Team:Kyoto/Materials

From 2010.igem.org

Contents

Materials

Strains

NameGenotype and/or Relevant FeaturesSource or Reference
TOP10F-, mcrA, Δ(mrr-hsdRMS-mcrBC), φ80lacZΔM15, ΔlacX74, nupG, recA1, araD139, Δ(ara-leu)7697, galE15, galK16 rpsL(StrR), endA1, λ-Invitrogen
KRX[F′, traD36, ΔompP, proA+B+, lacIq, Δ(lacZ)M15] ΔompT, endA1, recA1, gyrA96 (Nalr), thi-1, hsdR17 (rk, mk+), e14– (McrA–), relA1, supE44, Δ(lac-proAB), Δ(rhaBAD)::T7 RNA polymerase.Laboratory of Gene Biodynamics, Graduate School of Biostudies, Kyoto University
(Promega [1])
BL21(DE3)pLysSF–, ompT, hsdSB (rB, mB), dcm, gal, λ(DE3), pLysS, Cmr.Promega [2]

DNA

NameSource or Reference
Lambda Phage (cI857 Sam7)DNA Digested Markers (#3403 λ-Hind III digest) from Takara Bio [3]
http://www.ncbi.nlm.nih.gov/nuccore/NC_001416

Primers

DateNameSequence
07/21S Forward (Same as SRRz Forward)gGAATTCGCGGCCGCTTCTAGAGgcctggatttgttctatcagtaatcga
07/21S ReverseCTGCAGCGGCCGCTACTAGTAttattgatttctaccatcttctactccggc
07/21SRRz ReverseCTGCAGCGGCCGCTACTAGTAtgagttgcccatcgatatgggc
07/28ΔTMD1 Forwardcgcggcagatataatggcggt
07/28ΔTMD1 Reversegtcatgtttttctggcatcttcatgtct
08/19, 08/24Sam7 Forwardggttcattcgtgaccttctcgacttc
08/19, 08/24Sam7 Reverseaggcgataatggcgcacatc
08/20SRRz Forward RetrygGAATTCGCGGCCGCTTCTAGAGgagcaaatccccttattgggggtaagacatg
08/20SRRz Reverse RetryCTGCAGCGGCCGCTACTAGTAgcaactctatctgcactgctcattaatatacttctgg
08/23, 08/24Deletion of Upstream Forwardgagcaaatccccttattgggggtaagacatg
08/23, 08/24Deletion of Upstream Reversectctagaagcggccgcgaattcc
09/13, 09/22Add J23105 ForwardCAGTCCTAGGTACTATGCTAGCtactagtagcggccgctgc
09/13, 09/22Add J23105 ReverseAGCTAGCCGTAAActctagtatataaacgcagaaaggcccacc
10/10Deletion of GFP Forward (Primer1)ccaggcatcaaataaaacgaaaggctc
10/10Deletion of GFP-DT Forward (Primer2)tactagtagcggccgctgc
10/10Deletion of GFP, GFP-DT Reverse (Primer3)ctctagtattattgatttctaccatcttctactcc
- VF2 (BBa_G00100)tgccacctgacgtctaagaa
- VF (BBa_G00101)attaccgcctttgagtgagc