Team:Macquarie Australia/Safety
From 2010.igem.org
Biosafety page for Wiki...
1. Would any of your project ideas raise safety issues?
When working in any laboratory there are always risks involved that need to be taken into consideration. The Macquarie University 2010 iGEM team took precautionary measures designed to minimize the risks that could not only potentially affect individual researchers but also the public and the surrounding environment.
Each individual team member completed a laboratory induction-training course and signed an acknowledgment to confirm that they had completed the course. The signed acknowledgement included safety measurements such as where any fire extinguishers and other safety equipment were located as well as the safe use of all machinery in the lab.
Additionally, a seminar was provided by the Macquarie University Chemistry & Biomolecular Science Department’s Technical Manager of Chemical Safety officer – Jenny Minard, to explain Workplace Health and Safety. Topics including the safe storage and documentation of chemicals (such as MSDS’s and risk assessment forms) were discussed in detail.
In the laboratory, we always use protective clothing such as lab coats and gloves when handling all bacterial cultures and DNA samples. The bacterial strains used in our experiments are considered non-hazardous and non-infectious and culture volumes were kept to a minimum so that any risk of spread was minimized.
No harmful chemicals were required for use in these experiments. In particular, Ethidium bromide is not used to bind DNA for agarose gel visualization because of its carcinogenic properties. At Macquarie University, the use of ethidium bromide has instead been replaced with newer staining reagents such as GelRed.
A Material Safety Data Sheet was completed for all chemicals and reagents used in the laboratory. All workspaces were kept clean to keep sterile conditions and bacterial waste material was auto-claved prior to disposal.
2. Do any of the new BioBrick parts (or devices) that you made this year raise any safety issues?
No, we do not consider the two cloned genes to be Biosafety hazards. The Bacteriophytochrome gene is a pigment-binding protein and the Heme Oxygenase gene is a metabolic enzyme. This means that we did not have to document any issues in the registry.
3. Is there a local Biosafety group, committee, or review board at your institution?
There is a local Biosafety committee at Macquarie University and all experiments which may involve biosafety risk and/or which involve cloning or transformation of organisms within the University need to obtain approval by the committee before proceeding.
The committee adheres to Australian Government’s legislation: Gene Technology Regulations Act, 2000 . The Biosafety committee granted approval for the 2010 Macquarie University iGEM project prior to commencement of in vivo methods such as cloning and expression (approval number REF: 5201001087EX).
Additionally, as mentioned above the Chemistry & Biomolecular Science Department’s Technical Manager of Chemical Safety officer – Jenny Minard was made fully aware of all chemicals and reagents to be used in the experiment and her approval was obtained.
Occupational Health & Safety – Biosafety:
http://web.science.mq.edu.au/intranet/ohs/hazsub/biosafety.htm#Biosafety
Biosafety Research Ethics – About the Biosafety committee:
http://www.research.mq.edu.au/for/researchers/how_to_obtain_ethics_approval/biosafety_research_ethics
For further information on the Australian legislation, in particular the Gene Regulations Act please click on the following link:
Australian Government – Office of the Gene Technology Regulator
http://www.ogtr.gov.au/
4. Do you have any other ideas how to deal with safety issues that could be useful for future iGEM competitions? How could parts, devices and systems be made even safer through biosafety engineering?
As the iGEM competition is getting more popular each year the number of parts to be submitted is growing. Better documentation and standardization of parts is required.
Suggestion for amended BiobrickTM instructions
The instructions that can be accessed on http://partsregistry.org/ Help:Spring_2010_DNA_distribution provide an explanation on how to use the linearised plasmid backbone. We found these instructions to be slightly confusing and a little misleading, particularly as it says "All you need to do is cut with EcoRI, PstI and DpnI to leave two ends ready to be ligated to a Biobrick™ part". Used in this way, it effectively incapacitates the ability to further use this BioBrick in an assembly process.
The protocol given (http://partsregistry.org/Help:Protocols/Linearized_Plasmid_Backbones) is one that describes how to use these linearised backbones to assemble two parts together in a single ligation reaction. This is not the same as using the linearised backbone to insert a single Biobrick™ part into the linearised vector as implied in the usage instructions.
Below is a modification of this protocol to describe how to ligate in a single Biobrick part as well as renaming the use as previously described to make the usage clearer.
Primers
gccgctgcagtccggcaaaaaaacg,SB-prep-3P
atgaattccagaaatcatccttagcg,SB-prep-2Ea
Dilute to 30 pmol/ul
PCR
• 100 ul PCR supermix high fidelity
• 0.7 ul each primer
• 0.5 ul template DNA at 10 ng/ul (Note: Do not use a sample of linearized plasmid backbones
(pcred) as a template.)cycle 94/30s; 36x(94/30s;55/30s;68/3:00 min); 68/10 min Ethanol precipitate (This step does not appear necessary) Digest with DpnI enzyme in 100 ul 2 ul DpnI Incubate 37/overnight hour; heat kill 80/20 min
Cleanup
•Add 500 ul Qiagen buffer PB
•Spin through a column twice, discard flowthrough
•Wash 1x with 700 ul buffer PB
•Wash 2x with 760 ul buffer PE
•Discard liquid, spin dry at 17000g for 3 min
•Elute into a new tube twice with 50 ul of TE (100 ul total)
Quality Control
•Run 3 ul on a gel to verify the correct band and concentration and lack of side products
• Quantify concentration on a nanodrop. Expect around 10 ug from a 100 ul PCR reaction (100 ng/ul in 100 ul)
Perform a ligation test
Test for both the EcoRI and PstI cutting and ligation efficiency
• Digest in a 15 ul final volume
•1 ul DNA (approximately 100 ng)
•1.5 ul NEB Buffer 2 (Not buffer 4; see E-Gel Buffer Compatibility)
•0.15 ul BSA
•0.5 ul either EcoRI-HF or PstI enzyme (not both!)
•12 ul water
•Digest 37/1 hour; 80/20 min
•Add 5 ul of a 4x ligation master mix
•Ligate 30 min at room temperature
•Heat kill the ligase 80/20 min
•run all 20 ul on a gel
•Compare intensity of the single and double length bands. Good product should show mostly double length bands.
Ligation master mix
• 50 ul final
• 20 ul T4 DNA ligase buffer
•5 ul T4 DNA ligase
•25 ul water
Transformation test
•Transform 1 ul of the diluted final product into highly competent cells
•Control transform 10 pg of pUC19
•plate on the appropriate antibiotic and observe few colonies. Any colonies represent background to the three antibiotic assembly process
•Quantify the effective amount of remaining circular DNA able to transform
Bulk production
•PCR with PCR supermix high fidelity
add 19 ul primer SB-prep-2Eb•add 19 ul primer SB-prep-3P
•add 1 ul 10 ng/ul template DNA
•aliquot 100ul/well in 96 well plate
•cycle 1 min/94C 40x(30s 94; 30s 58; 3min 68) 10 min/68 hold 4C
purify Promega SV96 pcr cleanup
•Add 100 ul pcr cleanup buffer using 8 well pipet, mix
•transfer to cleanup plate, allow to sit 1 min, vacuum dry
•wash 3x with 200 ul 80% ethanol, vacuum after each
•remove from the wash manual, blot on paper towels, reinstall in wash manifold
•dry 4 min on vacuum
•transfer to collection manifold
•elute with 2x 50 ul TE buffer
• Measure concentration on nanodrop, adjust to 25 ng/ul with TE
Use for assembly of two biobrick parts
•Prepare 2x Enzyme master mix (25 ul)
•5.0 ul NEB Buffer 4
•0.5 ul NEB BSA
•0.5 ul EcoRI-HF
•0.5 ul PstI
•0.5 ul DpnI
•18 ul water
•flick mix, spin down
Digest construction plasmid
•Add 4 ul prepared construction plasmid (25 ng/ul)
•Add 4 ul 2x Enzyme mix
•digest in a pcr cycler 37C/30 min, heat kill 80C/20 min using a hot lid
Ligation
•Add 2ul of digested construction plasmid (25 ng)
•Add equimolar amount of EcoRI-HF SpeI digested fragment which will stay at 5' end of Biobrick assembly (< 3 ul)
•Add equimolar amount of XbaI PstI digested fragment which will stay at 5' end of Biobrick assembly (< 3 ul)
•Add 1 ul NEB T4 DNA ligase buffer
•Add 0.5 ul T4 DNA ligase
•Add water to 10 ul if necessary
•ligate 16C/30 min, heat kill 80C/20 min
•transform with 1-2 ul of product
Use for insertion of a single BioBrick part or composite part from a non-registry plasmid into linearized iGEM plasmid
•Prepare 2x Enzyme master mix (25 ul)
•5.0 ul NEB Buffer 4
•0.5 ul NEB BSA
•0.5 ul EcoRI
•0.5 ul PstI
•0.5 ul DpnI
•18 ul water
•flick mix, spin down
Digest construction plasmid•Add 4 ul prepared construction plasmid (25 ng/ul)
•Add 4 ul 2x Enzyme mix
•digest in a pcr cycler 37C/30 min, heat kill 80C/20 min using a hot lid
Ligation
•Add 2ul of digested construction plasmid (25 ng)
•Add equimolar amount of gel purified EcoRI and PstI digested Biobrick part (< 3 ul)
•Add 1 ul NEB T4 DNA ligase buffer
•Add 0.5 ul T4 DNA ligase
•Add water to 10 ul if necessary
•ligate 16C/30 min, heat kill 80C/20 min
•transform with 1-2 ul of product
"

