Team:Cornell/Project/Design
From 2010.igem.org
Proposed DesignWhen designing ClyA-protein BioBrick parts, we realized that the conventional RFC 10 standard would not work because ligation of two RFC 10 parts produces an eight-base-pair scar site, a linker sequence that would cause our fusion protein to be read out of frame. We initially spent a significant amount of time trying to devise methods of adding one or several spacer base pairs to the ClyA sequence to address this issue, but it was soon realized that an in-frame scar site would contain a stop codon. We then considered using the Silver (Biofusion) Standard, RFC 23, to produce our ClyA fusions. However, RFC 23 confers several disadvantages such as a rare AGA codon (encoding Argenine) in scar sites, which can prevent protein over-expression in E. coli3. After much deliberation, we decided to use the Freiburg (Fusion) standard, RFC 25, because it produces benign protein scars while allowing proteins to be fused in frame4. RFC 25 preserves the native ATG start codon in the first protein by making the first protein coding region into an “N-part” BioBrick, a construct flanked by the RFC 10 prefix and the Fusion part suffix. Downstream proteins are made into Fusion parts containing RFC 25 suffixes and prefixes4. Furthermore, RFC 25 can be converted to RFC 23 parts5 but conversion the other way around is not possible. In RFC 25, ClyA would serve as the “N part,” and the protein of interest would be the Fusion part. Following is the RFC 25 prefix and suffix: N Part Prefix - Gaattccgcggccgcttctag Regular Prefix - gaattccgcggccgcttctagatggccggc Suffix - accggttaatactagtagcggccgctgcag Constructs: ClyA N-part Fluorescent protein construct (fusion part) Antibody fragment construct (fusion part) Future work Constructing a ClyA-streptavidin fusion and engineering it into E. coli will enable us to create OMVs that can bind to biotinylated surfaces in addition to performing other functions such as fluorescing in different colors or binding to antigens of interest.
References[1] Kim, J. Y., Doody, A. M., Chen, D. J., Cremona, G. H., Shuler, M. L., Putnam, D., & DeLisa, M. P.(2008). Engineered Bacterial Outer Membrane Vesicles with Enhanced Functionality. J. Mol. Biol. 380, 51–66. [2] Chen, D. J., Osterrieder, N., Metzger, S. M., Buckles, E., Doody, A. M., DeLisa, M. P., & Putnam, D. (2010). Delivery of foreign antigens by engineered outer membrane vesicle vaccines. Proc Natl Acad Sci U S A. 107, 3099-3104. [3] http://dspace.mit.edu/handle/1721.1/32535 [4] http://dspace.mit.edu/bitstream/handle/1721.1/45140/BBF_RFC%2025.pdf?sequence=1 [5] http://dspace.mit.edu/bitstream/handle/1721.1/44961/BBFRFC24.pdf?sequence=1 |
"

