BLASTN 2.2.24+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. RID: A6BRUCM6111 Query= pSB1C3.nLMWP.SOD.hi4_premix -- 194..448 of sequence Length=255 Score E Sequences producing significant alignments: (Bits) Value lcl|2489 73.1 2e-17 ALIGNMENTS >lcl|2489 Length=857 Score = 73.1 bits (39), Expect = 2e-17 Identities = 39/39 (100%), Gaps = 0/39 (0%) Strand=Plus/Plus Query 108 GCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGG 146 ||||||||||||||||||||||||||||||||||||||| Sbjct 781 GCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGG 819