://www.ncbi.nlm.nih.gov/nuccore/49169782/?from=20472&to=24542&report=fasta (Gene ID : 2943499)
protein sequence is in
- http://www.ncbi.nlm.nih.gov/protein/45655909?report=genpept
SARS starin
nucleotide sequence is in
- http://www.ncbi.nlm.nih.gov/nuccore/30271926/?from=21492&to=25259&report=fasta (Gene ID : 1489668)
protein sequence is in
- http://www.ncbi.nlm.nih.gov/protein/29836496?report=genpept
SARS-CoV Spike Protein
It seems very hard to get SARS-CoV spike protein cDNA in our country.
Since there was no patient of SARS, few researchers used it.
We can get the cDNA by 200 dollars from this overseas website.
- http://www.bcgsc.ca/project/sars/SARS/clones
It is not easy to bring cDNA in here, so we should keep finding a better way.
Sequence we used
1. Cytokine Receptor
- 1.1 ER Receptor | making
- 1.2 HER2 Receptor | making
2. JAK JAK.fasta
3. STAT STAT.fasta
4. GFP GFP.fasta
ER, HER2 Receptor signal peptide sequence is P07110[1-24]. If we reverse-translate MKDRIPFAVNNITCVILLSLFCNA we can obtain outer membrane usher protein papC, Escherichia coli signal peptide
- ATGAAGGACAGCATTCCATTCGCAGTAAACAACATCACGTGTGTCATACTGCTGTCCTTCTTCTGCAATGCG
|